Cadmium-Induced Kidney Injury in Mice Is Counteracted by a Flavonoid-Rich Extract of Bergamot Juice, Alone or in Association with Curcumin and Resveratrol, via the Enhancement of Different Defense Mechanisms
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Drugs and Chemicals
2.3. Experimental Protocol
2.4. Urea Nitrogen and Creatinine Levels Quantification
2.5. Determination of Glutathione (GSH) and Glutathione Peroxidase (GPx) Content
2.6. Real-Time PCR Analyses
2.7. Histological Evaluation
2.8. Immunohistochemical Analysis for IL-1β and Nrf2
2.9. Morphometric Evaluation
2.10. Statistical Analysis
3. Results
3.1. Effects of Nutraceuticals on Urea Nitrogen and Creatinine Levels
3.2. Effects of Nutraceuticals on GSH and GPx Levels
3.3. Effects of Nutraceuticals on Apoptotis-Related Genes
3.4. Effects of Nutraceuticals on Nos2 and Il1b Gene Expression
3.5. Effects of Nutraceuticals on Nrf2, Nqo1 and Hmox1 Gene Expression
3.6. Histological and Morphometric Evaluation
3.7. Immunohistochemistry for IL-1β and Nrf2
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yang, Q.Z.; Hao, J.; Chen, M.X.; Li, G. Dermatopontin is a novel regulator of the CdCl2-induced decrease in claudin-11 expression. Toxicol. In Vitro 2014, 28, 1158–1164. [Google Scholar] [CrossRef] [PubMed]
- Babaknejad, N.; Moshtaghie, A.A.; Nayeri, H.; Hani, M.; Bahrami, S. Protective role of zinc and magnesium against cadmium nephrotoxicity in male wistar rats. Biol. Trace Elem. Res. 2016, 174, 112–120. [Google Scholar] [CrossRef] [PubMed]
- Brzoska, M.M.; Kaminski, M.; Dziki, M.; Moniuszko-Jakoniuk, J. Changes in the structure and function of the kidney of rats chronically exposed to cadmium. II. Histoenzymatic studies. Arch. Toxicol. 2004, 78, 226–231. [Google Scholar] [PubMed]
- Genchi, G.; Sinicropi, M.S.; Lauria, G.; Carocci, A.; Catalano, A. The effects of cadmium toxicity. Int. J. Environ. Res. Public Health 2020, 17, 3782. [Google Scholar] [CrossRef] [PubMed]
- Rahman, M.T.; Haque, N.; Abu Kasim, N.H.; De Ley, M. Origin, function, and fate of metallothionein in human blood. Rev. Physiol. Biochem. Pharmacol. 2017, 173, 41–62. [Google Scholar] [CrossRef] [PubMed]
- Morales, A.I.; Vicente-Sanchez, C.; Sandoval, J.M.; Egido, J.; Mayoral, P.; Arevalo, M.A.; Fernandez-Tagarro, M.; Lopez-Novoa, J.M.; Perez-Barriocanal, F. Protective effect of quercetin on experimental chronic cadmium nephrotoxicity in rats is based on its antioxidant properties. Food Chem. Toxicol. 2006, 44, 2092–2100. [Google Scholar] [CrossRef]
- Ansari, M.A.; Raish, M.; Ahmad, A.; Alkharfy, K.M.; Ahmad, S.F.; Attia, S.M.; Alsaad, A.M.S.; Bakheet, S.A. Sinapic acid ameliorate cadmium-induced nephrotoxicity: In vivo possible involvement of oxidative stress, apoptosis, and inflammation via NF-kappaB downregulation. Environ. Toxicol. Pharmacol. 2017, 51, 100–107. [Google Scholar] [CrossRef]
- Thevenod, F. Cadmium and cellular signaling cascades: To be or not to be? Toxicol. Appl. Pharmacol. 2009, 238, 221–239. [Google Scholar] [CrossRef]
- Gobe, G.; Crane, D. Mitochondria, reactive oxygen species and cadmium toxicity in the kidney. Toxicol. Lett. 2010, 198, 49–55. [Google Scholar] [CrossRef]
- Prozialeck, W.C.; Edwards, J.R. Mechanisms of cadmium-induced proximal tubule injury: New insights with implications for biomonitoring and therapeutic interventions. J. Pharmacol. Exp. Ther. 2012, 343, 2–12. [Google Scholar] [CrossRef] [Green Version]
- Fouad, A.A.; Jresat, I. Protective effect of telmisartan against cadmium-induced nephrotoxicity in mice. Life Sci. 2011, 89, 29–35. [Google Scholar] [CrossRef] [PubMed]
- Flora, S.J.; Pachauri, V. Chelation in metal intoxication. Int. J. Environ. Res. Public Health 2010, 7, 2745–2788. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Das, S.; Dewanjee, S.; Dua, T.K.; Joardar, S.; Chakraborty, P.; Bhowmick, S.; Saha, A.; Bhattacharjee, S.; De Feo, V. Carnosic acid attenuates cadmium induced nephrotoxicity by inhibiting oxidative stress, promoting Nrf2/HO-1 signalling and impairing TGF-BETA1/smad/collagen IV signalling. Molecules 2019, 24, 4176. [Google Scholar] [CrossRef] [Green Version]
- Mohamed, H.R.H. Alleviation of cadmium chloride-induced acute genotoxicity, mitochondrial DNA disruption, and ROS generation by chocolate coadministration in Mice Liver and Kidney Tissues. Biol. Trace Elem. Res. 2021. [Google Scholar] [CrossRef] [PubMed]
- Nazima, B.; Manoharan, V.; Miltonprabu, S. Grape seed proanthocyanidins ameliorates cadmium-induced renal injury and oxidative stress in experimental rats through the up-regulation of nuclear related factor 2 and antioxidant responsive elements. Biochem. Cell Biol. Biochim. Biol. Cell. 2015, 93, 210–226. [Google Scholar] [CrossRef]
- Luo, T.; Liu, G.; Long, M.; Yang, J.; Song, R.; Wang, Y.; Yuan, Y.; Bian, J.; Liu, X.; Gu, J.; et al. Treatment of cadmium-induced renal oxidative damage in rats by administration of alpha-lipoic acid. Environ. Sci. Pollut. Res. Int. 2017, 24, 1832–1844. [Google Scholar] [CrossRef]
- Micali, A.; Pallio, G.; Irrera, N.; Marini, H.; Trichilo, V.; Puzzolo, D.; Pisani, A.; Malta, C.; Santoro, G.; Laura, R.; et al. Flavocoxid, a natural antioxidant, protects mouse kidney from cadmium-induced toxicity. Oxid. Med. Cell. Longev. 2018, 2018, 9162946. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pallio, G.; Micali, A.; Benvenga, S.; Antonelli, A.; Marini, H.R.; Puzzolo, D.; Macaione, V.; Trichilo, V.; Santoro, G.; Irrera, N.; et al. Myo-inositol in the protection from cadmium-induced toxicity in mice kidney: An emerging nutraceutical challenge. Food Chem. Toxicol. 2019, 132, 110675. [Google Scholar] [CrossRef] [PubMed]
- Mannucci, C.; Navarra, M.; Calapai, F.; Squeri, R.; Gangemi, S.; Calapai, G. Clinical pharmacology of Citrus bergamia: A systematic review. Phytother. Res. PTR 2017, 31, 27–39. [Google Scholar] [CrossRef]
- Marino, A.; Paterniti, I.; Cordaro, M.; Morabito, R.; Campolo, M.; Navarra, M.; Esposito, E.; Cuzzocrea, S. Role of natural antioxidants and potential use of bergamot in treating rheumatoid arthritis. PharmaNutrition 2015, 3, 53–59. [Google Scholar] [CrossRef]
- Navarra, M.; Femia, A.P.; Romagnoli, A.; Tortora, K.; Luceri, C.; Cirmi, S.; Ferlazzo, N.; Caderni, G. A flavonoid-rich extract from bergamot juice prevents carcinogenesis in a genetic model of colorectal cancer, the Pirc rat (F344/NTac-Apc(am1137)). Eur. J. Nutr. 2020, 59, 885–894. [Google Scholar] [CrossRef] [PubMed]
- Filocamo, A.; Bisignano, C.; Ferlazzo, N.; Cirmi, S.; Mandalari, G.; Navarra, M. In vitro effect of bergamot (Citrus bergamia) juice against cagA-positive and-negative clinical isolates of Helicobacter pylori. BMC Complement. Altern. Med. 2015, 15, 256. [Google Scholar] [CrossRef] [Green Version]
- Cirmi, S.; Bisignano, C.; Mandalari, G.; Navarra, M. Anti-infective potential of Citrus bergamia Risso et Poiteau (bergamot) derivatives: A systematic review. Phytother. Res. PTR 2016, 30, 1404–1411. [Google Scholar] [CrossRef] [PubMed]
- Mollace, V.; Scicchitano, M.; Paone, S.; Casale, F.; Calandruccio, C.; Gliozzi, M.; Musolino, V.; Carresi, C.; Maiuolo, J.; Nucera, S.; et al. Hypoglycemic and hypolipemic effects of a new lecithin formulation of bergamot polyphenolic fraction: A double blind, randomized, placebo-controlled study. Endocr. Metab. Immune Disord. Drug Targets 2019, 19, 136–143. [Google Scholar] [CrossRef]
- Ferlazzo, N.; Cirmi, S.; Maugeri, A.; Russo, C.; Lombardo, G.E.; Gangemi, S.; Calapai, G.; Mollace, V.; Navarra, M. Neuroprotective effect of bergamot juice in 6-OHDA-induced SH-SY5Y cell death, an in vitro model of parkinson’s disease. Pharmaceutics 2020, 12, 326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Curro, M.; Risitano, R.; Ferlazzo, N.; Cirmi, S.; Gangemi, C.; Caccamo, D.; Ientile, R.; Navarra, M. Citrus bergamia juice extract attenuates beta-amyloid-induced pro-inflammatory activation of THP-1 cells through MAPK and AP-1 pathways. Sci. Rep. 2016, 6, 20809. [Google Scholar] [CrossRef] [Green Version]
- Ferlazzo, N.; Visalli, G.; Smeriglio, A.; Cirmi, S.; Lombardo, G.E.; Campiglia, P.; Di Pietro, A.; Navarra, M. Flavonoid fraction of orange and bergamot juices protect human lung epithelial cells from hydrogen peroxide-induced oxidative Stress. Evid. Based Complement. Altern. Med. eCAM 2015, 2015, 957031. [Google Scholar] [CrossRef]
- Ferlazzo, N.; Visalli, G.; Cirmi, S.; Lombardo, G.E.; Lagana, P.; Di Pietro, A.; Navarra, M. Natural iron chelators: Protective role in A549 cells of flavonoids-rich extracts of Citrus juices in Fe(3+)-induced oxidative stress. Environ. Toxicol. Pharmacol. 2016, 43, 248–256. [Google Scholar] [CrossRef]
- Maugeri, A.; Cirmi, S.; Minciullo, P.L.; Gangemi, S.; Calapai, G.; Mollace, V.; Navarra, M. Citrus fruits and inflammaging: A systematic review. Phytochem. Rev. 2019, 18, 1025–1049. [Google Scholar] [CrossRef]
- Maugeri, A.; Ferlazzo, N.; De Luca, L.; Gitto, R.; Navarra, M. The link between the AMPK/SIRT1 axis and a flavonoid-rich extract of Citrus bergamia juice: A cell-free, in silico, and in vitro study. Phytother. Res. 2019, 33, 1805–1814. [Google Scholar] [CrossRef]
- Musumeci, L.; Maugeri, A.; Cirmi, S.; Lombardo, G.E.; Russo, C.; Gangemi, S.; Calapai, G.; Navarra, M. Citrus fruits and their flavonoids in inflammatory bowel disease: An overview. Nat. Prod. Res. 2020, 34, 122–136. [Google Scholar] [CrossRef]
- Ferlazzo, N.; Cirmi, S.; Calapai, G.; Ventura-Spagnolo, E.; Gangemi, S.; Navarra, M. Anti-inflammatory activity of Citrus bergamia derivatives: Where do we stand? Molecules 2016, 21, 1273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferlazzo, N.; Micali, A.; Marini, H.R.; Freni, J.; Santoro, G.; Puzzolo, D.; Squadrito, F.; Pallio, G.; Navarra, M.; Cirmi, S.; et al. A flavonoid-rich extract from bergamot juice, alone or in association with curcumin and resveratrol, shows protective effects in a murine model of cadmium-induced testicular injury. Pharmaceuticals 2021, 14, 386. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Lee, B.M.; Kim, H.S. Potential protective roles of curcumin against cadmium-induced toxicity and oxidative stress. J. Toxicol. Environ. Health Part B Crit. Rev. 2021, 24, 95–118. [Google Scholar] [CrossRef]
- Avila-Rojas, S.H.; Lira-Leon, A.; Aparicio-Trejo, O.E.; Reyes-Fermin, L.M.; Pedraza-Chaverri, J. Role of autophagy on heavy metal-induced renal damage and the protective effects of curcumin in autophagy and kidney preservation. Medicina 2019, 55, 360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fu, X.; Li, M.; Tang, C.; Huang, Z.; Najafi, M. Targeting of cancer cell death mechanisms by resveratrol: A review. Apoptosis 2021, 26, 561–573. [Google Scholar] [CrossRef] [PubMed]
- Gal, R.; Deres, L.; Toth, K.; Halmosi, R.; Habon, T. The effect of resveratrol on the cardiovascular system from molecular mechanisms to clinical results. Int. J. Mol. Sci. 2021, 22, 10152. [Google Scholar] [CrossRef]
- Smoliga, J.M.; Baur, J.A.; Hausenblas, H.A. Resveratrol and health—A comprehensive review of human clinical trials. Mol. Nutr. Food Res. 2011, 55, 1129–1141. [Google Scholar] [CrossRef] [PubMed]
- Tabrizi, R.; Tamtaji, O.R.; Lankarani, K.B.; Akbari, M.; Dadgostar, E.; Dabbaghmanesh, M.H.; Kolahdooz, F.; Shamshirian, A.; Momen-Heravi, M.; Asemi, Z. The effects of resveratrol intake on weight loss: A systematic review and meta-analysis of randomized controlled trials. Crit. Rev. Food Sci. Nutr. 2020, 60, 375–390. [Google Scholar] [CrossRef]
- Gugliandolo, E.; Fusco, R.; D’Amico, R.; Peditto, M.; Oteri, G.; Di Paola, R.; Cuzzocrea, S.; Navarra, M. Treatment with a flavonoid-rich fraction of bergamot juice improved lipopolysaccharide-induced periodontitis in rats. Front. Pharmacol. 2018, 9, 1563. [Google Scholar] [CrossRef] [Green Version]
- Minutoli, L.; Micali, A.; Pisani, A.; Puzzolo, D.; Bitto, A.; Rinaldi, M.; Pizzino, G.; Irrera, N.; Galfo, F.; Arena, S.; et al. Flavocoxid protects against cadmium-induced disruption of the blood-testis barrier and improves testicular damage and germ cell impairment in mice [corrected]. Toxicol. Sci. 2015, 148, 311–329. [Google Scholar] [CrossRef] [Green Version]
- Benvenga, S.; Micali, A.; Pallio, G.; Vita, R.; Malta, C.; Puzzolo, D.; Irrera, N.; Squadrito, F.; Altavilla, D.; Minutoli, L. Effects of myo-inositol alone and in combination with seleno-lmethionine on cadmium-induced testicular damage in mice. Curr. Mol. Pharmacol. 2019, 12, 311–323. [Google Scholar] [CrossRef] [PubMed]
- Eleawa, S.M.; Alkhateeb, M.A.; Alhashem, F.H.; Bin-Jaliah, I.; Sakr, H.F.; Elrefaey, H.M.; Elkarib, A.O.; Alessa, R.M.; Haidara, M.A.; Shatoor, A.S.; et al. Resveratrol reverses cadmium chloride-induced testicular damage and subfertility by downregulating p53 and Bax and upregulating gonadotropins and Bcl-2 gene expression. J. Reprod. Dev. 2014, 60, 115–127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Momeni, H.R.; Eskandari, N. Curcumin protects the testis against cadmium-induced histopathological damages and oxidative stress in mice. Hum. Exp. Toxicol. 2020, 39, 653–661. [Google Scholar] [CrossRef] [PubMed]
- Eybl, V.; Kotyzova, D.; Koutensky, J. Comparative study of natural antioxidants—Curcumin, resveratrol and melatonin—In cadmium-induced oxidative damage in mice. Toxicology 2006, 225, 150–156. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.H.; He, J.B.; Yu, L.H.; Li, L.; Long, M.; Liu, M.D.; Li, P. Protective role of curcumin in cadmium-induced testicular injury in mice by attenuating oxidative stress via Nrf2/ARE pathway. Environ. Sci. Pollut. Res. Int. 2019, 26, 34575–34583. [Google Scholar] [CrossRef] [PubMed]
- Gong, P.; Chen, F.; Liu, X.; Gong, X.; Wang, J.; Ma, Y. Protective effect of caffeic acid phenethyl ester against cadmium-induced renal damage in mice. J. Toxicol. Sci. 2012, 37, 415–425. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Flohe, L.; Gunzler, W.A. Assays of glutathione peroxidase. Methods Enzymol. 1984, 105, 114–121. [Google Scholar] [CrossRef]
- Manna, P.; Sinha, M.; Sil, P.C. Taurine plays a beneficial role against cadmium-induced oxidative renal dysfunction. Amino Acids 2009, 36, 417–428. [Google Scholar] [CrossRef]
- Yamamoto, Y.; Maeshima, Y.; Kitayama, H.; Kitamura, S.; Takazawa, Y.; Sugiyama, H.; Yamasaki, Y.; Makino, H. Tumstatin peptide, an inhibitor of angiogenesis, prevents glomerular hypertrophy in the early stage of diabetic nephropathy. Diabetes 2004, 53, 1831–1840. [Google Scholar] [CrossRef] [Green Version]
- Okada, H.; Senmaru, T.; Fukui, M.; Kondo, Y.; Ishigami, A.; Maruyama, N.; Obayashi, H.; Yamazaki, M.; Nakamura, N.; Hasegawa, G. Senescence marker protein-30/gluconolactonase deficiency exacerbates diabetic nephropathy through tubular injury in a mouse model of type 1 diabetes. J. Diabetes Investig. 2015, 6, 35–43. [Google Scholar] [CrossRef]
- Thevenod, F.; Wolff, N.A. Iron transport in the kidney: Implications for physiology and cadmium nephrotoxicity. Met. Integr. Biomet. Sci. 2016, 8, 17–42. [Google Scholar] [CrossRef] [PubMed]
- Krstic, D.; Tomic, N.; Radosavljevic, B.; Avramovic, N.; Dragutinovic, V.; Skodric, S.R.; Colovic, M. Biochemical markers of renal function. Curr. Med. Chem. 2016, 23, 2018–2040. [Google Scholar] [CrossRef] [PubMed]
- Gowda, S.; Desai, P.B.; Kulkarni, S.S.; Hull, V.V.; Math, A.A.; Vernekar, S.N. Markers of renal function tests. N. Am. J. Med Sci. 2010, 2, 170–173. [Google Scholar]
- Zhao, Y.H.; Shen, C.F.; Wang, G.J.; Kang, Y.; Song, Y.H.; Liu, J.W. Curcumin alleviates acute kidney injury in a dry-heat environment by reducing oxidative stress and inflammation in a rat model. J. Biochem. Mol. Toxicol. 2021, 35, e22630. [Google Scholar] [CrossRef]
- Cheng, K.; Song, Z.; Chen, Y.; Li, S.; Zhang, Y.; Zhang, H.; Zhang, L.; Wang, C.; Wang, T. Resveratrol protects against renal damage via attenuation of inflammation and oxidative stress in high-fat-diet-induced obese mice. Inflammation 2019, 42, 937–945. [Google Scholar] [CrossRef] [PubMed]
- Nemmiche, S. Oxidative signaling response to cadmium exposure. Toxicol. Sci. 2017, 156, 4–10. [Google Scholar] [CrossRef] [Green Version]
- Koedrith, P.; Seo, Y.R. Advances in carcinogenic metal toxicity and potential molecular markers. Int. J. Mol. Sci. 2011, 12, 9576–9595. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tandon, S.K.; Singh, S.; Prasad, S.; Khandekar, K.; Dwivedi, V.K.; Chatterjee, M.; Mathur, N. Reversal of cadmium induced oxidative stress by chelating agent, antioxidant or their combination in rat. Toxicol. Lett. 2003, 145, 211–217. [Google Scholar] [CrossRef]
- Zhang, Q.; Zhang, C.; Ge, J.; Lv, M.W.; Talukder, M.; Guo, K.; Li, Y.H.; Li, J.L. Ameliorative effects of resveratrol against cadmium-induced nephrotoxicity via modulating nuclear xenobiotic receptor response and PINK1/Parkin-mediated Mitophagy. Food Funct. 2020, 11, 1856–1868. [Google Scholar] [CrossRef] [PubMed]
- Ansari, M.N.; Rehman, N.U.; Karim, A.; Imam, F.; Hamad, A.M. Protective effect of thymus serrulatus essential oil on cadmium-induced nephrotoxicity in rats, through suppression of oxidative stress and downregulation of NF-kappaB, iNOS, and Smad2 mRNA expression. Molecules 2021, 26, 1252. [Google Scholar] [CrossRef] [PubMed]
- Chatterjee, P.K. Novel pharmacological approaches to the treatment of renal ischemia-reperfusion injury: A comprehensive review. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2007, 376, 1–43. [Google Scholar] [CrossRef] [PubMed]
- Rinaldi, M.; Micali, A.; Marini, H.; Adamo, E.B.; Puzzolo, D.; Pisani, A.; Trichilo, V.; Altavilla, D.; Squadrito, F.; Minutoli, L. Cadmium, organ toxicity and therapeutic approaches: A review on brain, kidney and testis damage. Curr. Med. Chem. 2017, 24, 3879–3893. [Google Scholar] [CrossRef] [PubMed]
- Almeer, R.S.; AlBasher, G.I.; Alarifi, S.; Alkahtani, S.; Ali, D.; Abdel Moneim, A.E. Royal jelly attenuates cadmium-induced nephrotoxicity in male mice. Sci. Rep. 2019, 9, 5825. [Google Scholar] [CrossRef] [Green Version]
- Osukoya, O.A.; Oyinloye, B.E.; Ajiboye, B.O.; Olokode, K.A.; Adeola, H.A. Nephroprotective and anti-inflammatory potential of aqueous extract from Persea americana seeds against cadmium-induced nephrotoxicity in Wistar rats. Biometals 2021, 34, 1141–1153. [Google Scholar] [CrossRef]
- Alshammari, G.M.; Al-Qahtani, W.H.; AlFaris, N.A.; Albekairi, N.A.; Alqahtani, S.; Eid, R.; Yagoub, A.E.A.; Al-Harbi, L.N.; Yahya, M.A. Quercetin alleviates cadmium chloride-induced renal damage in rats by suppressing endoplasmic reticulum stress through SIRT1-dependent deacetylation of Xbp-1s and eIF2alpha. Biomed. Pharmacother. 2021, 141, 111862. [Google Scholar] [CrossRef]
- Kim, K.S.; Lim, H.J.; Lim, J.S.; Son, J.Y.; Lee, J.; Lee, B.M.; Chang, S.C.; Kim, H.S. Curcumin ameliorates cadmium-induced nephrotoxicity in Sprague-Dawley rats. Food Chem. Toxicol. 2018, 114, 34–40. [Google Scholar] [CrossRef] [PubMed]
- Dashzeveg, N.; Yoshida, K. Cell death decision by p53 via control of the mitochondrial membrane. Cancer Lett. 2015, 367, 108–112. [Google Scholar] [CrossRef]
- Mahdavi, S.; Khodarahmi, P.; Roodbari, N.H. Effects of cadmium on Bcl-2/ Bax expression ratio in rat cortex brain and hippocampus. Hum. Exp. Toxicol. 2018, 37, 321–328. [Google Scholar] [CrossRef]
- Wang, Y.; Wu, Y.; Luo, K.; Liu, Y.; Zhou, M.; Yan, S.; Shi, H.; Cai, Y. The protective effects of selenium on cadmium-induced oxidative stress and apoptosis via mitochondria pathway in mice kidney. Food Chem. Toxicol. 2013, 58, 61–67. [Google Scholar] [CrossRef]
- Shen, R.; Liu, D.; Hou, C.; Liu, D.; Zhao, L.; Cheng, J.; Wang, D.; Bai, D. Protective effect of Potentilla anserina polysaccharide on cadmium-induced nephrotoxicity in vitro and in vivo. Food Funct. 2017, 8, 3636–3646. [Google Scholar] [CrossRef]
- Fan, R.; Hu, P.C.; Wang, Y.; Lin, H.Y.; Su, K.; Feng, X.S.; Wei, L.; Yang, F. Betulinic acid protects mice from cadmium chloride-induced toxicity by inhibiting cadmium-induced apoptosis in kidney and liver. Toxicol. Lett. 2018, 299, 56–66. [Google Scholar] [CrossRef]
- Fang, J.; Xie, S.; Chen, Z.; Wang, F.; Chen, K.; Zuo, Z.; Cui, H.; Guo, H.; Ouyang, P.; Chen, Z.; et al. Protective effect of Vitamin E on cadmium-induced renal oxidative damage and apoptosis in rats. Biol. Trace Elem. Res. 2021, 199, 4675–4687. [Google Scholar] [CrossRef] [PubMed]
- Stenvinkel, P.; Chertow, G.M.; Devarajan, P.; Levin, A.; Andreoli, S.P.; Bangalore, S.; Warady, B.A. Chronic inflammation in chronic kidney disease progression: Role of Nrf2. Kidney Int. Rep. 2021, 6, 1775–1787. [Google Scholar] [CrossRef]
- Schmidlin, C.J.; Dodson, M.B.; Zhang, D.D. Filtering through the role of NRF2 in kidney disease. Arch. Pharm. Res. 2020, 43, 361–369. [Google Scholar] [CrossRef]
- Shelton, L.M.; Park, B.K.; Copple, I.M. Role of Nrf2 in protection against acute kidney injury. Kidney Int. 2013, 84, 1090–1095. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.Y.; Wang, Z.Y.; Zhu, Y.S.; Zhu, S.M.; Fan, R.F.; Wang, L. Alleviation of cadmium-induced oxidative stress by trehalose via inhibiting the Nrf2-Keap1 signaling pathway in primary rat proximal tubular cells. J. Biochem. Mol. Toxicol. 2018, 32, e22011. [Google Scholar] [CrossRef]
- Yan, L.-J.; Allen, D.C. Cadmium-induced kidney injury: Oxidative damage as a unifying mechanism. Biomolecules 2021, 11, 1575. [Google Scholar] [CrossRef]
- Cirmi, S.; Maugeri, A.; Ferlazzo, N.; Gangemi, S.; Calapai, G.; Schumacher, U.; Navarra, M. Anticancer potential of citrus juices and their extracts: A systematic review of both preclinical and clinical studies. Front. Pharmacol. 2017, 8, 420. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Atanasov, A.G.; Zotchev, S.B.; Dirsch, V.M.; the International Natural Product Sciences Taskforce; Supuran, C.T. Natural products in drug discovery: Advances and opportunities. Nat. Rev. Drug Discov. 2021, 20, 200–216. [Google Scholar] [CrossRef]
- Efferth, T.; Koch, E. Complex interactions between phytochemicals. The multi-target therapeutic concept of phytotherapy. Curr. Drug Targets 2011, 12, 122–132. [Google Scholar] [CrossRef] [PubMed]








| Gene | Protein | NCBI Reference Sequence | Primer Sequence |
|---|---|---|---|
| Actb | Beta-actin | NM_007393.5 | F: GCTGTGCTATGTTGCTCTA R: TCGTTGCCAATAGTGATGA |
| Bax | Apoptosis regulator BAX | NM_007527.3 | F: GCGAATTGGAGATGAACT R: CAGTTGAAGTTGCCATCA |
| Bcl2 | Apoptosis regulator Bcl-2 | NM_009741.5 | F: GTGGAGGAACTCTTCAGG R: TGACATCTCCCTGTTGAC |
| Hmox1 | Heme oxygenase 1 | NM_002133.3 | F: CGCCTTCCTGCTCAACAT R: ACGAAGTGACGCCATCTG |
| Il1b | Interleukin-1 beta | NM_008361.4 | F: ATCTATACCTGTCCTGTGTAATGA R: GCTTGTGCTCTGCTTGTG |
| Nos2 | Nitric oxide synthase, inducible | NM_010927.4 | F: GAGCGAGTTGTGGATTGT R: GCAGCCTCTTGTCTTTGA |
| Nqo1 | NAD(P)H dehydrogenase [quinone] 1 | NM_009706.5 | F: TCAGTATCCTTCCGAGTCATC R: TCAAACCAGCCTTTCAGAAT |
| Nrf2 | Nuclear factor erythroid 2-related factor 2 | NM_010902.4 | F: CAGCACCTTGTATCTTGAAGT R: GCAACACATTGCCATCTCT |
| Tp53 | Tumor suppressor p53 | NM_001127233.1 | F: TGGAAGACAGGCAGACTT R: ACTTGTAGTGGATGGTGGTA |
| Urea Nitrogen (mg/dL) | Creatinine (mg/dL) | |
|---|---|---|
| Controls | 14.5 ± 1.7 | 0.68 ± 0.1 |
| CdCl2 + vehicle | 41.2 ± 3.6 a | 1.51 ± 0.33 a |
| CdCl2 + Cur 50 mg/kg | 32.2 ± 2.9 a,b | 1.24 ± 0.4 a,b |
| CdCl2 + Cur 100 mg/kg | 30.3 ± 2.5 a,b | 1.21 ± 0.33 a,b |
| CdCl2 + Re 20 mg/kg | 26.6 ± 3.1 a,b | 1.02 ± 0.37 a,b |
| CdCl2 + BJe 20 mg/kg | 34.3 ± 2.1 a,b | 1.29 ± 0.28 a,b |
| CdCl2 + BJe 40 mg/kg | 18.3 ± 1.9 b | 0.77 ± 0.29 b |
| CdCl2 + Cur 50 mg/kg + Re 20 mg/kg + BJe 20 mg/kg | 15.9 ± 1.6 b | 0.73 ± 0.18 b |
| CdCl2 + Cur 100 mg/kg + Re 20 mg/kg + BJe 40 mg/kg | 14.7 ± 1.9 b | 0.71 ± 0.15 b |
| GSH (μmol/g of Tissue) | GPx (nmol/min per mg of Protein) | |
|---|---|---|
| Controls | 65 ± 4 | 34.6 ± 1.9 |
| CdCl2 + vehicle | 47 ± 5 a | 16.3 ± 1.6 a |
| CdCl2 + Cur 50 mg/kg | 53 ± 3 a | 21.4 ± 0.8 a |
| CdCl2 + Cur 100 mg/kg | 54 ± 6 a,b | 22.7 ± 0.7 a,b |
| CdCl2 + Re 20 mg/kg | 57 ± 4 a,b | 26.6 ± 1.1 a,b |
| CdCl2 + BJe 20 mg/kg | 51 ± 3 a,b | 19.5 ± 1.2 a,b |
| CdCl2 + BJe 40 mg/kg | 59 ± 5 b | 30.3 ± 0.4 b |
| CdCl2 + Cur 50 mg/kg + Re 20 mg/kg + BJe 20 mg/kg | 62 ± 6 b | 32.2 ± 1.1 b |
| CdCl2 + Cur 100 mg/kg + Re 20 mg/kg + BJe 40 mg/kg | 64 ± 5 b | 34.1 ± 1.1 b |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cirmi, S.; Maugeri, A.; Micali, A.; Marini, H.R.; Puzzolo, D.; Santoro, G.; Freni, J.; Squadrito, F.; Irrera, N.; Pallio, G.; et al. Cadmium-Induced Kidney Injury in Mice Is Counteracted by a Flavonoid-Rich Extract of Bergamot Juice, Alone or in Association with Curcumin and Resveratrol, via the Enhancement of Different Defense Mechanisms. Biomedicines 2021, 9, 1797. https://doi.org/10.3390/biomedicines9121797
Cirmi S, Maugeri A, Micali A, Marini HR, Puzzolo D, Santoro G, Freni J, Squadrito F, Irrera N, Pallio G, et al. Cadmium-Induced Kidney Injury in Mice Is Counteracted by a Flavonoid-Rich Extract of Bergamot Juice, Alone or in Association with Curcumin and Resveratrol, via the Enhancement of Different Defense Mechanisms. Biomedicines. 2021; 9(12):1797. https://doi.org/10.3390/biomedicines9121797
Chicago/Turabian StyleCirmi, Santa, Alessandro Maugeri, Antonio Micali, Herbert Ryan Marini, Domenico Puzzolo, Giuseppe Santoro, Jose Freni, Francesco Squadrito, Natasha Irrera, Giovanni Pallio, and et al. 2021. "Cadmium-Induced Kidney Injury in Mice Is Counteracted by a Flavonoid-Rich Extract of Bergamot Juice, Alone or in Association with Curcumin and Resveratrol, via the Enhancement of Different Defense Mechanisms" Biomedicines 9, no. 12: 1797. https://doi.org/10.3390/biomedicines9121797
APA StyleCirmi, S., Maugeri, A., Micali, A., Marini, H. R., Puzzolo, D., Santoro, G., Freni, J., Squadrito, F., Irrera, N., Pallio, G., Navarra, M., & Minutoli, L. (2021). Cadmium-Induced Kidney Injury in Mice Is Counteracted by a Flavonoid-Rich Extract of Bergamot Juice, Alone or in Association with Curcumin and Resveratrol, via the Enhancement of Different Defense Mechanisms. Biomedicines, 9(12), 1797. https://doi.org/10.3390/biomedicines9121797

