Genomic Characterization of Serotype III/ST-17 Group B Streptococcus Strains with Antimicrobial Resistance Using Whole Genome Sequencing
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolates Collection and Growth Conditions
2.2. Whole-Genome Sequencing
2.3. MLST, Serotyping, Pilus Typing and Antimicrobial Susceptibility Test
| Gene | Sequence (5′−3′) | Product Size (bp) | Reference (DOI) |
|---|---|---|---|
| ISSag5 | F: CAACAGATGCATCTCATTCTAATC | 1459 | this study |
| R: TTCCTGCACATCTCAACTAA | |||
| PI-1 | F: CAAGATTGACCGGGTGGAGA | 325 | 10.1016/j.micpath.2018.01.035 [30] |
| R: ATGGGCAGTTAGAACGGCAT | |||
| PI-2a | F: CGGGGTGCAAGTCAATAAGG | 264 | 10.1016/j.micpath.2018.01.035 [30] |
| R: GGAGCAGGGCATTTAGAAGGT | |||
| PI-2b | F: CTCTGCTACCACCAAAGCGT | 665 | 10.1016/j.micpath.2018.01.035 [30] |
| R: GTGGGGGTAGGCTTAATGGC | |||
| ICESag37 head | F: ACATAGCCCCGTCAGTATG | 816 | this study |
| R: ATCACGTGGAGTGGTAGTG | |||
| ICESag37 tail | F: GCAACGTGGTGAATTGATAGGG | 1011 | 10.3389/fmicb.201.7.01921 [32] |
| R: AAAACTGCACGATCAAACTCCG |
3. Results
3.1. Serotyping and Antimicrobial Susceptibility Testing
3.2. Whole Genome Sequencing
3.3. Pilus Genes, ISSag5 and ICESag37 in All Serotype III GBS Isolates
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Russell, N.J.; Seale, A.C.; O’Driscoll, M.; O’Sullivan, C.; Bianchi-Jassir, F.; Gonzalez-Guarin, J.; Lawn, J.E.; Baker, C.J.; Bartlett, L.; Cutland, C.; et al. Maternal colonization with group B Streptococcus and serotype distribution worldwide: Systemic review and meta-analyses. Clin. Infect. Dis. 2017, 65 (Suppl. 2), S100–S111. [Google Scholar] [CrossRef] [Scilit]
- Seale, A.C.; Koech, A.C.; Sheppard, A.; Barsosio, H.C.; Langat, J.; Anyango, E.; Mwakio, S.; Mwarumba, S.; Morpeth, S.C.; Anampiu, K.; et al. Maternal colonization with Streptococcus agalactiae and associated stillbirth and neonatal disease in coastal Kenya. Nat. Microbiol. 2016, 1, 16067. [Google Scholar] [CrossRef] [Scilit]
- Ouchenir, L.; Renaud, C.; Khan, S.; Bitnun, A.; Boisvert, A.-A.; McDonald, J.; Bowes, J.; Brophy, J.; Barton, M.; Ting, J.Y.; et al. The Epidemiology, Management, and Outcomes of Bacterial Meningitis in Infants. Pediatr. 2017, 140, e20170476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsai, M.-H.; Hsu, J.-F.; Lai, M.-Y.; Lin, L.-C.; Chu, S.-M.; Huang, H.-R.; Chiang, M.-C.; Fu, R.-H.; Lu, J.-J. Molecular Characteristics and Antimicrobial Resistance of Group B Streptococcus Strains Causing Invasive Disease in Neonates and Adults. Front. Microbiol. 2019, 10, 264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nanduri, S.A.; Petit, S.; Smelser, C.; Apostol, M.; Alden, N.B.; Harrison, L.H.; Lynfield, R.; Vagnone, P.S.; Burzlaff, K.; Spina, N.L.; et al. Epidemiology of Invasive Early-Onset and Late-Onset Group B Streptococcal Disease in the United States, 2006 to 2015. JAMA Pediatr. 2019, 173, 224–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tazi, A.; Plainvert, C.; Anselem, O.; Ballon, M.; Marcou, V.; Seco, A.; El Alaoui, F.; Joubrel, C.; El Helali, N.; Falloukh, E.; et al. Risk Factors for Infant Colonization by Hypervirulent CC17 Group B Streptococcus: Toward the Understanding of Late-onset Disease. Clin. Infect. Dis. 2019, 69, 1740–1748. [Google Scholar] [CrossRef] [Scilit]
- Björnsdóttir, E.S.; Martins, E.R.; Erlendsdóttir, H.; Haraldsson, G.; Melo-Cristino, J.; Ramirez, M.; Kristinsson, K.G. Group B Streptococcal Neonatal and Early Infancy Infections in Iceland, 1976–2015. Pediatr. Infect. Dis. J. 2019, 38, 620–624. [Google Scholar] [CrossRef] [Scilit]
- Romain, A.-S.; Cohen, R.; Plainvert, C.; Joubrel, C.; Béchet, S.; Perret, A.; Tazi, A.; Poyart, C.; Levy, C. Clinical and Laboratory Features of Group B Streptococcus Meningitis in Infants and Newborns: Study of 848 Cases in France, 2001–2014. Clin. Infect. Dis. 2017, 66, 857–864. [Google Scholar] [CrossRef] [Scilit]
- Al Luhidan, L.; Madani, A.; Albanyan, E.A.; Al Saif, S.; Nasef, M.; AlJohani, S.; Madkhali, A.; Al Shaalan, M.; Alalola, S. Neonatal group B Streptococcus infection in a tertiary care hospital in Saudi Arabia: A 13-year experience. Pediatric Infect. Dis. J. 2019, 38, 731–734. [Google Scholar] [CrossRef] [Scilit]
- Pietrocola, G.; Arciola, C.R.; Rindi, S.; Montanaro, L.; Speziale, P. Streptococcus agalactiae Non-Pilus, Cell Wall-Anchored Proteins: Involvement in Colonization and Pathogenesis and Potential as Vaccine Candidates. Front. Immunol. 2018, 9, 602. [Google Scholar] [CrossRef] [Scilit]
- Lohrmann, F.; Berg, A.; Wicker, E.; Imm, A.; Krause, G.; Zürn, K.; Berner, R.; Hufnagel, M.; Lander, F. Prevalence of capsular serotype, pilus island distribution, and antibiotic resistance in pediatric and adult invasive group B Streptococcus isolates: Data from a nationwide prospective surveil-lance study in Germany. Pediatric Infect. Dis. J. 2021, 40, 76–82. [Google Scholar] [CrossRef] [Scilit]
- Vornhagen, J.; Adams Waldorf, K.M.; Rajagopal, L. Perinatal Group B Streptococcal Infections: Virulence Factors, Immunity, and Prevention Strategies. Trends. Microbiol. 2017, 25, 919–931. [Google Scholar] [CrossRef] [Scilit]
- Martins, E.R.; Pedroso-Roussado, C.; Melo-Cristino, J.; Ramirez, M. Portuguese Group for the Study of Streptococcal Infections. Streptococcus agalactiae causing neonatal infections in Portugal (2005–2015): Diversification and emergence of a CC17/PI-2b mul-tidrug resistant sublineage. Front. Microbiol. 2017, 8, 499. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Plainvert, C.; Hays, C.; Touak, G.; Joubrel-Guyot, C.; Dmytruk, N.; Frigo, A.; Poyart, C.; Tazi, A. Multidrug-Resistant Hypervirulent Group B Streptococcus in Neonatal Invasive Infections, France, 2007–2019. Emerg. Infect. Dis. 2020, 26, 2721–2724. [Google Scholar] [CrossRef] [Scilit]
- Campisi, E.; Rosini, R.; Ji, W.; Guidotti, S.; Rojas-López, M.; Geng, G.; Deng, Q.; Zhong, H.; Wang, W.; Liu, H.; et al. Genomic analysis reveals multi-drug resistance clusters in Group B Streptococcus CC17 hypervirulent isolates causing neonatal invasive disease in Southern Mainland China. Front. Microbiol. 2016, 7, 1265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lamagni, T.L.; Keshishian, C.; Efstratiou, A.; Guy, R.; Henderson, K.; Broughton, K.; Sheridan, E. Emerging Trends in the Epidemiology of Invasive Group B Streptococcal Disease in England and Wales, 1991–2010. Clin. Infect. Dis. 2013, 57, 682–688. [Google Scholar] [CrossRef] [Scilit]
- Kitamura, M.; Kimura, K.; Ido, A.; Seki, T.; Banno, H.; Jin, W.; Wachino, J.-I.; Yamada, K.; Arakawa, Y. Relatively high rates of cefotaxime- and ceftriaxone-non-susceptible isolates among group B streptococci with reduced penicillin susceptibility (PRGBS) in Japan. J. Antimicrob. Chemother. 2019, 74, 931–934. [Google Scholar] [CrossRef] [Scilit]
- Teatero, S.; Ferrieri, P.; Martin, I.; Demczuk, W.; McGeer, A.; Fittipaldi, N. Serotype distribution, population structure, and antimicro-bial resistance of Group B Streptococcus strains recovered from colonized pregnant women. J. Clin. Microbiol. 2017, 55, 412–422. [Google Scholar] [CrossRef] [Scilit]
- Da Cunha, V.; Davies, M.R.; Douarre, P.E.; Rosinski-Chupin, I.; Margarit, I.; Spinali, S.; Perkins, T.; Lechat, P.; Dmytruk, N.; Sauvage, E.; et al. Streptococcus agalactiae clones infecting humans were selected and fixed through the extensive use of tetracycline. Nat. Commun. 2014, 5, 4544. [Google Scholar] [CrossRef] [Scilit]
- Flores, A.R.; Galloway-Peña, J.; Sahasrabhojane, P.; Saldaña, M.; Yao, H.; Su, X.; Ajami, N.J.; Holder, M.E.; Petrosino, J.F.; Thompson, E.; et al. Sequence type 1 group B Streptococcus, an emerg-ing cause of invasive disease in adults, evolves by small genetic changes. Proc. Natl. Acad. Sci. USA 2015, 112, 6431–6436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teatero, S.; Athey, T.B.; Van Caeseele, P.; Horsman, G.; Alexander, D.C.; Melano, R.G.; Li, A.; Flores, A.R.; Shelburne, S.A., III; McGeer, A.; et al. Emergence of serotype IV Group B Strepto-coccus adult invasive disease in Manitoba and Saskatchewan, Canada, is driven by clonal sequence type 459 strains. J. Clin. Microbiol. 2015, 53, 2919–2926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teatero, S.; Ramoutar, E.; McGeer, A.; Li, A.; Melano, R.G.; Wasserscheid, J.; Dewar, K.; Fittipaldi, N. Clonal Complex 17 Group B Streptococcus strains causing invasive disease in neonates and adults originate from the same genetic pool. Sci. Rep. 2016, 6, 20047. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Metcalf, B.J.; Chochua, S.; Gertz, R.E., Jr.; Hawkins, P.A.; Ricaldi, J.; Li, Z.; Walker, H.; Tran, T.; Rivers, J.; Mathis, S.; et al. Short-read whole genome sequencing for determination of antimicrobial resistance mechanisms and capsular serotypes of current invasive Streptococcus agalactiae recovered in the USA. Clin. Microbiol. Infect. 2017, 23, 574.e7–574.e14. [Google Scholar] [CrossRef] [Scilit]
- Shelburne, S.A.; Sahasrabhojane, P.; Saldaña, M.; Yao, H.; Su, X.; Horstmann, N.; Thompson, E.; Flores, A.R. Streptococcus mitisStrains Causing Severe Clinical Disease in Cancer Patients. Emerg. Infect. Dis. 2014, 20, 762–771. [Google Scholar] [CrossRef] [Scilit]
- Seemann, T. Prokka: Rapid Prokaryotic Genome Annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manning, S.; Springman, A.C.; Lehotzky, E.; Lewis, M.A.; Whittam, T.S.; Dele Davies, H. Multilocus Sequence Types Associated with Neonatal Group B Streptococcal Sepsis and Meningitis in Canada. J. Clin. Microbiol. 2009, 47, 1143–1148. [Google Scholar] [CrossRef] [Scilit]
- Francisco, A.P.; Bugalho, M.; Ramirez, M.; Carriço, J.A. Global optimal eBURST analysis of multilocus typing data using a graphic matroid approach. BMC Bioinform. 2009, 10, 152. [Google Scholar] [CrossRef] [Scilit]
- Tien, N.; Ho, C.-M.; Lin, H.-J.; Shih, M.-C.; Ho, M.-W.; Lin, H.-C.; Lin, H.-S.; Chang, C.-C.; Lu, J.-J. Multilocus sequence typing of invasive group B Streptococcus in central area of Taiwan. J. Microbiol. Immunol. Infect. 2011, 44, 430–434. [Google Scholar] [CrossRef] [Scilit]
- Lin, H.-C.; Chen, C.-J.; Chiang, K.-H.; Yen, T.-Y.; Ho, C.-M.; Hwang, K.-P.; Su, B.-H.; Lin, H.-C.; Li, T.-C.; Lu, J.-J. Clonal dissemination of invasive and colonizing clonal complex 1 of serotype VI group B Streptococcus in central Taiwan. J. Microbiol. Immunol. Infect. 2016, 49, 902–909. [Google Scholar] [CrossRef] [Scilit]
- Khodaei, F.; Najafi, M.; Hasani, A.; Kalantar, E.; Sharifi, E.; Amini, A.; Aghazadeh, M. Pilus–encoding islets in S. agalactiae and its association with antibacterial resistance and serotype distribution. Microb. Pathog. 2018, 116, 189–194. [Google Scholar] [CrossRef] [Scilit]
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-Second Informational Supplement; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2012. [Google Scholar]
- Zhou, K.; Xie, L.; Han, L.; Guo, X.-K.; Wang, Y.; Sun, J. ICESag37, a Novel Integrative and Conjugative Element Carrying Antimicrobial Resistance Genes and Potential Virulence Factors in Streptococcus agalactiae. Front. Microbiol. 2017, 8, 1921. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kao, Y.; Tsai, M.H.; Lai, M.Y.; Chu, S.M.; Huang, H.R.; Chiang, M.C.; Fu, R.H.; Lu, J.J.; Hsu, J.F. Emerging serotype III sequence type 17 group B Streptococcus invasive infection in infants: The clinical characteristics and impacts on outcomes. BMC Infect. Dis. 2019, 19, 538. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.; Luo, M.; Zhou, H.; Li, C.; Luk, A.; Zhao, G.; Fung, K.; Ip, M. Role of Two-Component System Response Regulator bceR in the Antimicrobial Resistance, Virulence, Biofilm Formation, and Stress Response of Group B Streptococcus. Front. Microbiol. 2019, 10, 10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hayes, K.; O’Halloran, F.; Cotter, L. A review of antibiotic resistance in Group B Streptococcus: The story so far. Crit. Rev. Microbiol. 2020, 46, 253–269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, Y.; Wang, Y.; Hsia, Y.; Russell, N.; Heath, P.T. Systematic Review and Meta-Analyses of Incidence for Group B Streptococcus Disease in Infants and Antimicrobial Resistance, China. Emerg. Infect. Dis. 2020, 26, 2651–2659. [Google Scholar] [CrossRef] [Scilit]
- Kekic, D.; Gajic, I.; Opavski, N.; Kojic, M.; Vukotic, G.; Smitran, A.; Boskovic, L.; Stojkovic, M.; Ranin, L. Trends in molecular characteristics and antimicrobial resistance of group B streptococci: A multicenter study in Serbia, 2015–2020. Sci. Rep. 2021, 11, 540. [Google Scholar] [CrossRef] [Scilit]
- Kimura, K.; Nagano, N.; Nagano, Y.; Suzuki, S.; Wachino, J.I.; Shibayama, K.; Arakawa, Y. High frequency of fluoroquinolone- and macro-lide-resistant streptococci among clinically isolated group B streptococci with reduced penicillin susceptibility. J. Antimicrob. Chemother. 2013, 68, 539–542. [Google Scholar] [CrossRef] [Scilit]
- Banno, H.; Kimura, K.; Seki, T.; Jin, W.; Wachino, J.-I.; Yamada, K.; Nagano, N.; Arakawa, Y. High isolation rate and multidrug resistance tendency of penicillin-susceptible group B Streptococcus with reduced ceftibuten susceptibility in Japan. Eur. J. Clin. Microbiol. Infect. Dis. 2018, 37, 1511–1519. [Google Scholar] [CrossRef] [Scilit]
- Schürch, A.; Arredondo-Alonso, S.; Willems, R.; Goering, R. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene–based approaches. Clin. Microbiol. Infect. 2018, 24, 350–354. [Google Scholar] [CrossRef] [Scilit]
- Sharma, P.; Lata, H.; Arya, D.K.; Kashyap, A.K.; Kumar, H.; Dua, M.; Ali, A.; Johri, A.K. Role of pilus proteins in adherence and invasion of Strepto-coccus agalactiae to the lung and cervical epithelial cells. J. Biol. Chem. 2013, 288, 4023–4034. [Google Scholar] [CrossRef] [Scilit]
- Springman, A.C.; Lacher, D.W.; Waymire, E.A.; Wengert, S.L.; Singh, P.; Zadoks, R.N.; Dele Davies, H.; Manning, S.D. Pilus distribution among lineages of group b streptococcus: An evolutionary and clinical perspective. BMC Microbiol. 2014, 14, 159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, B.; Wu, J.; Chen, X.; Gao, C.; Yang, J.; Li, Y.; Wang, J.; Zeng, J.; Fang, Y.; Wang, D.; et al. Microbiological and clinical characteristics of Group B Streptococcus isolates causing materno-neonatal infections: High prevalence of CC17/PI-1 and PI-2b sublineage in neonatal infections. J. Med. Microbiol. 2018, 67, 1551–1559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, B.; Wang, D.; Zhou, H.; Zhu, F.; Li, D.; Zhang, S.; Shi, Y.; Cui, Y.; Huang, L.; Wu, H. Distribution of pilus islands and alpha-like protein genes of group B Strepto-coccus colonized in pregnant women in Beijing, China. Eur. J. Clin. Microbiol. Infect. Dis. 2015, 34, 1173–1179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tettelin, H.; Masignani, V.; Cieslewicz, M.J.; Eisen, J.A.; Peterson, S.; Wessels, M.R.; Paulsen, I.; Nelson, K.E.; Margarit, I.; Read, T.; et al. Complete genome sequence and comparative genomic analysis of an emerging human pathogen, serotype V Streptococcus agalactiae. Proc. Natl. Acad. Sci. USA 2002, 99, 12391–12396. [Google Scholar] [CrossRef] [Scilit]
- Ambroset, C.; Coluzzi, C.; Guédon, G.; Devignes, M.-D.; Loux, V.; Elacroix, T.; Payot, S.; Eleblond-Bourget, N. New Insights into the Classification and Integration Specificity of Streptococcus Integrative Conjugative Elements through Extensive Genome Exploration. Front. Microbiol. 2016, 6, 1483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siguier, P.; Gourbeyre, E.; Chandler, M. Bacterial insertion sequences: Their genomic impact and diversity. FEMS Microbiol. Rev. 2014, 38, 865–891. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimizu, A.; Tsukagoshi, H.; Sekizuka, T.; Kuroda, M.; Koizumi, A.; Fujita, M.; Yamada, Y.; Saruki, N. Meningitis and bacteremia by nonhemolytic Group B Streptococcus strain: A whole genome analysis. Microbiol. Immunol. 2020, 64, 630–634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khazaal, S.; Al Safadi, R.; Osman, D.; Hiron, A.; Gilot, P. Dual and divergent transcriptional impact of IS1548 insertion upstream of the peptidoglycan biosynthesis gene murB of Streptococcus agalactiae. Gene 2019, 720, 144094. [Google Scholar] [CrossRef] [Scilit]
- Fléchard, M.; Gilot, P.; Hery-Arnaud, G.; Mereghetti, L.; Rosenau, A. Analysis and identification of IS1548 insertion targets in Streptococcus agalactiae. FEMS Microbiol. Lett. 2013, 340, 65–72. [Google Scholar] [CrossRef] [Scilit]




| No. (%) of Resistant GBS Isolates | ||||||||
|---|---|---|---|---|---|---|---|---|
| Sources | Maternal Colonized Strains (Total n = 100) | Adult Invasive Strains (Total n = 399) | Neonatal Invasive Strains (Total n = 182) | Total (n = 681 GBS Isolates) | ||||
| Serotype(n)/ Antibiotics | Erythromycin | Clindamycin | Erythromycin | Clindamycin | Erythromycin | Clindamycin | Erythromycin | Clindamycin |
| Ia (n = 80) | 1/7 (14.3) | 1/7 (14.3) | 10/40 (25.0) | 7/40 (17.5) | 8/33 (24.2) | 10/33 (30.3) | 19/80 (23.8) | 18/80 (22.5) |
| Ib (n = 81) | 8/10 (80.0) | 8/10 (80.0) | 50/56 (89.3) | 50/56 (89.3) | 15/15 (100.0) | 15/15 (100.0) | 73/81 (90.1) | 73/81 (90.1) |
| II (n = 47) | 1/6 (16.7) | 1/6 (16.7) | 5/38 (13.2) | 5/38 (13.2) | 0/3 (0) | 0/3 (0) | 6/47 (12.8) | 6/47 (12.8) |
| III (n = 190) | 16/25 (64.0) | 15/25 (60.0) | 25/47 (53.2) | 29/47 (61.7) | 97/118 (82.2) | 91/18 (77.1) | 138/190 (72.6) | 135/190 (71.1) |
| V (n = 81) | 11/16 (68.8) | 11/16 (68.8) | 40/59 (67.8) | 39/59 (66.1) | 4/6 (66.7) | 4/6 (66.7) | 55/81 (67.9) | 54/81 (66.7) |
| VI (n = 192) | 6/35 (17.1) | 6/35 (17.1) | 40/150 (26.7) | 40/150 (26.7) | 0/7 (0) | 0/7 (0) | 46/192 (24.0) | 46/192 (24.0) |
| Others (10) | 0/1 (0) | 0/1 (0) | 0/9 (0) | 1/9 (11.1) | 0/0 (0) | 0/0 (0) | 0/10 (0) | 1/10 (10.0) |
| All (n = 681) | 43/100 (43.0) | 42/100 (42.0) | 170/399 (42.6) | 171/399 (42.9) | 124/182 (68.1) | 120/182 (65.9) | 337/681 (49.5) | 333/681 (48.9) |
| Strain | Source | Age/Gender | Resistance Genes | Antimicrobial Resistance Profiles | |
|---|---|---|---|---|---|
| Erythromycin | Clindamycin | ||||
| N5 | cerebrospinal fluid | newborn/M | tetM, tetO, ermB, ant6-Ia, aphIII, aadE | resistance | resistance |
| N48 | cerebrospinal fluid | newborn/F | tetO, ermB, ant6-Ia, aadE, aphIII | resistance | resistance |
| P103 | swab | pregnant women/F | tetM, tetO, ermB, ant6-Ia, aphIII, aadE | resistance | resistance |
| N96 | cerebrospinal fluid | newborn/M | tetM | sensitive | sensitive |
| A28 | blood | adult/M | tetM | sensitive | sensitive |
| P65 | swab | pregnant women/F | tetM | sensitive | sensitive |
| No. (%) of All 190 Type III GBS Isolates | ||||||
|---|---|---|---|---|---|---|
| ISSag 5 | Presence of ISSag 5 (Total n = 33, 17.4%) | Absence of ISSag 5 (Total n = 157, 82.6%) | ||||
| Pilus genes | PI-1 + PI-2a | PI-1 + PI-2b | PI-2b | PI-1 + PI-2a | PI-1 + PI-2b | PI-2b |
| Total n (%) | 4 (2.1%) | 29 (15.3%) | 0 (0) | 46 (24.2%) | 0 (0) | 111 (58.4%) |
| Sequence types | ||||||
| ST-17 (total n = 128) | 0 (0) | 24 (82.8) | - | 0 (0) | - | 104 (93.7) |
| Non-ST17 (total n = 62) | 4 (100) | 5 (17.2) | - | 46 (100) | - | 7 (6.3) |
| Sources | ||||||
| Neonatal invasive diseases | 1 (25.0) | 19 (65.5) | - | 12 (26.1) | - | 86 (77.5) |
| Adult invasive diseases | 1 (25.0) | 6 (20.7) | - | 29 (63.0) | - | 11 (9.9) |
| Maternal colonization | 2 (50.0) | 4 (13.8) | - | 5 (10.9) | - | 14 (12.6) |
| ICESag37 | ||||||
| Presence | 0 (0) | 3 (10.3) | - | 8 (17.4) | - | 105 (94.6) |
| Absence | 4 (100) | 26 (89.7) | - | 38 (82.6) | - | 6 (5.4) |
| Antibiotic resistance patterns (No. (%) of resistant GBS isolates) | ||||||
| Ery (R) + Clin (R) | 0 (0) | 7 (24.1) | - | 15 (32.6) | - | 106 (95.5) |
| Ery (S) + Clin (S) | 4 (100) | 15 (51.7) | - | 23 (50.0) | - | 3 (2.7) |
| Ery (R) + Clin (S) | 0 (0) | 7 (24.1) | - | 3 (6.5) | - | 0 (0) |
| Ery (S) + Clin (R) | 0 (0) | 0 (0) | - | 5 (10.9) | - | 2 (1.8) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hsu, J.-F.; Tsai, M.-H.; Lin, L.-C.; Chu, S.-M.; Lai, M.-Y.; Huang, H.-R.; Chiang, M.-C.; Yang, P.-H.; Lu, J.-J. Genomic Characterization of Serotype III/ST-17 Group B Streptococcus Strains with Antimicrobial Resistance Using Whole Genome Sequencing. Biomedicines 2021, 9, 1477. https://doi.org/10.3390/biomedicines9101477
Hsu J-F, Tsai M-H, Lin L-C, Chu S-M, Lai M-Y, Huang H-R, Chiang M-C, Yang P-H, Lu J-J. Genomic Characterization of Serotype III/ST-17 Group B Streptococcus Strains with Antimicrobial Resistance Using Whole Genome Sequencing. Biomedicines. 2021; 9(10):1477. https://doi.org/10.3390/biomedicines9101477
Chicago/Turabian StyleHsu, Jen-Fu, Ming-Horng Tsai, Lee-Chung Lin, Shih-Ming Chu, Mei-Yin Lai, Hsuan-Rong Huang, Ming-Chou Chiang, Peng-Hong Yang, and Jang-Jih Lu. 2021. "Genomic Characterization of Serotype III/ST-17 Group B Streptococcus Strains with Antimicrobial Resistance Using Whole Genome Sequencing" Biomedicines 9, no. 10: 1477. https://doi.org/10.3390/biomedicines9101477
APA StyleHsu, J.-F., Tsai, M.-H., Lin, L.-C., Chu, S.-M., Lai, M.-Y., Huang, H.-R., Chiang, M.-C., Yang, P.-H., & Lu, J.-J. (2021). Genomic Characterization of Serotype III/ST-17 Group B Streptococcus Strains with Antimicrobial Resistance Using Whole Genome Sequencing. Biomedicines, 9(10), 1477. https://doi.org/10.3390/biomedicines9101477

