Bioartificial Cardiac Patches Functionalized with Apelin-13 Increase Cardiac C-Type Natriuretic Peptide Expression in Infarcted Rats

Abstract

Background: recently, regenerative medicine has introduced a new branch of science that facilitates the repair of damaged tissues and organs in acute myocardial infarction. This study explores the role of the C-type natriuretic peptide (CNP) system in myocardial infarction (MI) and its modulation by Apelin-13 functionalized patches (A-13p). Methods: using an experimental rat model of ischemia/reperfusion, the rats were divided into four groups: Sham, Infarct, Sham with A-13p, and Infarct with A-13p. Cardiac tissue from the infarct, border, and remote zones was analyzed for CNP and its receptors’ mRNA expression via Real-Time PCR. Results: histological analysis, 4 weeks post A-13p implantation, showed no damage from A-13p implantation in either MI or Sham groups, with reduced left ventricle wall thinning in the Infarct group treated with A-13p. CNP mRNA expression was higher in the infarcted groups (p = ns), especially in the border/infarct zone (BZ + IZ), compared to the Sham group (p = 0.05). NPR-B receptor expression was higher in the RZ than in (BZ + IZ), both in the absence (p = 0.02) and presence of patches (p = 0.01), while NPR-C expression was lower. No significant differences were observed in VEGF mRNA levels across the groups. Conclusions: the findings suggest that the CNP system is involved in MI and that A-13p modulates CNP expression, highlighting CNP as a potential target for therapeutic strategies aimed at regulating vascular remodeling and angiogenesis in MI treatment.

1. Introduction

In recent years, acute myocardial infarction (AMI) has remained a leading cause of premature mortality and disability worldwide [1]. Myocardial infarction (MI) causes sudden myocardial cell death due to ischemia, triggering extensive tissue remodeling. Adult mammalian hearts have limited regenerative capacity [2], making myocardial regeneration a major clinical challenge. Post-infarction repair involves a strong angiogenic response that originates at the infarct border zone and extends into the necrotic core [3].

Although various therapies alleviate clinical symptoms, innovative strategies to promote tissue regeneration are still under investigation. Cardiomyocyte loss during AMI involves apoptosis, autophagy, and necrosis. Recently, regenerative medicine has introduced a new branch of science that facilitates the repair of damaged tissues and organs in AMI [4]. The ideal therapy could biologically stimulate and induce regeneration, address cardiac mechanics, and consider the inflammatory stage. Biomaterials of both synthetic and natural origin, administered either as patches or injectable treatments, are widely proposed for use in MI, each presenting its own advantages and limitations [5,6,7]. Biological stimulation, however, is essential for restoring cardiac function and is mediated by either bioactive factors incorporated into the biomaterials and/or through other intrinsic bio-inductive scaffold characteristics [8].

In recent years, apelin has emerged as a promising therapeutic target in cardiovascular disease, including ischemic heart disease and heart failure, due to its protective effects against multiple pathological mechanisms [9,10,11,12,13]. Activation of the G protein-coupled APJ receptor by apelin reduces infarct size, improves post-ischemic contractile recovery, and may support reverse remodeling [10,11]. Apelin also promotes angiogenesis in the myocardium, suggesting its potential to enhance regenerative therapies [12,13,14], and the modulation of APJ-related pathways could represent a promising therapeutic strategy for AMI, for example, through the use of innovative bioartificial acellular patches functionalized with Apelin-13.

Based on these premises, we recently developed an advanced multifunctional bioartificial cardiac patch conceived to address the multifaceted biological and mechanical demands of myocardial tissue regeneration following an infarction [15]. The patch is functionalized with Apelin-13 to promote angiogenesis, anti-apoptotic signaling, recruitment of progenitor cells, and inhibition of fibrosis [10,11,12,13,16,17]. Its surface also incorporates molecularly imprinted nanoparticles (MIPs) to selectively sequester matrix metalloproteinase-9 (MMP-9), mitigating adverse extracellular matrix remodeling without impairing physiological repair [15].

In a preclinical rat model of ischemia/reperfusion (I/R) injury, the patch was epicardially implanted and evaluated over 4 weeks. The patch was found to be well-retained on the myocardial surface, biocompatible, and non-immunogenic, with no damage observed in the healthy myocardium. Importantly, it promoted vascularization, recruited endogenous progenitor cells, and supported proper cardiomyocyte alignment as well as gap junction distribution at the implantation site. Histological and molecular analyses showed reduced fibrotic area, preservation of tissue architecture, and expression of key regenerative markers [15]. To further elucidate the molecular mechanisms underlying these effects, we focused on two key mediators of post-infarction repair: C-type natriuretic peptide (CNP) and vascular endothelial growth factor (VEGF). CNP and VEGF play critical but incompletely defined roles in myocardial remodeling. Evidence on the cardioprotective effects of CNP and its receptors (NPR-B, NPR-C) is mixed: some studies report pro-apoptotic and anti-proliferative effects [18,19,20], while others show that exogenous CNP limits late remodeling [21]. VEGF expression is normally low but increases post-MI in response to inflammation and mechanical stress, suggesting a potential apelin-mediated pro-angiogenic effect [22,23,24,25]. Several preclinical studies indicate that myocardial VEGF overexpression can prevent [26] or limit [27] late remodeling through induction of angiogenesis. A previous study of ours [28] indicated that CNP modulates VEGF-dependent vasculogenesis during post-ischemic remodeling, yet its precise role remains unclear.

This study aimed to evaluate changes in the CNP system and VEGF mRNA expression in cardiac tissue from rats subjected to ischemia/reperfusion and treated with the Apelin-13-functionalized patch, to better define the molecular mechanisms underlying patch-induced myocardial regeneration.

2. Materials and Methods

2.1. Preparation of the Microstructured Electroconductive Nano-Functionalized Drug-Eluting Patch

Poly (DL-lactide-co-glycolide) (PLGA; 50:50 lactide: glycolide ratio, MW 40–75 kDa), gelatin (porcine skin-derived), dichloromethane (DCM), and acetone (ACT) were obtained from Carlo Erba Reagenti (Turin, Italy). The self-assembling peptide 9-fluorenylmethoxycarbonyl-diphenylalanine (Fmoc-FF) was provided by Biogelx Ltd. (Chapelhall, Scotland, UK), and (Glp1)-Apelin-13 (trifluoroacetate salt, MW 1533.8 Da) was supplied by Cayman Chemical through Vinci-Biochem Srl (Florence, Italy). All other reagents and materials, unless otherwise specified, were purchased from Sigma-Aldrich (Milan, Italy).

The patch was prepared following a protocol previously described by Cristallini et al., 2025 [15]. Briefly, the external membranes were produced using a PLGA/gelatin blend (70:30 w/w), with PLGA dissolved in DCM and gelatin in bidistilled water (10% w/v). Fmoc-FF was added at 0.025% w/v in ACT to enhance electroconductive properties. The blended solution was cast into PDMS molds with predefined microstructured geometry and dried under a ventilated hood for 24 h. The resulting membranes were carefully removed and sterilized.

The internal layer consisted of a 10 mM Fmoc-FF hydrogel, prepared by dissolving the peptide in bidistilled water adjusted to pH 12 with NaOH, followed by sonication and pH adjustment to 7.5–8.5 using HCl. After gelation at 4 °C for 24 h, Apelin-13 (0.05 mM) was incorporated into the hydrogel. This was then deposited onto the flat, non-microstructured side of one membrane. A second membrane was placed on top, with the microstructured surfaces facing outward, and the patch was sealed using a heated blade system.

The external surfaces of the patch were functionalized with two types of nanoparticles: Apelin-13-loaded polyhydroxybutyrate (PHB) nanoparticles and molecularly imprinted nanoparticles (MIPs) selective for MMP-9. PHB nanoparticles were produced by adding PHB dissolved in ACT dropwise into a 0.1% w/v polyvinyl alcohol (PVA) solution, followed by washing, filtration, and incubation with 0.05 mM Apelin-13 for 2 h. MIPs were synthesized by precipitation polymerization using methacrylic acid (MAA), polyvinylpyrrolidone (PVP), and trimethylpropane trimethacrylate (TRIM) in the presence of human recombinant MMP-9 as a template. Following polymerization, the MIPs were thoroughly washed, the template was removed, and the particles were evaluated for selectivity.

Both nanoparticle suspensions were prepared in a 30:70 water/ethanol solution, sonicated, and spray-deposited onto the external membrane surfaces, achieving deposition densities of approximately 3.4 μg/cm² for PHB nanoparticles and 10 μg/cm² for MIPs. Visual and schematic representations of the patch architecture are shown in Figure 1a,b.

2.2. Scanning Electron Microscopy (SEM) Analysis

The surface morphology of the samples was examined using scanning electron microscopy (SEM) with a FEI Quanta™ 450 FEG instrument (USA). Imaging was performed under high-vacuum conditions at an accelerating voltage of 10 kV, using a manual aperture and a beam spot size of 3. Micrographs were acquired at 1000× magnification to assess the structural features and surface topography of the patch before and after degradation.

2.3. Animal Model of Myocardial Infarction

All animal procedures were approved by the Italian Ministry of Health (authorization no. 536/2020-PR, issued on 27 May 2020) and conducted in accordance with Directive 2010/63/EU of the European Parliament.

Wistar male rats (4 months of age; 300–350 g body weight, n = 27) were purchased from ENVIGO RMS srl (San Pietro al Natisone, Udine, Italy). Animals were subdivided into 4 groups: (1) the Sham group (n = 7), rats subjected to surgery without proceeding with ligation of the left anterior descending coronary artery (LAD), which served as the control group; (2) the Infarct group (n = 7), rats subjected to 30 min LAD ligation followed by reperfusion; (3) the sham animals with the application of the Apelin-13 functionalized patch (A-13p) on cardiac surface (Sham + A-13p group, n = 6); and (4) the infarcted rats with the application of the A-13p on cardiac surface (Infarct + A-13p group, n = 7).

The animals were housed up to 2 animals per cage. Food and water were provided ad libitum, a 12 h light/dark cycle was maintained, and the room temperature was regulated at 21 ± 1 °C (humidity 40–60%), with an average lighting intensity of 1.2 cd/m². The antibiotic therapy started the day before the operation. Myocardial infarction was induced by temporary ligation of the LAD (30 min of ischemia followed by unrestrained reperfusion), according to a previous study [29]. In summary, the rats received prophylactic analgesic therapy with Carprofen at a dosage of 5 mg/kg and were anesthetized using Zoletil and Xylazine at 40 mg/kg and 7.5 mg/kg, respectively. Every effort was made to minimize animal suffering.

After being placed in supine decubitus on a thermostated surface (37 °C), the rat was intubated trans-laryngeally and mechanically ventilated, with a small animal ventilator. Subsequently, the animal was placed in right lateral decubitus, and the thoracic cavity was accessed through a left lateral thoracotomy. After removal of the pericardium, the LAD was visualized and temporarily occluded. The effectiveness of the coronary occlusion was confirmed by the observation of the immediate appearance of pallor limited to the area of the left ventricle previously supplied with blood. Ten minutes after the occlusion, the patch functionalized with Apelin-13 (A-13p) of appropriate size to cover the ischemic area was positioned on the ventricle surface and fixed with a single central stitch. After LAD ligation, the muscle layer and skin were sutured, and the animals were kept warm and under observation. Post-operatively, all rats underwent hydration with physiological saline and received the analgesic therapy (acetylsalicylic acid 100 mg/kg) for three days or until needed. An antibiotic therapy (Baytril^® 2.5% oral solution) was maintained for one week.

2.4. Histological and Immunofluorescence Analyses

Hearts were harvested at sacrifice and cut through the ventricle midpoint plane at the level of the papillary muscles. The half-cup containing the base of the heart was fixed in 10% buffered formalin and paraffin-embedded. Then, 5 µm slices were cut from paraffin blocks and mounted on a microscope slide. Afterward, the slides were de-paraffined by immersion in xylene and rehydrated through a descending scale of alcohol. Infarct evaluation was performed through histological analysis of explanted hearts four weeks post-surgery. Sections were stained with Hematoxylin–eosin and Mallory’s trichrome (04-010802, Bio-Optica, Milan, Italy) following the manufacturer’s procedures, to evaluate myocardial fibrosis and ventricular wall morphology, including wall thinning in the infarcted area. Stained sections were analyzed using a light microscope equipped with a digital camera. For immunofluorescence analysis, after de-paraffinization and re-hydration, permeabilization in 0.15% Triton X-100 and blocking of non-specific binding sites (through incubation with 6% BSA and 3% NGS) were performed. Tissue sections were then incubated with primary antibodies directed against anti-TnC (1:30, sc-48347, Santa Cruz, Germany) and anti-smooth muscle α-actin (α-SMA) (1:50, ab5694, Abcam, Cambridge, UK) O/N at 4 °C, followed by secondary antibodies conjugated to phycoerythrin (1:200, sc-3738, Santa Cruz, Heidelberg, Germany) and Alexa Fluor 488 (1:200, A11070, Invitrogen, Thermo Fisher, Monza, Italy), respectively, for 2 h at RT. Samples were washed in PBS, and nuclei were counterstained using DAPI nuclear dye (1:2500, Sigma-Aldrich, Milan, Italy) for 30 min. Samples were stored at 4 °C in the dark and imaged using a laser scanning confocal microscope (LSM510, Carl Zeiss, Oberkochen, Germany). Vessel diameter measurements were carried out with Image J software (Version 1.54p, February 2025, National Institute of Health, USA).

2.5. Tissue Handling, RNA Extraction, and cDNA Synthesis

Cardiac tissue harvested by the border, infarct, and remote (BZ, IZ, RZ) zone was homogenized with a guanidinium thiocyanate-phenol solution (Qiazol^® Qiagen S.p.A., Milano, Italy) using an automated tissue-lyser Mixer Mill MM300 (Qiagen S.p.A, Milano, Italy) to disrupt cell membranes and release nucleic acids. After chloroform addition and sample centrifugation, RNA was purified from the upper aqueous phase using a dedicated assay (miRneasy Mini kit, Qiagen S.p.A., Milano, Italy). High-quality RNA was eluted in an 80 μL volume of RNase-free water; all RNA samples were stored at −80 °C after integrity, purity, and concentration evaluation. Following DNAse treatment (RNase-Free DNase Set, Qiagen S.p.A, Milano, Italy), the first-strand cDNA was synthesized with an iScript cDNA Synthesis kit (Bio-Rad, Hercules, CA, USA) using about 2 µg of total RNA as template. The reverse transcriptase reaction sequence consisted of incubation at 25 °C for 5 min, followed by three different cycles at 42 °C for 30 min and 45–48 °C for 10 min, to better separate the strands. The reverse transcriptase enzyme was inactivated by heating to 85 °C for 5 min. The cDNA samples obtained were placed on ice and stored at 4 °C until further use.

2.6. Real-Time PCR Experiments

The cDNA samples were diluted 1:10 in bi-distilled water for Real-Time PCR analysis, which was performed in duplicate in the Bio-Rad C1000™ thermal cycler (CFX-96 Real-Time PCR detection systems, Bio-Rad Laboratories Inc., Hercules, CA, USA). For the monitoring of the cDNA amplification reaction, a fluorogenic DNA-binding dye, EvaGreen (SsoFAST EvaGreen Supermix, Bio-Rad Laboratories Inc., CA) was used. Real-Time PCR of the CNP system and VEGF was performed in a volume of 20 μL per reaction. The reaction mixture included 2 μL of template cDNA [100 ng/μL], 0.2 μM of each primer (Sigma-Aldrich, St. Louis, MO, USA), 1X SsoFAST EvaGreen SuperMix (BioRad), and sterile H₂O. The amplification protocol started with 98 °C for 30 s, followed by 40 cycles at 95 °C for 5 s and 58/60 °C for 30 s. To assess product specificity, amplicons were systematically checked by melting curve analysis. Melting curves were generated from 65 °C to 95 °C with increments of 0.5 °C/cycle. Multiple inter-run calibrators were always used to allow comparison of Ct values obtained in different runs.

The optimal Real-Time PCR conditions were developed for each gene analyzed in rat cardiac tissue. The efficiency and the linearity of amplification were evaluated by varying primer annealing temperature and sample concentration. Since Real-Time PCR efficiency is highly dependent on the primers used, their sequences were accurately selected, and whenever possible, intron-spanning primers were selected to avoid amplification of genomic DNA. To improve primer specificity, the regions of homology were checked and excluded, and secondary structures leading to poor or no yield of the product were avoided. The primers for both housekeeping and target genes were designed with a specific software Beacon Designer^® (version 8.1; Premier Biosoft International, Palo Alto, CA) with reference to nucleotide sequences included in the NCBI database GenBank (http://www.ncbi.nlm.nih.gov/Genbank/index.html, 1 February 2024) (

Table 1. Details of specific primers used in Real-Time PCR experiment.

Gene	Primer Sequence	GenBank Accession Number	Amplicon Length	Ta, °C	Efficiency, %
ACTB	F: GTCGTACCACTGGCATTGTG R: CTCTCAGCTGTGGTGGTGAA	NM_031144	181 bp	60	104.3
HPRT1	F: CCCAGCGTCGTGATTAGTGATG R: TTCAGTCCTGTCCTAATCAGTC	NM_012583	125 bp	60	103
RPL13a	F: GGATCCCTCCACCCTATGACA R: CTGGTACTTCCACCCGACCTC	NM_173340	130 bp	60	101
SDHA	F: CTCTTTTGGACCTTGTCGTCTTT R: TCTCCAGCATTGCCTTAATCGG	NM_130428	102 bp	60	104.7
PPIA	F: CCAAACACAAATGGTT R: ATTCCTGGACCCAAAACGCT	NM 017101	135 bp	60	99
GAPDH	F: CTACCCACGGCAAGTTCAAC R: CCAGTAGACTCCACGACATAC	NM_01708	98 bp	60	98.4
YWHAG	F: TTCCTAAAGCCCTTCAAGGCA R: GGCTTTCTGCACTAGTTGCTCG	NM_019376.2	100 bp	60	95.3
POLR2a	F: CGTATCCGCATCATGAACATGA R: TCATCCATCTTATCCACCATCTT	XM_343922	70 bp	60	105
CNP	F: GGAGCCAATCTCAAGGGA R: TGCCGCCTTTGTATTTGC	NM_053750	201 bp	60	101
NPR-B	F: CCCATCCTGTGATAAAACTCC R: AAGCTGGAAACACCAAACA	NM_053838	89 bp	60	104
NPR-C	F: GGACCGCGAAGCCTGATGAGA R: ATGGACACCTGCCCGGCTACCT	NM_012868	240 bp	64	100.3
VEGF-A	F: CAGATGTGACAAGCCAAG R: CGGTGAGAGGTCTAGTTC	NM_031836.3	124 bp	58	102

Table legend: ACTB: Beta Actin; HPRT1: Hypoxanthine Phosphoribosyltransferase 1; RPL13a: Ribosomal Protein L13a; SDHA: Succinate Dehydrogenase Complex Flavoprotein Subunit A; PPIA: Peptidylprolyl Isomerase A; GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase; YWHAG: Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Gamma; POLR2a: RNA Polymerase II Subunit A; CNP: C-type natriuretic peptide; NPR-B/NPR-C: Natriuretic Peptide Receptor B/C; VEGF-A: vascular endothelial growth factor.

). Whenever possible, the primers were designed at the confluence of two exons to prevent the amplification of genomic DNA. The primers for housekeeping and target genes were synthesized by Sigma Aldrich (Milan, Italy) or QIAGEN (Milan, Italy).

2.7. Statistical Analysis

To provide greater transparency of our results between research laboratories, this study was carried out to conform to the Minimum Information for Publication of Quantitative Real-Time PCR Experiments [30]. Several reference genes were tested, and the combination of GeNorm technology and CFX Manager Software 3.1.1621 (CFX-96 Real-Time PCR detection systems, Bio-Rad Laboratories Inc., Hercules, CA, USA) was used to define the most stably expressed gene set. The algorithm permits the calculation of the normalization factor (M value), and genes are ranked for their M value in a step-wise manner. This analysis is carried out using proven solutions for normalization analysis, data quality control, including the elimination of erroneous data, normalization for removing sample-specific non-biologic variation, and inter-run calibration, which can remove the technical variation between samples analyzed in different runs.

Relative quantification of each target gene studied was calculated by the ΔΔCt method with dedicated software (CFX Manager Software Bio-Rad). When expression values were not normally distributed, the logarithmic transformation of data was used for statistical analysis.

Differences between the four independent groups were analyzed by Fisher’s test after ANOVA [Fisher’s least significant difference (LSD)]. The results are expressed as mean ± SEM, and the p-value was considered significant when <0.05. The association between different variables was assessed by linear regression and described with the Pearson coefficient.

All data were analyzed by using Statview 5.0.1 software released for Windows Statistical (SAS Institute, Inc., Cary, NC, USA).

3. Results

3.1. Patch Morphological Analysis After In Vitro Degradation

Figure 1c presents a scanning electron microscopy (SEM) image of the PLGA/Gelatin/Fmoc-FF patch after 30 days of in vitro degradation, acquired at 1000× magnification. The image reveals a porous microstructure with a heterogeneous distribution of cavities and interconnected voids. The surface shows partial degradation, with evident erosion of the polymer matrix.

Quantitative image analysis determined a mean pore diameter of 20.64 ± 5.58 μm. The observed pores exhibit various morphologies, including rounded and elongated shapes, that remain structurally distinct despite prolonged exposure to the degradation medium.

3.2. Histological Results and Immunofluorescence Analyses

After sham surgery, histological analysis revealed that implantation of the functionalized patch per se did not cause any damage to the myocardium.

As reported in our previous study [15], histological analysis performed four weeks post-surgery revealed that A-13p treatment reduced left ventricular wall thinning in infarcted animals compared to untreated infarcted rats, indicating improved structural preservation of the myocardium.

The cardiac patch remained in contact with the epicardium for four weeks and interacted with the tissue regardless of whether the heart was infarcted or not. Upon examination, it was found that the area between the patch and myocardium was filled with a loose extracellular matrix (Figure 2a).

The pericardium incorporated the patch into a continuum, while the patch itself was populated with neovessels and other cellular elements. The detection of red blood cells in some of these vessels confirmed their connection to the myocardial vasculature (Figure 2b).

In addition, the epicardially implanted patch enhanced vessel neoformation in the infarcted myocardium (Figure 2c). This improved tissue organization was also associated with a qualitative reduction in fibrotic deposition in patch-treated hearts, as assessed by Mallory’s trichrome staining.

Fluorescent image analysis of α-SMA confirmed the formation of newly developed small blood vessels within the implanted patch, exhibiting a mean diameter of 13.18 ± 5.66 µm (Figure 3a).

As previously reported, this neovascularization occurred inside the patch, regardless of the presence or absence of myocardial infarction14. In addition, the number of small blood vessels increased in the cardiac tissue under the implanted patch compared to infarction alone14. In the Infarct + A-13p group, the blood vessels had a mean diameter of 18.9 ± 6.5 µm (Figure 3b).

3.3. Real-Time PCR

3.3.1. Methodological Results

Condition Assessment and Selection of Reference Gene Set for Real-Time PCR Analysis

Optimal annealing temperature, obtained by a gradient PCR, and RNA concentration were assessed for each designed PCR primer to optimize each reference and target gene’s thermocycler profile.

Dilution series were run for all candidate reference/target genes to quantify Real-Time PCR efficiency that resulted in the range of 95–105% and a linear standard curve, R2, greater than |0.990|.

The expression of the reference genes studied was detected in the BZ, IZ, and RZ of all animals studied. The threshold cycle range resulted in differences among genes tested in a tissue and zone-specific manner (Figure 4a). Using the GeNorm technology and CFX Manager Software 3.1.1621 (CFX-96 Real-Time PCR detection systems, Bio-Rad Laboratories Inc., Hercules, CA, USA), which provided the gene expression stability measure (M) for each reference gene, they were ranked from the least stable (higher M value) to the most stably expressed (lowest M value). The reference genes with greater stability were selected. Although we analyzed eight reference genes for the M value evaluation, the stability was reached only with two genes (PPIA and POLR2a) (Figure 4b) since the addition of a third gene created a destabilization of our system. When the system was analyzed with a specific software, such as NormFinder, to validate the robustness of the genes used for the normalization strategy, the selected reference genes were not co-regulated despite the higher M value, thus confirming that the optimal setting resulted in being composed of these two housekeeping genes. For this issue, the normalization of the results was carried out with PPIA and POLR2a.

3.3.2. Gene Expression Analysis

Evaluating the cardiac tissue harvested by BZ, IZ, and RZ of each animal as a whole, we obtained the results reported in Figure 5 and Figure 6. CNP mRNA expression (Figure 5a) was higher, even though not significantly, in the Infarct group compared to the Sham group, while NPR-B (Figure 5b) and NPR-C (Figure 5c) mRNA expression were similar in all different groups. Analyzing the samples considering the BZ + IZ as a whole and RZ separately (Figure 6a–c), we observed a significantly higher CNP mRNA expression in BZ + IZ of the Infarct group in comparison to the Sham group. At the same time, the RZ showed CNP mRNA levels similar to the Sham group (Figure 6a). CNP mRNA expression increased in sham and infarcted animals with A-13p with respect to the Sham and Infarct groups, respectively (Figure 6a). Significantly higher levels of NPR-B mRNA expression were observed between BZ + IZ and RZ in the Infarct group, both in the absence and presence of patches (Figure 6b). In contrast, lower levels of NPR-C transcripts were observed in the same samples, although not significantly (Figure 6c).

Assessing BZ, IZ, and RZ of each animal as a whole, we did not find any significant differences in VEGF-A mRNA expression between the four groups except for Sham + A-13p vs. Infarct + A-13p (Figure 7a), as well as considering the BZ + IZ as a whole and RZ separately (Figure 7b). No consistent VEGF upregulation was observed, despite enhanced angiogenesis. The presence of the patch in BZ + IZ seems to reduce its levels.

No correlations were found between the biomarkers.

4. Discussion

The study demonstrates the involvement of the CNP system during MI.

As previously reported in our study [28], CNP was overexpressed in the border and infarct zones. In contrast, its expression in the non-infarcted remote zone was not increased and remained comparable to that of normal healthy myocardium from sham-operated animals. The observed trend of increased CNP mRNA expression following implantation of the Apelin-13–functionalized patch should be interpreted as being associated with treatment with the patch as an integrated system, rather than exclusively with Apelin-13 release.

This finding supports a potential role of apelin in vascular remodeling and angiogenesis regulation during myocardial healing, and suggests that CNP may represent a relevant mediator during MI, given its possible therapeutic implications.

Importantly, the patch used in this study is not a passive support, but a multifunctional, bioartificial device specifically engineered to interact with the injured myocardial environment at multiple levels. The Apelin-13–functionalized patch integrates (i) mechanical support through biomimetic microstructured PLGA/Gelatin membranes, (ii) bioelectrical signaling via a central Fmoc-FF hydrogel layer that restores electromechanical coupling, and (iii) controlled biochemical stimulation, delivering Apelin-13 both directly and through PHB nanoparticles for sustained release. Moreover, the patch’s surface is functionalized with molecularly imprinted nanoparticles (MIPs) selective for MMP-9, a strategy aimed at counteracting maladaptive ECM degradation post-MI. In vivo, this patch has shown excellent biocompatibility, recruitment of progenitor cells, reduction in fibrosis, and preservation of myocardial architecture in a rat ischemia/reperfusion model [14]. Therefore, the biological effects observed in the present study likely arise from the combined mechanical, bioelectrical, and biochemical contributions of the patch. Together, these properties may contribute to the modulation of CNP expression and angiogenic processes observed in the present study, supporting the concept of A-13p as an active modulator of myocardial repair rather than a simple scaffold. The implantation of this Apelin-13-releasing patch on the murine epicardium contributes to new small blood vessel formation not only within the patch but also in the cardiac tissue beyond it. Notably, the neovascularization is consistent with the enhancement of CNP expression, being well-known for its role in vascular remodeling and angiogenesis regulation [31]. CNP plays a fundamental role in regulating vascular function, local blood flow, systemic blood pressure, and the reactivity of circulating leukocytes and platelets [32,33,34]. Previous works have also suggested that this peptide contributes to maintaining blood vessel integrity and response to injury [28,35,36,37]. Regarding endothelial and vascular smooth muscle cell hyperplasia, both cognate receptors, NPR-B and NPR-C, appear to be implicated [38]. However, the signaling pathway (s) underpinning these vasoprotective functions of CNP remain unresolved. The increase in CNP expression observed in this study may reflect an anti-fibrotic response to treatment [39,40] and the involvement of its specific receptors. In our study, we did not find any significant differences in VEGF-A mRNA expression between the four groups, except for Sham + A-13p vs. Infarct + A-13p. The presence of the patch in BZ + IZ seems to reduce its levels.

VEGF-A is a highly specific vascular endothelial growth factor that can promote vascular permeability and endothelial cell migration, proliferation, and angiogenesis.

It is also known that VEGF-A expression is low in physiological conditions, but its release can rise after MI due to inflammation and mechanical tension [22,23], thus suggesting the stimulation of angiogenesis via the activation of VEGF-A/VEGFR2 signaling after apelin treatment [11,25].

Histological results emphasize the significant role of Apelin-13. The functionalized patch was capable of recruiting cells and promoting neovascularization, both within the scaffold and at the interface with the myocardial surface.

This improved tissue organization was also associated with a qualitative reduction in fibrotic deposition in patch-treated hearts, as assessed by Mallory’s trichrome staining.

The porous architecture observed in vitro after 30 days of degradation supports these findings, revealing the patch’s ability to maintain a morphology conducive to vascularization and cellular infiltration. SEM analysis showed that the average pore diameter (20.64 ± 5.58 μm) falls within a range considered optimal for capillary ingrowth and tissue colonization. These results are consistent with those previously reported by Cristallini et al., 2025 [15], where the cardiac patches explanted from infarcted myocardium exhibited elongated pores (2–7 μm in width and 10–20 μm in length) integrated within the extracellular matrix. The persistence of these pores highlights the structural stability of the PLGA/gelatin/Fmoc-FF composite and underlines its design rationale: combining mechanical integrity with a biomimetic degradable matrix favorable to regenerative processes.

Further reinforcing this relevance, in vivo α-SMA immunostaining of the Infarct + A-13p group revealed neovessels with a mean diameter of 13.18 ± 5.66 µm, strikingly close to the average pore size observed in vitro. This dimensional compatibility suggests that the porous structure of the patch may support neovessel development in infarcted tissue, not only by releasing pro-angiogenic signals such as Apelin-13 but also by providing spatial cues and a permissive matrix architecture for vascular invasion and organization.

Another noteworthy observation is that CNP mRNA expression increased both in infarcted and in sham animals with Apelin-13 functionalized patches. In sham animals, this increase is more likely to represent a physiological biological response to epicardial interaction with the patch rather than pathological remodeling. While this transcriptional response may be influenced by apelin signaling, it cannot be excluded that it also reflects a generic myocardial response to the mechanical and bioelectrical presence of the scaffold itself. Therefore, we interpret this response cautiously, avoiding direct causal attribution. The reactivation of fetal genes leads to the production of phenotypically mature cardiomyocytes that can stimulate specific involved genes, such as CNP expression.

This finding aligns with a previous study, which hypothesized that BNP/CNP behavior during phenotype differentiation is likely due to differences in gene sequence, transcription rate, and differential mRNA stabilization [41]. Although the absence of a non-functionalized patch control group represents a limitation of the present study, our data support a significant involvement of apelin in vascular activity, remodeling, and angiogenesis, and suggest CNP as a potentially relevant mediator to monitor in MI, considering its therapeutic implications.

From a translational perspective, it is important to consider the clinical applicability of epicardial patches. While percutaneous coronary intervention (PCI) and thrombolysis remain the standard of care for acute myocardial infarction, the A-13p patch is intended for the subacute and chronic phases, where progressive remodeling and fibrosis can lead to heart failure despite successful reperfusion. Epicardial application of patches is already feasible and clinically validated in patients undergoing coronary artery bypass grafting (CABG), as demonstrated by the use of various FDA-approved scaffolds in surgical practice [42].

In this context, the A-13p patch could serve as an adjunct therapy to provide mechanical support, promote neovascularization, and modulate molecular signaling within the infarcted myocardium. Moreover, the patch’s biodegradable and foldable design opens the possibility of future minimally invasive delivery via thoracoscopic approaches, extending its potential use to patients who do not require open-chest surgery. These considerations reinforce the translational relevance of the present findings, highlighting the patch not only as a preclinical tool for studying CNP-mediated myocardial repair but also as a candidate for future clinical interventions targeting adverse post-infarct remodeling.

5. Conclusions

Despite the relatively small sample size per group and the exclusive assessment of mRNA expression without protein-level validation (e.g., CNP or VEGF-A), this study explores the role of CNP signaling in myocardial infarction and its modulation through bioengineered cardiac therapy. This study explores the role of CNP signaling in myocardial infarction and its modulation through bioengineered cardiac therapy. The Apelin-13-functionalized patch applied to infarcted rat hearts enhanced vascular response and tissue remodeling, supporting reparative processes through increased cellular recruitment, neovascularization, and reduced fibrosis. The patch’s design, combining biomimetic structure, electroconductive elements, and localized bioactive molecule delivery, appears to influence CNP expression and post-infarction healing. While some responses were observed in sham animals, the findings support the apelin–CNP axis as a key mediator in cardiac regeneration. These results highlight CNP as a promising marker for future studies and confirm the potential of Apelin-13-functionalized patches in myocardial repair, warranting further investigation in larger preclinical models.