Next Article in Journal
FedIHRAS: A Privacy-Preserving Federated Learning Framework for Multi-Institutional Collaborative Radiological Analysis with Integrated Explainability and Automated Clinical Reporting
Previous Article in Journal
Advances in SRNS Gene Research: From Precision Classification to Precision Diagnosis and Treatment
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomedicines
Volume 14
Issue 3
10.3390/biomedicines14030712
biomedicines-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Primary Cilia Are Required for Efficient BMP Signaling in Traumatic Heterotopic Ossification

by
Xinyuan Yuan
1,2,
Saman Toutounchi
1,2,
Susan F. Law
1,2,
David Achudhan
1,2,
Abhishek Chandra
1,3,
Kai He
3,
Yingshu Cao
3,
Jinghua Hu
3,
Robert J. Pignolo
1,2 and
Haitao Wang
1,2,*
1
Department of Physiology and Biomedical Engineering, Mayo Clinic, Rochester, MN 55905, USA
2
Department of Medicine, Mayo Clinic, Rochester, MN 55905, USA
3
Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, MN 55905, USA
*
Author to whom correspondence should be addressed.
Biomedicines 2026, 14(3), 712; https://doi.org/10.3390/biomedicines14030712
Submission received: 21 December 2025 / Revised: 6 March 2026 / Accepted: 14 March 2026 / Published: 19 March 2026
(This article belongs to the Section Cell Biology and Pathology)
Browse Figures
Versions Notes

Abstract

Background/Objectives: Heterotopic ossification (HO), the aberrant formation of bone within soft tissues, arises either from rare genetic mutations or more commonly from traumatic insults. It is a major cause of morbidity not only in individuals harboring causative mutations, but also in those undergoing musculoskeletal surgery or trauma and in soldiers sustaining blast or burn injuries. Bone morphogenetic protein (BMP) signaling is a central driver of both hereditary and acquired forms of HO. Primary cilia are nonmotile, antenna-like organelles that extend from the cell surface and serve as crucial sensory and signaling hubs by concentrating key pathway components within a confined volume at the ciliary tip. However, their functional role in the pathogenesis of traumatic HO remains poorly understood. Methods: We investigate the role of primary cilia in traumatic HO using a genetically modified mouse model and cellular model. Results: We demonstrate that BMP signaling is attenuated when primary cilia function is disrupted. Both ciliation frequency and ciliary length were reduced in Scleraxis-CreERT2; Intraflagellar transport 88 floxed/floxed (Scx-CreERT2;Ift88fl/fl) tenocytes. Deletion of Ift88 effectively suppressed pathological BMP signaling and inhibited HO formation. Conclusions: These findings establish that functional primary cilia are required for traumatic HO development and highlight ciliary regulation as a potential therapeutic avenue for preventing or mitigating post-traumatic HO.

1. Introduction

Heterotopic ossification (HO) is a pathological condition characterized by the formation of mature bone within soft tissues outside the normal skeletal framework. It can arise from rare genetic mutations or be triggered by more common forms of tissue injury and trauma [1]. HO poses a substantial risk of functional impairment, affecting individuals with inherited predisposition as well as patients undergoing invasive musculoskeletal procedures. In addition, HO is highly prevalent among military personnel exposed to modern combat injuries, particularly those involving high-energy blast trauma and extensive burns.
Based on etiology, HO is broadly divided into hereditary and nonhereditary forms. Hereditary HO is exemplified by fibrodysplasia ossificans progressiva (FOP), an extremely rare congenital disorder caused by a gain-of-function point mutation (R206H) in the Activin receptor type I gene (Acvr1, also known as ALK2) [2]. Clinically, FOP is marked by episodic heterotopic bone formation in skeletal muscles, tendons, and other connective tissues, ultimately leading to progressive and irreversible loss of mobility [1,3]. Mechanistically, FOP mutations result in constitutive activation of ACVR1 and enhanced sensitivity to Bone Morphogenetic Protein (BMP) signaling [4,5,6,7,8,9]. Although Activin A (Act A), a member of the transforming growth factor-beta (TGF-β)/BMP superfamily, normally binds ACVR1 to inhibit BMP signaling [10,11,12], pathogenic ACVR1 mutations in FOP convert this inhibitory signal into aberrant activation of downstream BMP effectors SMAD 1/5/8 [10,13]. This dysregulated BMP signaling drives inappropriate chondro-osseous differentiation of progenitor cells during tissue repair, culminating in the replacement of soft tissues with structurally normal bone [14,15].
In contrast, nonhereditary or acquired HO is far more common and typically develops in muscles, tendons, or ligaments following tissue injury [16]. Acquired HO frequently occurs in association with orthopedic procedures—most notably hip arthroplasty, which accounts for approximately 40% of cases [17,18,19]—as well as fractures or dislocations (~30%) [20], elbow trauma [21], high-energy extremity trauma [22], traumatic brain or spinal cord injury (with an incidence of up to 50% in spinal cord injury patients) [23], and severe burns (∼20% of third-degree burns) [24]. Among patients with severe combat-related traumatic amputations, the incidence of HO exceeds 90% [25]. Surgical excision remains the primary treatment for established lesions; however, it is associated with substantial morbidity, and the biological mechanisms underlying acquired HO remain incompletely understood [26]. Consequently, effective therapeutic options for non-genetic HO are limited.
BMP signaling has emerged as a central pathway in both hereditary and acquired forms of HO. In FOP, the canonical R206H mutation and all reported ACVR1 variants lead to loss of autoinhibitory control and persistent activation of BMP signaling [2,27]. Similarly, in trauma-induced HO, the injury-associated stem cell niche has been shown to be BMP-dependent [28], suggesting a partially shared mechanistic basis across HO subtypes.
Primary cilia are solitary, non-motile, microtubule-based organelles that extend from the surfaces of most mammalian cells and function as critical sensory and signaling centers. By concentrating signaling components within a confined subcellular domain, primary cilia enable cells to respond efficiently to low levels of extracellular ligands [29,30]. They play essential roles in regulating key developmental and homeostatic pathways, including Hedgehog, Wnt, and TGF-β signaling [31,32]. Intraflagellar transport protein 88 (Ift88) is a core component of the intraflagellar transport machinery and is indispensable for ciliogenesis across species [33]. Conditional Ift88 knockout mouse models have therefore provided a powerful approach for interrogating cilia-dependent signaling mechanisms in disease contexts [34]. In addition to BMP signaling, other cilia-dependent pathways, including Hedgehog and Wnt signaling, have been implicated in injury-induced HO and in genetic disorders such as progressive osseous heteroplasia [35]. We previously demonstrated that primary cilia regulate skeletogenic BMP and Hedgehog signaling in FOP-associated HO [36]; however, the contribution of primary cilia to BMP signaling in tenocytes during traumatic HO remains poorly defined. Elucidating the spatial and temporal regulation of BMP signaling in injury-responsive tenocytes is therefore critical for understanding the pathogenesis of HO following trauma.

2. Materials and Methods

2.1. Animal Models

All animal procedures were approved by the Mayo Clinic Institutional Animal Care and Use Committee. Mice were maintained in a temperature-controlled environment (23–25 °C) under a 12 h light/dark cycle and were provided standard laboratory chow (PicoLab Rodent Diet 20 #5053; LabDiet, St. Louis, MO, USA) and water ad libitum. Scx-CreERT2 mice [B6(129S4)-Scxtm2.1(cre/ERT2)Stzr/J, Jackson Laboratory] express a tamoxifen-inducible Cre recombinase (CreERT2) under the control of the endogenous Scleraxis (Scx) promoter, which drives expression predominantly in tendon and tenocyte lineages [37,38]. Ift88fl/fl mice carry loxP sites flanking essential exons of the Ift88 gene, enabling conditional deletion upon Cre-mediated recombination. Scx-CreERT2;Ift88fl/fl mice were obtained by crossing Scx-CreERT2 transgenic mice with Ift88 floxed mice. Thus, Scx-CreERT2;Ift88fl/fl mice were used as a genetic background to obtain tendon-lineage cells, while Ift88 deletion was induced in vitro to allow for controlled analysis of cilia loss in primary tenocytes.

2.2. Mouse Burn–Tenotomy-Induced HO

Seven–nine-week-old male WT and Scx-CreERT2;Ift88fl/fl mice (~20 g) were used for all experiments. Animals were anesthetized with 2.5% inhaled isoflurane, and the left hindlimb (knee to ankle), as well as a 2 cm × 3 cm region along the left paraspinal area, were shaved and disinfected. A longitudinal incision was made over the Achilles tendon to expose the posterior tibial tendon, which was transected transversely. The incision was closed using one or two interrupted 5-0 sutures. To induce burn injury, a 60 °C aluminum block (2 cm × 3 cm) was applied to the left side of the spinal midline for approximately 17 s without added pressure. Eight weeks after surgery, the entire left hindlimb was harvested and analyzed by micro-computed tomography (μCT) to assess heterotopic bone formation.

2.3. Isolation of Primary Tail Tenocytes

Primary tenocytes were isolated from the tails of one-month-old mice using a two-step enzymatic digestion protocol. Tissues were first incubated with 0.25% trypsin for 30 min to remove surface-associated cells. The remaining tendon tissue was then digested with collagenase type I and dispase II (0.2% and 0.3%, respectively) for 2 h to degrade the extracellular matrix and release resident tenocytes. Isolated cells were cultured in high-glucose DMEM (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. Because donor mice were not treated with tamoxifen prior to tenocyte isolation, Cre-mediated recombination was induced in vitro using adenoviral Cre; this approach was employed solely to delete Ift88, and potential nonspecific effects of viral exposure cannot be entirely excluded.

2.4. Western Blotting

Cultured cells were washed with cold PBS and lysed in 1.5× RIPA buffer supplemented with protease and phosphatase inhibitors. Protein concentrations were quantified, and equal amounts of lysates were resolved by SDS–PAGE (Thermo Fisher Scientific, Waltham, MA, USA, 1862495) and transferred onto PVDF membranes. Membranes were probed with antibodies against β-actin, p-SMAD 1/5 (Cell Signaling Technology, Danvers, MA, USA, 3700) for β-actin, total SMAD 1 (Cell Signaling Technology, 6944), and IFT88 (Proteintech, Rosemont, IL, USA, 13967-1-AP), followed by appropriate HRP-conjugated secondary antibodies. Protein signals were detected using enhanced chemiluminescence and visualized using a ChemiDoc™ MP Imaging System (Bio-Rad Laboratories, Hercules, CA, USA).

2.5. RT-qPCR

Total RNA was extracted from cultured cells using TRIzol reagent according to the manufacturer’s instructions. RNA concentration and purity were assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). First-strand cDNA was synthesized from 500 ng of total RNA using a high-capacity reverse transcription kit. Quantitative real-time PCR was performed using SYBR Green chemistry on a QuantStudio™ 7 Pro Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). Primer sequences are listed in Table 1. All reactions were performed in triplicate, and gene expression levels were normalized to GAPDH. Relative expression was calculated using the 2−ΔΔCt method, and data were analyzed using GraphPad Prism 10.

2.6. Immunofluorescence

Primary tail tenocytes isolated from Scx-CreERT2;Ift88fl/fl mice were transduced overnight with Ad5-CMV-Cre-eGFP (Baylor College of Medicine) at a multiplicity of infection (MOI) of 1000 when cells reached approximately 80% confluence. Transduction efficiency was assessed using a fluorescence microscope (EVOS M5000 Imaging System; Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA). Following transduction, Ift88-deficient cells were serum starved for 48 h and subsequently treated with recombinant BMP4 (50 ng/mL; R&D Systems, Minneapolis, MN, USA) for 1 h. Cells were then fixed in cold methanol for 30 min at −20 °C and permeabilized with 0.1% Triton X-100 for 10 min at room temperature. After blocking with 3% bovine serum albumin (BSA) for 2 h, cells were incubated with primary antibodies at 4 °C overnight, followed by incubation with fluorophore-conjugated secondary antibodies (Goat anti-rabbit IgG Alexa Fluor 647 (Cat. No. A21246, Invitrogen, Carlsbad, CA, USA) and goat anti-mouse IgG Alexa Fluor 488 (Cat. No. A10667, Invitrogen, Carlsbad, CA, USA) for 2 h at room temperature. Primary antibodies were used at the following dilutions: acetylated α-tubulin (1:500; Cat. T7451, Sigma-Aldrich, St. Louis, MO, USA) and phosphorylated SMAD 1/5 (1:500; Cat. 6944, Cell Signaling Technology, Danvers, MA, USA). Fluorescence images were acquired using a Nikon ECLIPSE Ti microscope, and quantitative analysis was performed using NIS-Elements software 5.21.03 (Nikon Corporation, Tokyo, Japan). Only clearly identifiable, intact primary cilia labeled by acetylated α-Tubulin were included in the analysis. For each experimental condition, ciliary length was quantified from 100 cilia obtained from 3 independent experiments, and measurements were performed in a blinded manner when applicable.

2.7. Immunohistochemistry

Formalin-fixed, paraffin-embedded tissue specimens were sectioned at a thickness of 5 µm. Hematoxylin and eosin (H&E) staining, Alcian Blue staining, and p-SMAD 1/5 staining were performed as previously described [39].

2.8. Micro-Computed Tomography

Hindlimbs harvested from WT or Scx-CreERT2;Ift88fl/fl mice following burn–tenotomy were analyzed by micro–computed tomography (µCT) using a VivaCT 40 micro-CT system (Scanco Medical AG, Brüttisellen, Switzerland). Heterotopic bone volume and two-dimensional medial sagittal plane images were obtained for each limb. Scanning parameters included a source voltage of 55 kV, a current of 142 μA, and an isotropic voxel size of 10.5 μm. Mineralized tissue was distinguished from non-mineralized tissue using a lower threshold of 200 and an upper threshold of 1000 Hounsfield units.

2.9. Statistical Analysis

All statistical analyses were performed using GraphPad Prism 10 (GraphPad Software, Boston, MA, USA). Comparisons between two groups were conducted using a two-tailed unpaired Student’s t-test. A p value < 0.05 was considered statistically significant. Significance levels are indicated as follows: p < 0.05; * p < 0.01; ** p < 0.001; ns, not significant. Data are presented as mean ± SEM, and sample sizes are provided in the corresponding figure legends.

3. Results

3.1. Isolation and Confirmation of Primary Tenocytes

We isolated primary tenocytes from tails of WT and Scx-CreERT2;Ift88fl/fl mice. After isolating primary tenocytes, we examined the tenocyte gene expression using myoblasts as a control. The isolation of myoblasts was performed as previously published [40]. We found that Scx and Tnmd genes are highly expressed in tenocytes, but not in myoblasts (Figure 1A,B). In contrast, the Myod1 and Myog genes are highly expressed in myoblasts, but not in tenocytes (Figure 1C,D). We cannot exclude the presence of minor non-tenocyte populations; however, these would be expected to be limited and unlikely to account for the observed phenotypes.

3.2. Ciliation Frequency and Cilia Length Decreased in Scx-CreERT2;Ift88fl/fl Tenocytes

We stained the isolated tenocytes for Ac-Tubulin (Green), p-SMAD 1/5 (Magenta) and nuclear localization with DAPI (Blue). We found that the p-SMAD 1/5 co-localized with Ac-Tubulin at the ciliary base (Figure 2A). The ciliation frequency of tenocytes decreased from 94% to 38% with IFT88 knock down (Figure 2B). In addition, the ciliary length decreased from 5.09 µm to 1.77 µm (Figure 2C). More cells are shown in the Supplementary Figure (Figure S1).

3.3. BMP Signaling Is Inhibited by Dysfunctional Primary Cilia

We then treated the isolated tenocytes with Cre-GFP adenovirus at an MOI of 1000. We found that about 50% of primary tenocytes cells expressed GFP (Figure 3A). We also confirmed that the Ift88 gene expression was significantly inhibited in tenocytes transfected with Cre adenovirus (Figure 3B). By Western blot analysis, we found that the IFT88 protein was reduced in the Cre-treated tenocyte cultures (Figure 3C,D). The p-SMAD 1/5 level decreased significantly in the Cre-treated tenocyte cultures (Figure 3C,E).

3.4. Chondrogenic and Osteogenic Gene Expressions Are Inhibited by Dysfunctional Primary Cilia

Primary tenocytes were isolated from Scx-CreERT2;Ift88fl/fl mice and infected with Cre-GFP adenovirus at a multiplicity of infection (MOI) of 1000. Quantitative RT–qPCR analysis demonstrated that deletion of Ift88 significantly suppressed chondrogenic and osteogenic gene expression. Specifically, the mRNA levels of chondrogenic marker genes, including Sox9, Col2a1, and Acan, were markedly downregulated in Cre-treated tenocytes compared to controls (Figure 4A–C). In addition, the expression of the osteogenic marker gene Runx2 was also significantly reduced in Cre-treated tenocytes (Figure 4D), suggesting impaired chondrogenic and osteogenic differentiation capacity. Collectively, these findings indicate that Ift88 deletion disrupts primary cilia function and attenuates both chondrogenic and osteogenic gene expression in primary tenocytes treated with Cre-GFP adenovirus at a multiplicity of infection (MOI) of 1000.

3.5. Traumatic HO Is Diminished in Mice with Dysfunctional Primary Cilia

To examine the effects of dysfunctional cilia on traumatic HO formation, we crossed Scx-CreERT2 mice with Ift88fl/fl mice to derive homozygous Scx-CreERT2;Ift88fl/fl mice (Figure 5A). Two months after burn–tenotomy injury, we found that, compared to WT, HO volume decreased in Scx-CreERT2;Ift88fl/fl mice with dysfunctional cilia (Figure 5B). The H&E staining confirmed normal endochondral bone formation at ectopic sites in tendons harvested from WT mice, whereas tendons from Scx-CreERT2;Ift88fl/fl mice exhibited reduced bone formation. The Alcian blue staining suggested reduced cartilage-associated staining in the tendon region of Ift88 mutant animals. Phosphorylated SMAD 1/5 immunostaining revealed reduced p-SMAD 1/5 signal intensity in Scx-CreERT2;Ift88fl/fl mice compared to WT mice (Figure 5C).

4. Discussion

Dysfunction of primary cilia causes a broad spectrum of human diseases that are collectively termed ciliopathies. For example, skeletal abnormalities, such as oral–facial malformation, short ribs/limbs, and polydactyly, are commonly associated with ciliopathies [41]. In FOP, a hallmark sign is congenital great toe malformation, but other joint malformations also occur prenatally [2]. In addition, the population and ciliation ratio of fibro/adipogenic progenitors (FAPs), one major cell types initiating HO formation in FOP [14,15], sharply increases upon muscle injury [42,43]. Recently, several studies associated primary cilia with TGF-β signaling [44] and BMP signaling in mammalian cells [45,46,47]. Also, loss of CEP128, a centriole subdistal appendage protein required for regulating ciliary signaling, leads to impaired TGF-β/BMP signaling, especially phosphorylation of Smad 2/3 in zebrafish [48].
In this study, we show that there is a strong association between BMP signaling and the integrity of primary cilia. Co-localization of Ac-Tubulin and p-SMAD 1/5 in WT tenocytes and their abrogation with IFT88 knockdown in vitro suggests an important localized structural relationship. Reduced BMP signaling after IFT88 knockdown further suggests a key structure–functional relationship. Furthermore, using homozygous Scx-CreERT2;Ift88fl/fl mice, we found that traumatic HO can be mitigated in a model of dysfunctional cilia. Taken together, we hypothesize that functional primary cilia play a crucial role in mediating trauma-induced HO through the regulation of BMP signaling (Figure 6).
BMP signaling is involved in the formation of traumatic HO is supported by other evidence. For example, Activin A is expressed in response to injury in both FOP and traumatic HO models, but by different types of cells. Although wild type ACVR1 does not transduce signal when engaged by activin A, activin A is nevertheless expressed in traumatic HO. Anti-activin A does not abrogate traumatic HO, whereas antibodies that neutralize ACVR1 or ALK3-Fc (which blocks osteogenic BMPs) do partly mitigate formation of ectopic bone [49].
The reduction of HO in the Scx-CreERT2;Ift88fl/fl model is robust, but not complete, suggesting that there are other signaling pathways involved in the process of traumatic HO. Indeed, traumatic HO arises through the aberrant activation of multiple osteogenic and inflammatory signaling pathways following severe tissue injury. The early inflammation activates TGF-β signaling, which is considered one of the primary drivers for osteogenic differentiation of mesenchymal progenitors in ectopic endochondral ossification [50]. Concurrently, hypoxia in the injured soft tissue stabilizes HIF-1α, which enhances chondrogenic commitment and synergizes with BMP signaling to promote endochondral ossification [39,51,52]. Additional developmental pathways—including Wnt/β-catenin, Hedgehog, and mTOR—further regulate progenitor expansion, chondrogenesis, and bone formation [36,52,53]. Traumatic HO is regulated by the PTEN/AKT signaling pathway in osteogenic and chondrogenic differentiation of tendon-derived stem cells [54]. It is plausible that primary cilia contribute to the pathological regulation of tendon-derived stem cells by interacting with PTEN/AKT signaling. Coordination among these inflammatory and osteogenic signaling networks form the molecular basis of HO pathogenesis and represent key targets for therapeutic intervention.
Primary cilia function not only as a mechanosensory hub for BMP signaling, but also as a critical regulator of cell proliferation, migration, and lineage commitment. Through their role in coordinating multiple developmental pathways—including Hedgehog, Wnt, and PDGFRα signaling—primary cilia help control the balance between progenitor cell expansion and differentiation [55]. Disruption or heightened sensitivity of ciliary signaling can therefore alter the activation state of mesenchymal progenitors and chondro-osteogenic programs, creating a permissive environment for endochondral ossification. Given these integrative roles, abnormalities in primary cilia structure or signaling may significantly influence susceptibility or progression of HO.
In summary, our findings indicate that primary cilia dysfunction is associated with reduced traumatic HO, at least partly through impaired BMP signaling. Given their central role in coordinating multiple signaling pathways, changes in primary cilia structure or function may contribute to HO susceptibility or progression and warrant further exploration as potential therapeutic targets.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biomedicines14030712/s1, Figure S1: Representative immunofluorescence images showing p-SMAD1/5 colocalized with Ac-Tubulin at the ciliary base.

Author Contributions

Conceptualization, H.W.; methodology, X.Y., S.F.L., S.T., D.A., K.H. and Y.C.; formal analysis, X.Y., S.T., D.A. and Y.C.; investigation, X.Y. and S.T.; resources, A.C., K.H. and J.H.; writing—original draft preparation, X.Y. and H.W.; writing—review and editing, X.Y., H.W. and R.J.P. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Institutes of Health (NIH R01-AR081318) and the International Fibrodysplasia Ossificans Progressiva Association (IFOPA) to H.W. and the Robert and Arlene Kogod Professorship to R.P.

Institutional Review Board Statement

The animal study protocol was approved by Institutional Animal Care and Use Committee of Mayo Clinic (protocol: A00004918-19 and date of approval on 26 June 2023).

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

R.P. is a principal investigator for ongoing clinical trials in FOP sponsored by Ipsen, Incyte, and AshiBio. He is also the co-inventor of Andecaliximab for the treatment of HO. The other authors declare no conflicts of interest.

Abbreviations

HOHeterotopic ossification
FOPFibrodysplasia ossificans progressiva
BMPBone morphogenetic protein
ACVR1Activin receptor A type I
TGF-βTransforming growth factor-beta
IFTIntraflagellar Transport
FAPsFibro/adipogenic progenitors
SMAD 1/5Mothers against decapentaplegic homolog 1/5

References

  1. Meyers, C.; Lisiecki, J.; Miller, S.; Levin, A.; Fayad, L.; Ding, C.; Sono, T.; McCarthy, E.; Levi, B.; James, A.W. Heterotopic Ossification: A Comprehensive Review. JBMR Plus 2019, 3, e10172. [Google Scholar] [CrossRef] [PubMed]
  2. Kaplan, F.S.; Xu, M.; Seemann, P.; Connor, J.M.; Glaser, D.L.; Carroll, L.; Delai, P.; Fastnacht-Urban, E.; Forman, S.J.; Gillessen-Kaesbach, G.; et al. Classic and atypical fibrodysplasia ossificans progressiva (FOP) phenotypes are caused by mutations in the bone morphogenetic protein (BMP) type I receptor ACVR1. Hum. Mutat. 2009, 30, 379–390. [Google Scholar] [CrossRef] [PubMed]
  3. Pignolo, R.J.; Bedford-Gay, C.; Liljesthrom, M.; Durbin-Johnson, B.P.; Shore, E.M.; Rocke, D.M.; Kaplan, F.S. The Natural History of Flare-Ups in Fibrodysplasia Ossificans Progressiva (FOP): A Comprehensive Global Assessment. J. Bone Miner. Res. 2016, 31, 650–656. [Google Scholar] [CrossRef] [PubMed]
  4. Macias-Silva, M.; Hoodless, P.A.; Tang, S.J.; Buchwald, M.; Wrana, J.L. Specific activation of Smad1 signaling pathways by the BMP7 type I receptor, ALK2. J. Biol. Chem. 1998, 273, 25628–25636. [Google Scholar] [CrossRef]
  5. Yu, P.B.; Deng, D.Y.; Lai, C.S.; Hong, C.C.; Cuny, G.D.; Bouxsein, M.L.; Hong, D.W.; McManus, P.M.; Katagiri, T.; Sachidanandan, C.; et al. BMP type I receptor inhibition reduces heterotopic [corrected] ossification. Nat. Med. 2008, 14, 1363–1369. [Google Scholar] [CrossRef]
  6. Fukuda, T.; Kohda, M.; Kanomata, K.; Nojima, J.; Nakamura, A.; Kamizono, J.; Noguchi, Y.; Iwakiri, K.; Kondo, T.; Kurose, J.; et al. Constitutively activated ALK2 and increased SMAD1/5 cooperatively induce bone morphogenetic protein signaling in fibrodysplasia ossificans progressiva. J. Biol. Chem. 2009, 284, 7149–7156. [Google Scholar] [CrossRef]
  7. van Dinther, M.; Visser, N.; de Gorter, D.J.; Doorn, J.; Goumans, M.J.; de Boer, J.; ten Dijke, P. ALK2 R206H mutation linked to fibrodysplasia ossificans progressiva confers constitutive activity to the BMP type I receptor and sensitizes mesenchymal cells to BMP-induced osteoblast differentiation and bone formation. J. Bone Miner. Res. 2010, 25, 1208–1215. [Google Scholar] [CrossRef]
  8. Shen, Q.; Little, S.C.; Xu, M.; Haupt, J.; Ast, C.; Katagiri, T.; Mundlos, S.; Seemann, P.; Kaplan, F.S.; Mullins, M.C.; et al. The fibrodysplasia ossificans progressiva R206H ACVR1 mutation activates BMP-independent chondrogenesis and zebrafish embryo ventralization. J. Clin. Investig. 2009, 119, 3462–3472. [Google Scholar] [CrossRef]
  9. Machiya, A.; Tsukamoto, S.; Ohte, S.; Kuratani, M.; Fujimoto, M.; Kumagai, K.; Osawa, K.; Suda, N.; Bullock, A.N.; Katagiri, T. Effects of FKBP12 and type II BMP receptors on signal transduction by ALK2 activating mutations associated with genetic disorders. Bone 2018, 111, 101–108. [Google Scholar] [CrossRef]
  10. Hatsell, S.J.; Idone, V.; Wolken, D.M.; Huang, L.; Kim, H.J.; Wang, L.; Wen, X.; Nannuru, K.C.; Jimenez, J.; Xie, L.; et al. ACVR1R206H receptor mutation causes fibrodysplasia ossificans progressiva by imparting responsiveness to activin A. Sci. Transl. Med. 2015, 7, 303ra137. [Google Scholar] [CrossRef]
  11. Olsen, O.E.; Wader, K.F.; Hella, H.; Mylin, A.K.; Turesson, I.; Nesthus, I.; Waage, A.; Sundan, A.; Holien, T. Activin A inhibits BMP-signaling by binding ACVR2A and ACVR2B. Cell Commun. Signal. 2015, 13, 27. [Google Scholar] [CrossRef] [PubMed]
  12. Aykul, S.; Corpina, R.A.; Goebel, E.J.; Cunanan, C.J.; Dimitriou, A.; Kim, H.J.; Zhang, Q.; Rafique, A.; Leidich, R.; Wang, X.; et al. Activin A forms a non-signaling complex with ACVR1 and type II Activin/BMP receptors via its finger 2 tip loop. Elife 2020, 9, e54582. [Google Scholar] [CrossRef] [PubMed]
  13. Hino, K.; Ikeya, M.; Horigome, K.; Matsumoto, Y.; Ebise, H.; Nishio, M.; Sekiguchi, K.; Shibata, M.; Nagata, S.; Matsuda, S.; et al. Neofunction of ACVR1 in fibrodysplasia ossificans progressiva. Proc. Natl. Acad. Sci. USA 2015, 112, 15438–15443. [Google Scholar] [CrossRef] [PubMed]
  14. Dey, D.; Bagarova, J.; Hatsell, S.J.; Armstrong, K.A.; Huang, L.; Ermann, J.; Vonner, A.J.; Shen, Y.; Mohedas, A.H.; Lee, A.; et al. Two tissue-resident progenitor lineages drive distinct phenotypes of heterotopic ossification. Sci. Transl. Med. 2016, 8, 366ra163. [Google Scholar] [CrossRef]
  15. Lees-Shepard, J.B.; Yamamoto, M.; Biswas, A.A.; Stoessel, S.J.; Nicholas, S.E.; Cogswell, C.A.; Devarakonda, P.M.; Schneider, M.J., Jr.; Cummins, S.M.; Legendre, N.P.; et al. Activin-dependent signaling in fibro/adipogenic progenitors causes fibrodysplasia ossificans progressiva. Nat. Commun. 2018, 9, 471. [Google Scholar] [CrossRef]
  16. Zhang, Q.; Zhou, D.; Wang, H.; Tan, J. Heterotopic ossification of tendon and ligament. J. Cell Mol. Med. 2020, 24, 5428–5437. [Google Scholar] [CrossRef]
  17. Brooker, A.F.; Bowerman, J.W.; Robinson, R.A.; Riley, L.H., Jr. Ectopic ossification following total hip replacement. Incidence and a method of classification. J. Bone Jt. Surg. Am. 1973, 55, 1629–1632. [Google Scholar] [CrossRef]
  18. Bedi, A.; Zbeda, R.M.; Bueno, V.F.; Downie, B.; Dolan, M.; Kelly, B.T. The incidence of heterotopic ossification after hip arthroscopy. Am. J. Sports Med. 2012, 40, 854–863. [Google Scholar] [CrossRef]
  19. Spinarelli, A.; Patella, V.; Petrera, M.; Abate, A.; Pesce, V.; Patella, S. Heterotopic ossification after total hip arthroplasty: Our experience. Musculoskelet. Surg. 2011, 95, 1–5. [Google Scholar] [CrossRef]
  20. Hong, C.C.; Nashi, N.; Hey, H.W.; Chee, Y.H.; Murphy, D. Clinically relevant heterotopic ossification after elbow fracture surgery: A risk factors study. Orthop. Traumatol. Surg. Res. 2015, 101, 209–213. [Google Scholar] [CrossRef]
  21. Sandeep, K.N.; Suresh, G.; Gopisankar, B.; Abhishek, N.; Sujiv, A. Does Excision of Heterotopic Ossification of the Elbow Result in Satisfactory Patient-Rated Outcomes? Malays. Orthop. J. 2017, 11, 35–40. [Google Scholar] [CrossRef]
  22. Forsberg, J.A.; Pepek, J.M.; Wagner, S.; Wilson, K.; Flint, J.; Andersen, R.C.; Tadaki, D.; Gage, F.A.; Stojadinovic, A.; Elster, E.A. Heterotopic ossification in high-energy wartime extremity injuries: Prevalence and risk factors. J. Bone Jt. Surg. Am. 2009, 91, 1084–1091. [Google Scholar] [CrossRef] [PubMed]
  23. Teasell, R.W.; Mehta, S.; Aubut, J.L.; Ashe, M.C.; Sequeira, K.; Macaluso, S.; Tu, L.; Team, S.R. A systematic review of the therapeutic interventions for heterotopic ossification after spinal cord injury. Spinal Cord. 2010, 48, 512–521. [Google Scholar] [CrossRef] [PubMed]
  24. Engber, W.D.; Reynen, P. Post-burn heterotopic ossification at the elbow. Iowa Orthop. J. 1994, 14, 38–41. [Google Scholar]
  25. Daniels, C.M.; Pavey, G.J.; Arthur, J.; Noller, M.; Forsberg, J.A.; Potter, B.K. Has the Proportion of Combat-Related Amputations That Develop Heterotopic Ossification Increased? J. Orthop. Trauma. 2018, 32, 283–287. [Google Scholar] [CrossRef]
  26. Agarwal, S.; Loder, S.J.; Breuler, C.; Li, J.; Cholok, D.; Brownley, C.; Peterson, J.; Hsieh, H.H.; Drake, J.; Ranganathan, K.; et al. Strategic Targeting of Multiple BMP Receptors Prevents Trauma-Induced Heterotopic Ossification. Mol. Ther. 2017, 25, 1974–1987. [Google Scholar] [CrossRef]
  27. Chaikuad, A.; Alfano, I.; Kerr, G.; Sanvitale, C.E.; Boergermann, J.H.; Triffitt, J.T.; von Delft, F.; Knapp, S.; Knaus, P.; Bullock, A.N. Structure of the bone morphogenetic protein receptor ALK2 and implications for fibrodysplasia ossificans progressiva. J. Biol. Chem. 2012, 287, 36990–36998. [Google Scholar] [CrossRef]
  28. Kan, C.; Ding, N.; Yang, J.; Tan, Z.; McGuire, T.L.; Lu, H.; Zhang, K.; Berger, D.M.P.; Kessler, J.A.; Kan, L. BMP-dependent, injury-induced stem cell niche as a mechanism of heterotopic ossification. Stem Cell Res. Ther. 2019, 10, 14. [Google Scholar] [CrossRef]
  29. Seeley, E.S.; Nachury, M.V. The perennial organelle: Assembly and disassembly of the primary cilium. J. Cell Sci. 2010, 123, 511–518. [Google Scholar] [CrossRef]
  30. Sanchez, I.; Dynlacht, B.D. Cilium assembly and disassembly. Nat. Cell Biol. 2016, 18, 711–717. [Google Scholar] [CrossRef]
  31. Satir, P.; Christensen, S.T. Overview of structure and function of mammalian cilia. Annu. Rev. Physiol. 2007, 69, 377–400. [Google Scholar] [CrossRef] [PubMed]
  32. Goetz, S.C.; Anderson, K.V. The primary cilium: A signalling centre during vertebrate development. Nat. Rev. Genet. 2010, 11, 331–344. [Google Scholar] [CrossRef] [PubMed]
  33. Pazour, G.J.; Dickert, B.L.; Vucica, Y.; Seeley, E.S.; Rosenbaum, J.L.; Witman, G.B.; Cole, D.G. Chlamydomonas IFT88 and its mouse homologue, polycystic kidney disease gene tg737, are required for assembly of cilia and flagella. J. Cell Biol. 2000, 151, 709–718. [Google Scholar] [CrossRef]
  34. Haycraft, C.J.; Zhang, Q.; Song, B.; Jackson, W.S.; Detloff, P.J.; Serra, R.; Yoder, B.K. Intraflagellar transport is essential for endochondral bone formation. Development 2007, 134, 307–316. [Google Scholar] [CrossRef] [PubMed]
  35. Regard, J.B.; Malhotra, D.; Gvozdenovic-Jeremic, J.; Josey, M.; Chen, M.; Weinstein, L.S.; Lu, J.; Shore, E.M.; Kaplan, F.S.; Yang, Y. Activation of Hedgehog signaling by loss of GNAS causes heterotopic ossification. Nat. Med. 2013, 19, 1505–1512. [Google Scholar] [CrossRef]
  36. He, K.; Jiang, H.; Li, W.; Toutounchi, S.; Huang, Y.; Wu, J.; Ma, X.; Baehr, W.; Pignolo, R.J.; Ling, K.; et al. Primary cilia mediate skeletogenic BMP and Hedgehog signaling in heterotopic ossification. Sci. Transl. Med. 2024, 16, eabn3486. [Google Scholar] [CrossRef]
  37. Pryce, B.A.; Brent, A.E.; Murchison, N.D.; Tabin, C.J.; Schweitzer, R. Generation of transgenic tendon reporters, ScxGFP and ScxAP, using regulatory elements of the scleraxis gene. Dev. Dyn. 2007, 236, 1677–1682. [Google Scholar] [CrossRef]
  38. Sugimoto, Y.; Takimoto, A.; Hiraki, Y.; Shukunami, C. Generation and characterization of ScxCre transgenic mice. Genesis 2013, 51, 275–283. [Google Scholar] [CrossRef]
  39. Wang, H.; Lindborg, C.; Lounev, V.; Kim, J.H.; McCarrick-Walmsley, R.; Xu, M.; Mangiavini, L.; Groppe, J.C.; Shore, E.M.; Schipani, E.; et al. Cellular Hypoxia Promotes Heterotopic Ossification by Amplifying BMP Signaling. J. Bone Miner. Res. 2016, 31, 1652–1665. [Google Scholar] [CrossRef]
  40. Li, W.; Zhu, Z.; He, K.; Ma, X.; Pignolo, R.J.; Sieck, G.C.; Hu, J.; Wang, H. Primary cilia in satellite cells are the mechanical sensors for muscle hypertrophy. Proc. Natl. Acad. Sci. USA 2022, 119, e2103615119. [Google Scholar] [CrossRef]
  41. Huber, C.; Cormier-Daire, V. Ciliary disorder of the skeleton. Am. J. Med. Genet. C Semin. Med. Genet. 2012, 160C, 165–174. [Google Scholar] [CrossRef]
  42. Lemos, D.R.; Babaeijandaghi, F.; Low, M.; Chang, C.K.; Lee, S.T.; Fiore, D.; Zhang, R.H.; Natarajan, A.; Nedospasov, S.A.; Rossi, F.M. Nilotinib reduces muscle fibrosis in chronic muscle injury by promoting TNF-mediated apoptosis of fibro/adipogenic progenitors. Nat. Med. 2015, 21, 786–794. [Google Scholar] [CrossRef] [PubMed]
  43. Kopinke, D.; Roberson, E.C.; Reiter, J.F. Ciliary Hedgehog Signaling Restricts Injury-Induced Adipogenesis. Cell 2017, 170, 340–351 e312. [Google Scholar] [CrossRef] [PubMed]
  44. Anvarian, Z.; Mykytyn, K.; Mukhopadhyay, S.; Pedersen, L.B.; Christensen, S.T. Cellular signalling by primary cilia in development, organ function and disease. Nat. Rev. Nephrol. 2019, 15, 199–219. [Google Scholar] [CrossRef] [PubMed]
  45. Xie, Y.F.; Shi, W.G.; Zhou, J.; Gao, Y.H.; Li, S.F.; Fang, Q.Q.; Wang, M.G.; Ma, H.P.; Wang, J.F.; Xian, C.J.; et al. Pulsed electromagnetic fields stimulate osteogenic differentiation and maturation of osteoblasts by upregulating the expression of BMPRII localized at the base of primary cilium. Bone 2016, 93, 22–32. [Google Scholar] [CrossRef]
  46. Vion, A.C.; Alt, S.; Klaus-Bergmann, A.; Szymborska, A.; Zheng, T.; Perovic, T.; Hammoutene, A.; Oliveira, M.B.; Bartels-Klein, E.; Hollfinger, I.; et al. Primary cilia sensitize endothelial cells to BMP and prevent excessive vascular regression. J. Cell Biol. 2018, 217, 1651–1665. [Google Scholar] [CrossRef]
  47. Koefoed, K.; Skat-Rordam, J.; Andersen, P.; Warzecha, C.B.; Pye, M.; Andersen, T.A.; Ajbro, K.D.; Bendsen, E.; Narimatsu, M.; Vilhardt, F.; et al. The E3 ubiquitin ligase SMURF1 regulates cell-fate specification and outflow tract septation during mammalian heart development. Sci. Rep. 2018, 8, 9542. [Google Scholar] [CrossRef]
  48. Monnich, M.; Borgeskov, L.; Breslin, L.; Jakobsen, L.; Rogowski, M.; Doganli, C.; Schroder, J.M.; Mogensen, J.B.; Blinkenkjaer, L.; Harder, L.M.; et al. CEP128 Localizes to the Subdistal Appendages of the Mother Centriole and Regulates TGF-beta/BMP Signaling at the Primary Cilium. Cell Rep. 2018, 22, 2584–2592. [Google Scholar] [CrossRef]
  49. Hwang, C.; Pagani, C.A.; Das, N.; Marini, S.; Huber, A.K.; Xie, L.; Jimenez, J.; Brydges, S.; Lim, W.K.; Nannuru, K.C.; et al. Activin A does not drive post-traumatic heterotopic ossification. Bone 2020, 138, 115473. [Google Scholar] [CrossRef]
  50. Wang, X.; Li, F.; Xie, L.; Crane, J.; Zhen, G.; Mishina, Y.; Deng, R.; Gao, B.; Chen, H.; Liu, S.; et al. Inhibition of overactive TGF-beta attenuates progression of heterotopic ossification in mice. Nat. Commun. 2018, 9, 551. [Google Scholar] [CrossRef]
  51. Agarwal, S.; Loder, S.; Brownley, C.; Cholok, D.; Mangiavini, L.; Li, J.; Breuler, C.; Sung, H.H.; Li, S.; Ranganathan, K.; et al. Inhibition of Hif1alpha prevents both trauma-induced and genetic heterotopic ossification. Proc. Natl. Acad. Sci. USA 2016, 113, E338–E347. [Google Scholar] [CrossRef]
  52. Wang, H.; Kaplan, F.S.; Pignolo, R.J. The HIF-1alpha and mTOR Pathways Amplify Heterotopic Ossification. Biomolecules 2024, 14, 147. [Google Scholar] [CrossRef]
  53. Kan, C.; Chen, L.; Hu, Y.; Ding, N.; Lu, H.; Li, Y.; Kessler, J.A.; Kan, L. Conserved signaling pathways underlying heterotopic ossification. Bone 2018, 109, 43–48. [Google Scholar] [CrossRef]
  54. Wei, D.; Song, D.; Wang, H.; Su, Y.; Liang, J.; Xu, J.; Zhao, J.; Liu, Q. Carnosic acid serves as a dual Nrf2 activator and PTEN/AKT suppressor to inhibit traumatic heterotopic ossification. Stem Cell Res. Ther. 2025, 17, 59. [Google Scholar] [CrossRef]
  55. Christensen, S.T.; Pedersen, S.F.; Satir, P.; Veland, I.R.; Schneider, L. The primary cilium coordinates signaling pathways in cell cycle control and migration during development and tissue repair. Curr. Top. Dev. Biol. 2008, 85, 261–301. [Google Scholar] [CrossRef]
Biomedicines 14 00712 g001
Figure 1. Isolation and confirmation of primary tenocytes. Primary tenocytes were isolated from tails of WT or Scx-CreERT2;Ift88fl/fl mice. Expression of tenocyte and myoblast marker genes were examined. (A,B) Scx and Tnmd genes are highly expressed in tenocytes, but not in myoblasts. (C,D) the Myod1 and Myog genes are highly expressed in myoblasts, but not in tenocytes. Data are presented as means ± SEM (n = 3). Statistical analyses were performed by two-tailed unpaired Student’s t-test. ** p < 0.01; *** p < 0.001.
Figure 1. Isolation and confirmation of primary tenocytes. Primary tenocytes were isolated from tails of WT or Scx-CreERT2;Ift88fl/fl mice. Expression of tenocyte and myoblast marker genes were examined. (A,B) Scx and Tnmd genes are highly expressed in tenocytes, but not in myoblasts. (C,D) the Myod1 and Myog genes are highly expressed in myoblasts, but not in tenocytes. Data are presented as means ± SEM (n = 3). Statistical analyses were performed by two-tailed unpaired Student’s t-test. ** p < 0.01; *** p < 0.001.
Biomedicines 14 00712 g001
Biomedicines 14 00712 g002
Figure 2. Ciliation frequency and cilia length are decreased in Scx-CreERT2;Ift88fl/fl tenocytes. Following BMP4 stimulation, isolated tenocytes were fixed and stained for Ac-Tubulin. (A) Representative immunofluorescence images showing p-SMAD 1/5 (Magenta) co-localized with Ac-Tubulin (Green) at the ciliary base in control (Ctrl) tenocytes. Nuclei were counterstained with DAPI (Blue). The boxed region indicates cilium, and is shown at higher magnification. (B) Quantification of the ciliation frequency revealed a significant decrease in Cre-treated (IFT88 knockdown) tenocytes compared with controls. In total, 100 cells per condition were analyzed for ciliation percentage quantification. (C) The ciliary length decreased from 5.09 µm to 1.77 µm with IFT88 knock down. Data is presented as means ± SEM (n = 4). Statistical analyses were performed by two-tailed unpaired Student’s t-test. **** p < 0.0001. In total, 100 cells were measured for cilia length for each condition. Ctrl, Control; Cre, IFT88 knock down. Scale bar: 10 µm.
Figure 2. Ciliation frequency and cilia length are decreased in Scx-CreERT2;Ift88fl/fl tenocytes. Following BMP4 stimulation, isolated tenocytes were fixed and stained for Ac-Tubulin. (A) Representative immunofluorescence images showing p-SMAD 1/5 (Magenta) co-localized with Ac-Tubulin (Green) at the ciliary base in control (Ctrl) tenocytes. Nuclei were counterstained with DAPI (Blue). The boxed region indicates cilium, and is shown at higher magnification. (B) Quantification of the ciliation frequency revealed a significant decrease in Cre-treated (IFT88 knockdown) tenocytes compared with controls. In total, 100 cells per condition were analyzed for ciliation percentage quantification. (C) The ciliary length decreased from 5.09 µm to 1.77 µm with IFT88 knock down. Data is presented as means ± SEM (n = 4). Statistical analyses were performed by two-tailed unpaired Student’s t-test. **** p < 0.0001. In total, 100 cells were measured for cilia length for each condition. Ctrl, Control; Cre, IFT88 knock down. Scale bar: 10 µm.
Biomedicines 14 00712 g002
Biomedicines 14 00712 g003
Figure 3. BMP signaling is inhibited in tenocytes with dysfunctional primary cilia. Isolated tenocytes were treated with Cre-GFP adenovirus at an MOI of 1000. (A) About 50% of primary tenocytes cells expressed GFP. Cells were uniformly stimulated with BMP4 (50 ng/mL) for 1 h to activate canonical BMP signaling prior to analysis. (B) The Ift88 expression was significantly inhibited in tenocytes transfected with Cre adenovirus. (C) IFT88 protein was substantially reduced from the Ade-Cre-virus-treated tenocyte cultures. The Smad 1/5 phosphorylation level decreased significantly in the Cre-treated tenocytes. (D) The quantification of IFT88 level normalized to β-actin level (from Western blot in (C)). (E) The quantification of SMAD 1/5 phosphorylation level normalized to β-actin (from Western blot in (C)). Data is presented as means ± SEM (n = 3). Statistical analyses were performed by two-tailed unpaired Student’s t-test. ** p < 0.01; *** p < 0.001.
Figure 3. BMP signaling is inhibited in tenocytes with dysfunctional primary cilia. Isolated tenocytes were treated with Cre-GFP adenovirus at an MOI of 1000. (A) About 50% of primary tenocytes cells expressed GFP. Cells were uniformly stimulated with BMP4 (50 ng/mL) for 1 h to activate canonical BMP signaling prior to analysis. (B) The Ift88 expression was significantly inhibited in tenocytes transfected with Cre adenovirus. (C) IFT88 protein was substantially reduced from the Ade-Cre-virus-treated tenocyte cultures. The Smad 1/5 phosphorylation level decreased significantly in the Cre-treated tenocytes. (D) The quantification of IFT88 level normalized to β-actin level (from Western blot in (C)). (E) The quantification of SMAD 1/5 phosphorylation level normalized to β-actin (from Western blot in (C)). Data is presented as means ± SEM (n = 3). Statistical analyses were performed by two-tailed unpaired Student’s t-test. ** p < 0.01; *** p < 0.001.
Biomedicines 14 00712 g003
Biomedicines 14 00712 g004
Figure 4. Reduced expression of chondrogenic markers in Cre-treated tenocytes with dysfunctional primary cilia. RT–qPCR analysis of chondrogenic gene expression in control (Ctrl) and Cre-treated tenocytes. Expression levels of Sox9 (A), Col2α1 (B), Acan (C), and Runx2 (D) were significantly reduced in the Cre-treated tenocytes compared with controls. Gene expression was normalized to Gapdh housekeeping gene expression and presented relative to the control group. Data are shown as mean ± SEM (n = 3). Statistical analyses were performed by two-tailed unpaired Student’s t-test. ** p < 0.01, *** p < 0.001.
Figure 4. Reduced expression of chondrogenic markers in Cre-treated tenocytes with dysfunctional primary cilia. RT–qPCR analysis of chondrogenic gene expression in control (Ctrl) and Cre-treated tenocytes. Expression levels of Sox9 (A), Col2α1 (B), Acan (C), and Runx2 (D) were significantly reduced in the Cre-treated tenocytes compared with controls. Gene expression was normalized to Gapdh housekeeping gene expression and presented relative to the control group. Data are shown as mean ± SEM (n = 3). Statistical analyses were performed by two-tailed unpaired Student’s t-test. ** p < 0.01, *** p < 0.001.
Biomedicines 14 00712 g004
Biomedicines 14 00712 g005
Figure 5. Traumatic HO is diminished in mice with dysfunctional primary cilia. (A) Two months after surgery, legs were harvested and examined with µCT. HO sites are marked with red circles. (B) The quantification of the HO volume measured by µCT. (C) H&E staining showed the confirmed bone structure in the harvested tendons from WT mice or Scx-CreERT2;Ift88fl/fl mice. Alcian blue staining indicated the cartilage formation in the Scx-CreERT2;Ift88fl/fl mice compared to WT mice. Phosphorylated SMAD 1/5 immunostaining revealed the p-SMAD 1/5 levels in Scx-CreERT2;Ift88fl/fl mice compared to WT mice. The boxed region indicates the p-SMAD 1/5, and is shown at higher magnification. Data is presented as means ± SEM (n = 5). Statistical analyses were performed by two-tailed unpaired Student’s t-test. ** p < 0.01. Scale bar: 100 µm.
Figure 5. Traumatic HO is diminished in mice with dysfunctional primary cilia. (A) Two months after surgery, legs were harvested and examined with µCT. HO sites are marked with red circles. (B) The quantification of the HO volume measured by µCT. (C) H&E staining showed the confirmed bone structure in the harvested tendons from WT mice or Scx-CreERT2;Ift88fl/fl mice. Alcian blue staining indicated the cartilage formation in the Scx-CreERT2;Ift88fl/fl mice compared to WT mice. Phosphorylated SMAD 1/5 immunostaining revealed the p-SMAD 1/5 levels in Scx-CreERT2;Ift88fl/fl mice compared to WT mice. The boxed region indicates the p-SMAD 1/5, and is shown at higher magnification. Data is presented as means ± SEM (n = 5). Statistical analyses were performed by two-tailed unpaired Student’s t-test. ** p < 0.01. Scale bar: 100 µm.
Biomedicines 14 00712 g005
Biomedicines 14 00712 g006
Figure 6. Primary cilia regulate traumatic HO. Schematic illustrating the role of primary cilia in BMP–SMAD signaling during traumatic HO. The ciliary protein IFT88 is required for the formation and function of the primary cilium, which acts as a signaling hub at the cell membrane. Upon activation of BMP signaling, SMAD1/5 becomes phosphorylated (p-SMAD1/5) near the basal body of the cilium. Phosphorylated SMAD1/5 translocates to the nucleus to regulate transcription of osteogenic genes, ultimately promoting ectopic endochondral bone formation and the development of heterotopic ossification.
Figure 6. Primary cilia regulate traumatic HO. Schematic illustrating the role of primary cilia in BMP–SMAD signaling during traumatic HO. The ciliary protein IFT88 is required for the formation and function of the primary cilium, which acts as a signaling hub at the cell membrane. Upon activation of BMP signaling, SMAD1/5 becomes phosphorylated (p-SMAD1/5) near the basal body of the cilium. Phosphorylated SMAD1/5 translocates to the nucleus to regulate transcription of osteogenic genes, ultimately promoting ectopic endochondral bone formation and the development of heterotopic ossification.
Biomedicines 14 00712 g006
Table 1. Primer sequences used in the RT-qPCR.
Table 1. Primer sequences used in the RT-qPCR.
Gene NameSequence
Gapdh FTGAAGGTCGGTGTGAACGGATTTGGC
Gapdh RCATGTAGGCCATGAGGTCCACCAC
Scx FAGCCCAAACAGATCTGCACCTT
Scx RCTTCCACCTTCACTAGTGGCATCA
Tnmd FTGTACTGGATCAATCCCACTCT
Tnmd RGCTCATTCTGGTCAATCCCCT
Myod1 FCTGCTCTGATGGCATGATGGAT
Myod1 RACTGTAGTAGGCGGTGTCGT
Myog FCAACCAGGAGGAGCGCGATCTCCG
Myog RGCTGGGTGTTAGCCTTATGTGAATGG
Ift88 FTCCAACTGATTCCCAAGCTC
Ift88 RTGGCACTCAGTCGTTCACTC
Sox9 FGCGTGCAGCACAAGAAAGAC
Sox9 RTCCGTTCTTCACCGACTTCCT
Col2α1 FCGAGTGGAAGAGCGGAGACTA
Col2α1 RGAAAACTTTCATGGCGTCCAA
Acan FCCTGCTACTTCATCGACCCC
Acan RAGATGCTGTTGACTCGAACCT
Runx2 FCAGATCCCAGGCAGGCACAGTC
Runx2 RACAGCGGCGTGGTGGAGTG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yuan, X.; Toutounchi, S.; Law, S.F.; Achudhan, D.; Chandra, A.; He, K.; Cao, Y.; Hu, J.; Pignolo, R.J.; Wang, H. Primary Cilia Are Required for Efficient BMP Signaling in Traumatic Heterotopic Ossification. Biomedicines 2026, 14, 712. https://doi.org/10.3390/biomedicines14030712

AMA Style

Yuan X, Toutounchi S, Law SF, Achudhan D, Chandra A, He K, Cao Y, Hu J, Pignolo RJ, Wang H. Primary Cilia Are Required for Efficient BMP Signaling in Traumatic Heterotopic Ossification. Biomedicines. 2026; 14(3):712. https://doi.org/10.3390/biomedicines14030712

Chicago/Turabian Style

Yuan, Xinyuan, Saman Toutounchi, Susan F. Law, David Achudhan, Abhishek Chandra, Kai He, Yingshu Cao, Jinghua Hu, Robert J. Pignolo, and Haitao Wang. 2026. "Primary Cilia Are Required for Efficient BMP Signaling in Traumatic Heterotopic Ossification" Biomedicines 14, no. 3: 712. https://doi.org/10.3390/biomedicines14030712

APA Style

Yuan, X., Toutounchi, S., Law, S. F., Achudhan, D., Chandra, A., He, K., Cao, Y., Hu, J., Pignolo, R. J., & Wang, H. (2026). Primary Cilia Are Required for Efficient BMP Signaling in Traumatic Heterotopic Ossification. Biomedicines, 14(3), 712. https://doi.org/10.3390/biomedicines14030712

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop