Sexually Dimorphic Effects of CYP2B6 in the Development of Fasting-Mediated Steatosis in Mice: Role of the Oxylipin Products 9-HODE and 9-HOTrE
Abstract
1. Introduction
2. Materials and Methods
2.1. Care and Genotyping of Cyp2b-Null and hCYP2B6-Tg Mice
2.2. Treatment of Cyp2b-Null Mice with 9-HODE or 9-HOTrE
2.3. Fasting of Cyp2b-Null and hCYP2B6-Tg Mice
2.4. Necropsy
2.5. Serum Lipid Markers
2.6. Liver Lipids and Lipidomics
2.7. RNA Sequencing (RNAseq)
2.8. Quantitative PCR
2.9. Hierarchical Clustering
2.10. Statistical Analysis and Graph Preparation
3. Results and Discussion
3.1. 9-HODE and 9-HOTrE Increase Serum Lipids with Greater Effects in Females than Males
3.2. Oxylipins Did Not Perturb Liver TGs
3.3. Gene Expression Differences with Oxylipin Treatment
3.4. Changes in Gross Anatomy and Serum Lipids Between hCYP2B6-Tg and Cyp2b-Null Mice Are Sexually Dimorphic
3.5. Liver TG Difference Between hCYP2B6-Tg and Cyp2b-Null Mice
3.6. Gene Expression Differences Between hCYP2B6-Tg and Cyp2b-Null Mice
3.7. Gene Expression Changes Evaluated via qPCR
3.8. GO Term and KEGG Pathway Analysis of Cyp2b-Null vs. Hcyp2b6-Tg DEG
3.9. Oxylipin Profile Changes Between hCYP2B6-Tg and Cyp2b-Null Mice
3.10. Hierarchical Clustering of DEG with Oxylipins
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization: Obesity and Overweight. Available online: https://www.who.int/news-room/fact-sheets/detail/obesity-and-overweight (accessed on 1 March 2024).
- Vanni, E.; Bugianesi, E.; Kotronen, A.; De Minicis, S.; Yki-Järvinen, H.; Svegliati-Baroni, G. From the metabolic syndrome to NAFLD or vice versa? Dig. Liver Dis. 2010, 42, 320–330. [Google Scholar] [CrossRef] [PubMed]
- Saltiel, A.R.; Olefsky, J.M. Inflammatory mechanisms linking obesity and metabolic disease. J. Clin. Investig. 2017, 127, 1–4. [Google Scholar] [CrossRef]
- Huggett, Z.J.; Smith, A.; De Vivo, N.; Gomez, D.; Jethwa, P.; Brameld, J.M.; Bennett, A.; Salter, A.M. A Comparison of Primary Human Hepatocytes and Hepatoma Cell Lines to Model the Effects of Fatty Acids, Fructose and Glucose on Liver Cell Lipid Accumulation. Nutrients 2022, 15, 40. [Google Scholar] [CrossRef] [PubMed]
- Merrell, M.D.; Cherrington, N.J. Drug metabolism alterations in nonalcoholic fatty liver disease. Drug Metab. Rev. 2011, 43, 317–334. [Google Scholar] [CrossRef] [PubMed]
- Heintz, M.M.; McRee, R.; Kumar, R.; Baldwin, W.S. Gender differences in diet-induced steatotic disease in Cyp2b-null mice. PLoS ONE 2020, 15, e0229896. [Google Scholar] [CrossRef]
- Heintz, M.M.; Eccles, J.A.; Olack, E.M.; Maner-Smith, K.M.; Ortlund, E.A.; Baldwin, W.S. Human CYP2B6 produces oxylipins from polyunsaturated fatty acids and reduces diet-induced obesity. PLoS ONE 2022, 17, e0277053. [Google Scholar] [CrossRef]
- Krogstad, V.; Peric, A.; Robertsen, I.; Kringen, M.K.; Wegler, C.; Angeles, P.C.; Hjelmesæth, J.; Karlsson, C.; Andersson, S.; Artursson, P.; et al. A Comparative Analysis of Cytochrome P450 Activities in Paired Liver and Small Intestinal Samples from Patients with Obesity. Drug Metab. Dispos. 2020, 48, 8–17. [Google Scholar] [CrossRef]
- Mo, S.L.; Liu, Y.H.; Duan, W.; Wei, M.Q.; Kanwar, J.R.; Zhou, S.F. Substrate specificity, regulation, and polymorphism of human cytochrome P450 2B6. Curr. Drug Metab. 2009, 10, 730–753. [Google Scholar] [CrossRef]
- Olack, E.M.; Heintz, M.M.; Baldwin, W.S. Dataset of endo- and xenobiotic inhibition of CYP2B6: Comparison to CYP3A4. Data Brief 2022, 41, 108013. [Google Scholar] [CrossRef]
- Li, J.; Lai, H.; Chen, S.; Zhu, H.; Lai, S. Interaction of sex steroid hormones and obesity on insulin resistance and type 2 diabetes in men: The Third National Health and Nutrition Examination Survey. J. Diabetes Complicat. 2017, 31, 318–327. [Google Scholar] [CrossRef]
- Wabitsch, M.; Hauner, H.; Heinze, E.; Böckmann, A.; Benz, R.; Mayer, H.; Teller, W. Body fat distribution and steroid hormone concentrations in obese adolescent girls before and after weight reduction. J. Clin. Endocrinol. Metab. 1995, 80, 3469–3475. [Google Scholar] [PubMed]
- Kim, J.; Li, Y.; Watkins, B.A. Fat to treat fat: Emerging relationship between dietary PUFA, endocannabinoids, and obesity. Prostaglandins Other Lipid Mediat. 2013, 104–105, 32–41. [Google Scholar] [CrossRef] [PubMed]
- Eccles, J.A.; Baldwin, W.S. Detoxification Cytochrome P450s (CYPs) in Families 1-3 Produce Functional Oxylipins from Polyunsaturated Fatty Acids. Cells 2022, 12, 82. [Google Scholar] [CrossRef] [PubMed]
- Damiri, B.; Baldwin, W.S. Cyp2b-Knockdown Mice Poorly Metabolize Corn Oil and Are Age-Dependent Obese. Lipids 2018, 53, 871–884. [Google Scholar] [CrossRef]
- Finn, R.D.; Henderson, C.J.; Scott, C.L.; Wolf, C.R. Unsaturated fatty acid regulation of cytochrome P450 expression via a CAR-dependent pathway. Biochem. J. 2009, 417, 43–54. [Google Scholar] [CrossRef]
- Williams, L.A.; Hamilton, M.C.; Edin, M.L.; Lih, F.B.; Eccles-Miller, J.A.; Tharayil, N.; Leonard, E.; Baldwin, W.S. Increased Perfluorooctanesulfonate (PFOS) Toxicity and Accumulation Is Associated with Perturbed Prostaglandin Metabolism and Increased Organic Anion Transport Protein (OATP) Expression. Toxics 2024, 12, 106. [Google Scholar] [CrossRef]
- Wedel, S.; Osthues, T.; Zimmer, B.; Angioni, C.; Geisslinger, G.; Sisignano, M. Oxidized linoleic acid metabolites maintain mechanical and thermal hypersensitivity during sub-chronic inflammatory pain. Biochem. Pharmacol. 2022, 198, 114953. [Google Scholar] [CrossRef]
- Evans, W.A.; Eccles-Miller, J.A.; Anderson, E.; Farrell, H.; Baldwin, W.S. 9-HODE and 9-HOTrE alter mitochondrial metabolism, increase triglycerides, and perturb fatty acid uptake and synthesis associated gene expression in HepG2 cells. Prostaglandins Leukot. Essent. Fat. Acids 2024, 202, 102635. [Google Scholar] [CrossRef]
- Zahradka, P.; Neumann, S.; Aukema, H.M.; Taylor, C.G. Adipocyte lipid storage and adipokine production are modulated by lipoxygenase-derived oxylipins generated from 18-carbon fatty acids. Int. J. Biochem. Cell Biol. 2017, 88, 23–30. [Google Scholar] [CrossRef]
- Vangaveti, V.; Shashidhar, V.; Collier, F.; Hodge, J.; Rush, C.; Malabu, U.; Baune, B.; Kennedy, R.L. 9- and 13-HODE regulate fatty acid binding protein-4 in human macrophages, but does not involve HODE/GPR132 axis in PPAR-γ regulation of FABP4. Ther. Adv. Endocrinol. Metab. 2018, 9, 137–150. [Google Scholar] [CrossRef]
- Donepudi, A.C.; Boehme, S.; Li, F.; Chiang, J.Y. G-protein-coupled bile acid receptor plays a key role in bile acid metabolism and fasting-induced hepatic steatosis in mice. Hepatology 2017, 65, 813–827. [Google Scholar] [CrossRef] [PubMed]
- Guan, H.P.; Goldstein, J.L.; Brown, M.S.; Liang, G. Accelerated fatty acid oxidation in muscle averts fasting-induced hepatic steatosis in SJL/J mice. J. Biol. Chem. 2009, 284, 24644–24652. [Google Scholar] [CrossRef] [PubMed]
- Heijboer, A.C.; Donga, E.; Voshol, P.J.; Dang, Z.-C.; Havekes, L.M.; Romijn, J.A.; Corssmit, E.P.M. Sixteen hours of fasting differentially affects hepatic and muscle insulin sensitivity in mice. J. Lipid Res. 2005, 46, 582–588. [Google Scholar] [CrossRef] [PubMed]
- Heintz, M.M.; Kumar, R.; Rutledge, M.M.; Baldwin, W.S. Cyp2b-null male mice are susceptible to diet-induced obesity and perturbations in lipid homeostasis. J. Nutr. Biochem. 2019, 70, 125–137. [Google Scholar] [CrossRef]
- Hamilton, M.C.; Heintz, M.M.; Pfohl, M.; Marques, E.; Ford, L.; Slitt, A.L.; Baldwin, W.S. Increased toxicity and retention of perflourooctane sulfonate (PFOS) in humanized CYP2B6-Transgenic mice compared to Cyp2b-null mice is relieved by a high-fat diet (HFD). Food Chem. Toxicol. 2021, 152, 112175. [Google Scholar] [CrossRef]
- Wei, Y.; Wu, H.; Li, L.; Liu, Z.; Zhou, X.; Zhang, Q.Y.; Weng, Y.; D’Agostino, J.; Ling, G.; Zhang, X.; et al. Generation and characterization of a CYP2A13/2B6/2F1-transgenic mouse model. Drug Metab. Dispos. 2012, 40, 1144–1150. [Google Scholar] [CrossRef]
- Ramírez-Zacarías, J.L.; Castro-Muñozledo, F.; Kuri-Harcuch, W. Quantitation of adipose conversion and triglycerides by staining intracytoplasmic lipids with oil red O. Histochemistry 1992, 97, 493–497. [Google Scholar] [CrossRef]
- Naudin, C.R.; Maner-Smith, K.; Owens, J.A.; Wynn, G.M.; Robinson, B.S.; Matthews, J.D.; Reedy, A.R.; Luo, L.; Wolfarth, A.A.; Darby, T.M.; et al. Lactococcus lactis Subspecies cremoris Elicits Protection Against Metabolic Changes Induced by a Western-Style Diet. Gastroenterology 2020, 159, 639–651.e635. [Google Scholar] [CrossRef]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef]
- Sherman, B.T.; Hao, M.; Qiu, J.; Jiao, X.; Baseler, M.W.; Lane, H.C.; Imamichi, T.; Chang, W. DAVID: A web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res. 2022, 50, W216–W221. [Google Scholar] [CrossRef]
- Supek, F.; Bošnjak, M.; Škunca, N.; Šmuc, T. REVIGO summarizes and visualizes long lists of gene ontology terms. PLoS ONE 2011, 6, e21800. [Google Scholar] [CrossRef] [PubMed]
- Roling, J.A.; Bain, L.J.; Baldwin, W.S. Differential gene expression in mummichogs (Fundulus heteroclitus) following treatment with pyrene: Comparison to a creosote contaminated site. Mar. Environ. Res. 2004, 57, 377–395. [Google Scholar] [CrossRef] [PubMed]
- Muller, P.Y.; Janovjak, H.; Miserez, A.R.; Dobbie, Z. Processing of gene expression data generated by quantitative real-time RT-PCR. Biotechniques 2002, 33, 514. [Google Scholar]
- Singh, A.K.; Chaube, B.; Zhang, X.; Sun, J.; Citrin, K.M.; Canfrán-Duque, A.; Aryal, B.; Rotllan, N.; Varela, L.; Lee, R.G.; et al. Hepatocyte-specific suppression of ANGPTL4 improves obesity-associated diabetes and mitigates atherosclerosis in mice. J. Clin. Investig. 2021, 131, e140989. [Google Scholar] [CrossRef]
- Senates, E.; Yilmaz, Y.; Colak, Y.; Ozturk, O.; Altunoz, M.E.; Kurt, R.; Ozkara, S.; Aksaray, S.; Tuncer, I.; Ovunc, A.O. Serum levels of hepcidin in patients with biopsy-proven nonalcoholic fatty liver disease. Metab. Syndr. Relat. Disord. 2011, 9, 287–290. [Google Scholar] [CrossRef]
- Wu, Z.; Wang, S. Role of kruppel-like transcription factors in adipogenesis. Dev. Biol. 2013, 373, 235–243. [Google Scholar] [CrossRef]
- Zelows, M.M.; Cady, C.; Dharanipragada, N.; Mead, A.E.; Kipp, Z.A.; Bates, E.A.; Varadharajan, V.; Banerjee, R.; Park, S.H.; Shelman, N.R.; et al. Loss of carnitine palmitoyltransferase 1a reduces docosahexaenoic acid-containing phospholipids and drives sexually dimorphic liver disease in mice. Mol. Metab. 2023, 78, 101815. [Google Scholar] [CrossRef]
- Su, Z.; Korstanje, R.; Tsaih, S.W.; Paigen, B. Candidate genes for obesity revealed from a C57BL/6J x 129S1/SvImJ intercross. Int J. Obes. 2008, 32, 1180–1189. [Google Scholar] [CrossRef][Green Version]
- Cai, Q.; Zhu, M.; Duan, J.; Wang, H.; Chen, J.; Xiao, Y.; Wang, Y.; Wang, J.; Yu, X.; Yang, H. Comprehensive Analysis of Immune-Related Prognosis of TK1 in Hepatocellular Carcinoma. Front. Oncol. 2021, 11, 786873. [Google Scholar] [CrossRef]
- Hoshi, M.; Osawa, Y.; Nakamoto, K.; Morita, N.; Yamamoto, Y.; Ando, T.; Tashita, C.; Nabeshima, T.; Saito, K. Kynurenine produced by indoleamine 2,3-dioxygenase 2 exacerbates acute liver injury by carbon tetrachloride in mice. Toxicology 2020, 438, 152458. [Google Scholar] [CrossRef]
- Zhou, Z.; Qian, J.; Kini, A.; Riederer, B.; Römermann, D.; Gros, G.; Seidler, U. Loss of luminal carbonic anhydrase XIV results in decreased biliary bicarbonate output, liver fibrosis, and cholangiocyte proliferation in mice. Pflug. Arch. 2022, 474, 529–539. [Google Scholar] [CrossRef] [PubMed]
- Meghadri, S.H.; Martinez-Delgado, B.; Ostermann, L.; Gomez-Mariano, G.; Perez-Luz, S.; Tumpara, S.; Wrenger, S.; DeLuca, D.S.; Maus, U.A.; Welte, T.; et al. Loss of Serpina1 in Mice Leads to Altered Gene Expression in Inflammatory and Metabolic Pathways. Int. J. Mol. Sci. 2022, 23, 10425. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.J.; Kim, S.; Choi, Y.; Nielsen, T.B.; Yan, J.; Lu, A.; Ruan, J.; Lee, H.-R.; Wu, H.; Spellberg, B.; et al. SERPINB1-mediated checkpoint of inflammatory caspase activation. Nat. Immunol. 2019, 20, 276–287. [Google Scholar] [CrossRef] [PubMed]
- Demir, S.; Wolff, G.; Wieder, A.; Maida, A.; Bühler, L.; Brune, M.; Hautzinger, O.; Feuchtinger, A.; Poth, T.; Szendroedi, J.; et al. TSC22D4 interacts with Akt1 to regulate glucose metabolism. Sci. Adv. 2022, 8, eabo5555. [Google Scholar] [CrossRef]
- Li, R.H.; Churchill, G.A. Epistasis contributes to the genetic buffering of plasma HDL cholesterol in mice. Physiol. Genom. 2010, 42a, 228–234. [Google Scholar] [CrossRef]
- López-Soldado, I.; Torres, A.G.; Ventura, R.; Martínez-Ruiz, I.; Díaz-Ramos, A.; Planet, E.; Cooper, D.; Pazderska, A.; Wanic, K.; O’Hanlon, D.; et al. Decreased expression of mitochondrial aminoacyl-tRNA synthetases causes downregulation of OXPHOS subunits in type 2 diabetic muscle. Redox Biol. 2023, 61, 102630. [Google Scholar] [CrossRef]
- Nikolaou, N.; Gathercole, L.L.; Marchand, L.; Althari, S.; Dempster, N.J.; Green, C.J.; van de Bunt, M.; McNeil, C.; Arvaniti, A.; Hughes, B.A.; et al. AKR1D1 is a novel regulator of metabolic phenotype in human hepatocytes and is dysregulated in non-alcoholic fatty liver disease. Metabolism 2019, 99, 67–80. [Google Scholar] [CrossRef]
- Ning, M.; Jeong, H. High-Fat Diet Feeding Alters Expression of Hepatic Drug-Metabolizing Enzymes in Mice. Drug Metab. Dispos. 2017, 45, 707–711. [Google Scholar] [CrossRef]
- Ahmed, S.; Bott, D.; Gomez, A.; Tamblyn, L.; Rasheed, A.; Cho, T.; MacPherson, L.; Sugamori, K.S.; Yang, Y.; Grant, D.M.; et al. Loss of the Mono-ADP-ribosyltransferase, Tiparp, Increases Sensitivity to Dioxin-induced Steatohepatitis and Lethality. J. Biol. Chem. 2015, 290, 16824–16840. [Google Scholar] [CrossRef]
- Sánchez-Mendoza, L.M.; Pérez-Sánchez, C.; García-Caballero, C.; Pérez-Rodríguez, M.; Calero-Rodríguez, P.; Vellón-García, B.; Moreno, J.A.; Burón, M.I.; de Cabo, R.; González-Reyes, J.A.; et al. CYB5R3 overexpression exhibits sexual dimorphism: Mitochondrial and metabolic adaptations in transgenic female mice during calorie restriction. Free Radic. Biol. Med. 2024, 223, 69–86. [Google Scholar] [CrossRef]
- Rodríguez-López, S.; López-Bellón, S.; González-Reyes, J.A.; Burón, M.I.; de Cabo, R.; Villalba, J.M. Mitochondrial adaptations in liver and skeletal muscle to pro-longevity nutritional and genetic interventions: The crosstalk between calorie restriction and CYB5R3 overexpression in transgenic mice. Geroscience 2020, 42, 977–994. [Google Scholar] [CrossRef] [PubMed]
- Jeyakumar, S.M.; Vajreswari, A. Stearoyl-CoA desaturase 1: A potential target for non-alcoholic fatty liver disease?-perspective on emerging experimental evidence. World J. Hepatol. 2022, 14, 168–179. [Google Scholar] [CrossRef] [PubMed]
- Kazierad, D.J.; Chidsey, K.; Somayaji, V.R.; Bergman, A.J.; Birnbaum, M.J.; Calle, R.A. Inhibition of ketohexokinase in adults with NAFLD reduces liver fat and inflammatory markers: A randomized phase 2 trial. Med 2021, 2, 800–813.e803. [Google Scholar] [CrossRef]
- Boughanem, H.; Yubero-Serrano, E.M.; López-Miranda, J.; Tinahones, F.J.; Macias-Gonzalez, M. Potential Role of Insulin Growth-Factor-Binding Protein 2 as Therapeutic Target for Obesity-Related Insulin Resistance. Int. J. Mol. Sci. 2021, 22, 1133. [Google Scholar] [CrossRef] [PubMed]
- Ruchti, E.; Roach, P.J.; DePaoli-Roach, A.A.; Magistretti, P.J.; Allaman, I. Protein targeting to glycogen is a master regulator of glycogen synthesis in astrocytes. IBRO Rep. 2016, 1, 46–53. [Google Scholar] [CrossRef]
- Reue, K. The role of lipin 1 in adipogenesis and lipid metabolism. Novartis Found. Symp. 2007, 286, 58–68; discussion 68–71, 162–163, 196–203. [Google Scholar]
- Chatterjee, C.; Sparks, D.L. Hepatic lipase, high density lipoproteins, and hypertriglyceridemia. Am. J. Pathol. 2011, 178, 1429–1433. [Google Scholar] [CrossRef]
- Mori, H.; Peterson, S.K.; Simmermon, R.C.; Overmyer, K.A.; Nishii, A.; Paulsson, E.; Li, Z.; Jen, A.; Uranga, R.M.; Maung, J.N.; et al. Scd1 and monounsaturated lipids are required for autophagy and survival of adipocytes. Mol. Metab. 2024, 83, 101916. [Google Scholar] [CrossRef]
- Sztalryd, C.; Brasaemle, D.L. The perilipin family of lipid droplet proteins: Gatekeepers of intracellular lipolysis. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2017, 1862, 1221–1232. [Google Scholar] [CrossRef]
- Soldo, B.; Šprung, M.; Mušac, G.; Pavela-Vrančić, M.; Ljubenkov, I. Evaluation of Olive Fruit Lipoxygenase Extraction Protocols on 9- and 13-Z,E-HPODE Formation. Molecules 2016, 21, 506. [Google Scholar] [CrossRef]
- Balvers, M.G.J.; Verhoeckx, K.C.M.; Plastina, P.; Wortelboer, H.M.; Meijerink, J.; Witkamp, R.F. Docosahexaenoic acid and eicosapentaenoic acid are converted by 3T3-L1 adipocytes to N-acyl ethanolamines with anti-inflammatory properties. Biochim. Biophys. Acta (BBA)—Mol. Cell Biol. Lipids 2010, 1801, 1107–1114. [Google Scholar] [CrossRef] [PubMed]
- Jones, P.J.; Lin, L.; Gillingham, L.G.; Yang, H.; Omar, J.M. Modulation of plasma N-acylethanolamine levels and physiological parameters by dietary fatty acid composition in humans. J. Lipid Res. 2014, 55, 2655–2664. [Google Scholar] [CrossRef] [PubMed]
- Wasilewski, M.; Więckowski, M.R.; Dymkowska, D.; Wojtczak, L. Effects of N-acylethanolamines on mitochondrial energetics and permeability transition. Biochim. Biophys. Acta (BBA)—Bioenerg. 2004, 1657, 151–163. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Everard, A.; Plovier, H.; Rastelli, M.; Van Hul, M.; de Wouters d’Oplinter, A.; Geurts, L.; Druart, C.; Robine, S.; Delzenne, N.M.; Muccioli, G.G.; et al. Intestinal epithelial N-acylphosphatidylethanolamine phospholipase D links dietary fat to metabolic adaptations in obesity and steatosis. Nat. Commun. 2019, 10, 457. [Google Scholar] [CrossRef]
- Mock, E.D.; Gagestein, B.; van der Stelt, M. Anandamide and other N-acylethanolamines: A class of signaling lipids with therapeutic opportunities. Progress Lipid Res. 2023, 89, 101194. [Google Scholar] [CrossRef]
- Tovar, R.; Gavito, A.L.; Vargas, A.; Soverchia, L.; Hernandez-Folgado, L.; Jagerovic, N.; Baixeras, E.; Ciccocioppo, R.; Rodríguez de Fonseca, F.; Decara, J. Palmitoleoylethanolamide Is an Efficient Anti-Obesity Endogenous Compound: Comparison with Oleylethanolamide in Diet-Induced Obesity. Nutrients 2021, 13, 2589. [Google Scholar] [CrossRef]
- Shao, Y.; Fu, Z.; Wang, Y.; Yang, Z.; Lin, Y.; Li, S.; Cheng, C.; Wei, M.; Liu, Z.; Xu, G.; et al. A metabolome atlas of mouse brain on the global metabolic signature dynamics following short-term fasting. Signal Transduct. Target. Ther. 2023, 8, 334. [Google Scholar] [CrossRef]
- Pashkov, V.; Huang, J.; Parameswara, V.K.; Kedzierski, W.; Kurrasch, D.M.; Tall, G.G.; Esser, V.; Gerard, R.D.; Uyeda, K.; Towle, H.C.; et al. Regulator of G protein signaling (RGS16) inhibits hepatic fatty acid oxidation in a carbohydrate response element-binding protein (ChREBP)-dependent manner. J. Biol. Chem. 2011, 286, 15116–15125. [Google Scholar] [CrossRef]
- Goetzman, E.S. Advances in the Understanding and Treatment of Mitochondrial Fatty Acid Oxidation Disorders. Curr. Genet. Med. Rep. 2017, 5, 132–142. [Google Scholar] [CrossRef]
- Jiang, P.; Ling, Y.; Zhu, T.; Luo, X.; Tao, Y.; Meng, F.; Cheng, W.; Ji, Y. Mitochondrial tRNA mutations in Chinese Children with Tic Disorders. Biosci. Rep. 2020, 40, BSR20201856. [Google Scholar] [CrossRef]
- Bracey, N.A.; Platnich, J.M.; Lau, A.; Chung, H.; Hyndman, M.E.; MacDonald, J.A.; Chun, J.; Beck, P.L.; Girardin, S.E.; Gordon, P.M.; et al. Tissue-selective alternate promoters guide NLRP6 expression. Life Sci. Alliance 2021, 4, e202000897. [Google Scholar] [CrossRef] [PubMed]
- Ghimire, L.; Paudel, S.; Jin, L.; Jeyaseelan, S. The NLRP6 inflammasome in health and disease. Mucosal Immunol. 2020, 13, 388–398. [Google Scholar] [CrossRef] [PubMed]
- Spano, D.; Cimmino, F.; Capasso, M.; D’Angelo, F.; Zambrano, N.; Terracciano, L.; Iolascon, A. Changes of the Hepatic Proteome in Hepatitis B-Infected Mouse Model at Early Stages of Fibrosis. J. Proteome Res. 2008, 7, 2642–2653. [Google Scholar] [CrossRef] [PubMed]
- Shi, Z.; Rockey, D.C. Upregulation of the actin cytoskeleton via myocardin leads to increased expression of type 1 collagen. Lab. Investig. 2017, 97, 1412–1426. [Google Scholar] [CrossRef]
- Monzón-Casanova, E.; Rudolf, R.; Starick, L.; Müller, I.; Söllner, C.; Müller, N.; Westphal, N.; Miyoshi-Akiyama, T.; Uchiyama, T.; Berberich, I.; et al. The Forgotten: Identification and Functional Characterization of MHC Class II Molecules H2-Eb2 and RT1-Db2. J. Immunol. 2016, 196, 988–999. [Google Scholar] [CrossRef]
- Logunova, N.; Kapina, M.; Kondratieva, E.; Apt, A. The H2-A Class II molecule α/β-chain cis-mismatch severely affects cell surface expression, selection of conventional CD4(+) T cells and protection against TB infection. Front. Immunol. 2023, 14, 1183614. [Google Scholar] [CrossRef]
- Liao, S.; He, H.; Zeng, Y.; Yang, L.; Liu, Z.; An, Z.; Zhang, M. A nomogram for predicting metabolic steatohepatitis: The combination of NAMPT, RALGDS, GADD45B, FOSL2, RTP3, and RASD1. Open Med. 2021, 16, 773–785. [Google Scholar] [CrossRef]
- Hilsabeck, T.A.U.; Liu-Bryan, R.; Guo, T.; Wilson, K.A.; Bose, N.; Raftery, D.; Beck, J.N.; Lang, S.; Jin, K.; Nelson, C.S.; et al. A fly GWAS for purine metabolites identifies human FAM214 homolog medusa, which acts in a conserved manner to enhance hyperuricemia-driven pathologies by modulating purine metabolism and the inflammatory response. Geroscience 2022, 44, 2195–2211. [Google Scholar] [CrossRef]
- Gehrke, N.; Hofmann, L.J.; Straub, B.K.; Rühle, F.; Waisman, A.; Galle, P.R.; Schattenberg, J.M. Hepatic interleukin-1 receptor type 1 signalling regulates insulin sensitivity in the early phases of nonalcoholic fatty liver disease. Clin. Transl. Med. 2022, 12, e1048. [Google Scholar] [CrossRef]
- Kovi, R.C.; Bhusari, S.; Mav, D.; Shah, R.R.; Ton, T.V.; Hoenerhoff, M.J.; Sills, R.C.; Pandiri, A.R. Genome-wide promoter DNA methylation profiling of hepatocellular carcinomas arising either spontaneously or due to chronic exposure to Ginkgo biloba extract (GBE) in B6C3F1/N mice. Arch. Toxicol. 2019, 93, 2219–2235. [Google Scholar] [CrossRef]
- Liu, H.; Pathak, P.; Boehme, S.; Chiang, J.L. Cholesterol 7α-hydroxylase protects the liver from inflammation and fibrosis by maintaining cholesterol homeostasis. J. Lipid Res. 2016, 57, 1831–1844. [Google Scholar] [CrossRef] [PubMed]
- Ke, C.; Xiao, C.; Li, J.; Wu, X.; Zhang, Y.; Chen, Y.; Sheng, S.; Fu, Z.; Wang, L.; Ni, C.; et al. FMO2 ameliorates nonalcoholic fatty liver disease by suppressing ER-to-Golgi transport of SREBP1. Hepatology 2025, 81, 181–197. [Google Scholar] [CrossRef] [PubMed]
- Qu, J.; Ko, C.W.; Tso, P.; Bhargava, A. Apolipoprotein A-IV: A Multifunctional Protein Involved in Protection against Atherosclerosis and Diabetes. Cells 2019, 8, 319. [Google Scholar] [CrossRef] [PubMed]
- Cheng, C.; Liu, X.H.; He, J.; Gao, J.; Zhou, J.T.; Fan, J.N.; Jin, X.; Zhang, J.; Chang, L.; Xiong, Z.; et al. Apolipoprotein A4 Restricts Diet-Induced Hepatic Steatosis via SREBF1-Mediated Lipogenesis and Enhances IRS-PI3K-Akt Signaling. Mol. Nutr. Food Res. 2022, 66, e2101034. [Google Scholar] [CrossRef] [PubMed]
- Xiang, L.; Jiao, Y.; Qian, Y.; Li, Y.; Mao, F.; Lu, Y. Comparison of hepatic gene expression profiles between three mouse models of Nonalcoholic Fatty Liver Disease. Genes Dis. 2022, 9, 201–215. [Google Scholar] [CrossRef]
- Meijer, I.A.; Sasarman, F.; Maftei, C.; Rossignol, E.; Vanasse, M.; Major, P.; Mitchell, G.A.; Brunel-Guitton, C. LPIN1 deficiency with severe recurrent rhabdomyolysis and persistent elevation of creatine kinase levels due to chromosome 2 maternal isodisomy. Mol. Genet. Metab. Rep. 2015, 5, 85–88. [Google Scholar] [CrossRef]
- Wang, P.; Kang, Q.; Wu, W.S.; Rui, L. Hepatic Snai1 and Snai2 promote liver regeneration and suppress liver fibrosis in mice. Cell Rep. 2024, 43, 113875. [Google Scholar] [CrossRef]
- Lin, X.; Liou, Y.H.; Li, Y.; Gong, L.; Li, Y.; Hao, Y.; Pham, B.; Xu, S.; Jiang, Z.; Li, L.; et al. FAM13A Represses AMPK Activity and Regulates Hepatic Glucose and Lipid Metabolism. iScience 2020, 23, 100928. [Google Scholar] [CrossRef]
- Yu, T.; Wang, L.; Cheng, Y.; Zhang, Y.; Zhu, J.; Zhang, G.; Hu, S. Downregulation of Setdb2 promotes alternative activation of macrophages via the PI3K/Akt pathway to attenuate NAFLD after sleeve gastrectomy. Biochem. Biophys. Res. Commun. 2024, 726, 150264. [Google Scholar] [CrossRef]
- Arvind, A.; Osganian, S.A.; Sjoquist, J.A.; Corey, K.E.; Simon, T.G. Epoxygenase-Derived Epoxyeicosatrienoic Acid Mediators Are Associated With Nonalcoholic Fatty Liver Disease, Nonalcoholic Steatohepatitis, and Fibrosis. Gastroenterology 2020, 159, 2232–2234.e2234. [Google Scholar] [CrossRef]
- Lamba, V.; Lamba, J.; Yasuda, K.; Strom, S.; Davila, J.; Hancock, M.L.; Fackenthal, J.D.; Rogan, P.K.; Ring, B.; Wrighton, S.A.; et al. Hepatic CYP2B6 expression: Gender and ethnic differences and relationship to CYP2B6 genotype and CAR (constitutive androstane receptor) expression. J. Pharmacol. Exp. Ther. 2003, 307, 906–922. [Google Scholar] [CrossRef]
- Wiwi, C.A.; Gupte, M.; Waxman, D.J. Sexually Dimorphic P450 Gene Expression in Liver-Specific Hepatocyte Nuclear Factor 4α-Deficient Mice. Mol. Endocrinol. 2004, 18, 1975–1987. [Google Scholar] [CrossRef] [PubMed]
- Baldwin, W.S.; Roling, J.A. A concentration addition model for the activation of the constitutive androstane receptor by xenobiotic mixtures. Toxicol. Sci. 2009, 107, 93–105. [Google Scholar] [CrossRef] [PubMed]
- Forman, B.M.; Tzameli, I.; Choi, H.-S.; Chen, J.; Simha, D.; Seol, W.; Evans, R.M.; Moore, D.D. Androstane metabolites bind to and deactivate the nuclear receptor CAR-β. Nature 1998, 395, 612–615. [Google Scholar] [CrossRef]
- Waxman, D.J.; Holloway, M.G. Sex Differences in the Expression of Hepatic Drug Metabolizing Enzymes. Mol. Pharmacol. 2009, 76, 215–228. [Google Scholar] [CrossRef]
- Astafev, A.A.; Patel, S.A.; Kondratov, R.V. Calorie restriction effects on circadian rhythms in gene expression are sex dependent. Sci. Rep. 2017, 7, 9716. [Google Scholar] [CrossRef]
- Csaki, L.S.; Dwyer, J.R.; Li, X.; Nguyen, M.H.K.; Dewald, J.; Brindley, D.N.; Lusis, A.J.; Yoshinaga, Y.; de Jong, P.; Fong, L.; et al. Lipin-1 and lipin-3 together determine adiposity in vivo. Mol. Metab. 2014, 3, 145–154. [Google Scholar] [CrossRef]
- Gropler, M.C.; Harris, T.E.; Hall, A.M.; Wolins, N.E.; Gross, R.W.; Han, X.; Chen, Z.; Finck, B.N. Lipin 2 is a liver-enriched phosphatidate phosphohydrolase enzyme that is dynamically regulated by fasting and obesity in mice. J. Biol. Chem. 2009, 284, 6763–6772. [Google Scholar] [CrossRef]
- Finck, B.N.; Gropler, M.C.; Chen, Z.; Leone, T.C.; Croce, M.A.; Harris, T.E.; Lawrence, J.C.; Kelly, D.P. Lipin 1 is an inducible amplifier of the hepatic PGC-1α/PPARα regulatory pathway. Cell Metab. 2006, 4, 199–210. [Google Scholar] [CrossRef]
- Massart, J.; Zierath, J.R. Role of Diacylglycerol Kinases in Glucose and Energy Homeostasis. Trends Endocrinol. Metab. 2019, 30, 603–617. [Google Scholar] [CrossRef]
- Bergstrom, J.D. The lipogenic enzyme acetoacetyl-CoA synthetase and ketone body utilization for denovo lipid synthesis, a review. J. Lipid Res. 2023, 64, 100407. [Google Scholar] [CrossRef] [PubMed]
- Goedeke, L.; Bates, J.; Vatner, D.F.; Perry, R.J.; Wang, T.; Ramirez, R.; Li, L.; Ellis, M.W.; Zhang, D.; Wong, K.E.; et al. Acetyl-CoA Carboxylase Inhibition Reverses NAFLD and Hepatic Insulin Resistance but Promotes Hypertriglyceridemia in Rodents. Hepatology 2018, 68, 2197–2211. [Google Scholar] [CrossRef] [PubMed]
- Schachtl-Riess, J.F.; Schönherr, S.; Lamina, C.; Forer, L.; Coassin, S.; Streiter, G.; Kheirkhah, A.; Li, Y.; Meiselbach, H.; Di Maio, S.; et al. KLKB1 and CLSTN2 are associated with HDL-mediated cholesterol efflux capacity in a genome-wide association study. Atherosclerosis 2023, 368, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Bouillon, R.; Schuit, F.; Antonio, L.; Rastinejad, F. Vitamin D Binding Protein: A Historic Overview. Front. Endocrinol. 2019, 10, 910. [Google Scholar] [CrossRef] [PubMed]
- Borup, A.; Christensen, P.M.; Nielsen, L.B.; Christoffersen, C. Apolipoprotein M in lipid metabolism and cardiometabolic diseases. Curr. Opin. Lipidol. 2015, 26, 48–55. [Google Scholar] [CrossRef]
- Bahitham, W.; Watts, R.; Nelson, R.; Lian, J.; Lehner, R. Liver-specific expression of carboxylesterase 1g/esterase-x reduces hepatic steatosis, counteracts dyslipidemia and improves insulin signaling. Biochim. Biophys. Acta 2016, 1861, 482–490. [Google Scholar] [CrossRef]
- Cheng, Y.; Zhou, W.; El Sheery, N.I.; Peters, C.; Li, M.; Wang, X.; Huang, J. Characterization of the Arabidopsis glycerophosphodiester phosphodiesterase (GDPD) family reveals a role of the plastid-localized AtGDPD1 in maintaining cellular phosphate homeostasis under phosphate starvation. Plant J. 2011, 66, 781–795. [Google Scholar] [CrossRef]
- Chu, K.; Miyazaki, M.; Man, W.C.; Ntambi, J.M. Stearoyl-coenzyme A desaturase 1 deficiency protects against hypertriglyceridemia and increases plasma high-density lipoprotein cholesterol induced by liver X receptor activation. Mol. Cell Biol. 2006, 26, 6786–6798. [Google Scholar] [CrossRef]
- Yan, S.; Yang, X.F.; Liu, H.L.; Fu, N.; Ouyang, Y.; Qing, K. Long-chain acyl-CoA synthetase in fatty acid metabolism involved in liver and other diseases: An update. World J. Gastroenterol. 2015, 21, 3492–3498. [Google Scholar] [CrossRef]
- Kwanten, W.J.; Vandewynckel, Y.P.; Martinet, W.; De Winter, B.Y.; Michielsen, P.P.; Van Hoof, V.O.; Driessen, A.; Timmermans, J.P.; Bedossa, P.; Van Vlierberghe, H.; et al. Hepatocellular autophagy modulates the unfolded protein response and fasting-induced steatosis in mice. Am. J. Physiol. Gastrointest. Liver Physiol. 2016, 311, G599–G609. [Google Scholar] [CrossRef]









| Gene | Forward Sequence | Reverse Sequence | Annealing Temp (°C) |
|---|---|---|---|
| Gapdh | CATCACTGCCACCCAGAAGACTG | ATGCCAGTGAGCTTCCCGTTCAG | 50 |
| 18S | AGTCCCTGCCCTTTGTACACA | CGATCCGAGGGCCTCACTA | 56 |
| Ppp1r3c | GCGTTGTGTTTGCTGACTCC | CGGTTGAAGGCTGAGGGAAAT | 62.4 |
| Lipc | CTTCCAGCCTGGCTGCCACTT | GCAAGGAGTCAATGAAGAGGTGC | 60 |
| Lpin1 | TAAACGGAGCCGACACCTTGGA | CCGTTGTCACTGGCTTGTTTGG | 60 |
| Igfbp2 | CCTCAAGTCAGGCATGAAGGAG | TGGTCCAACTCCTGCTGGCAAG | 60 |
| Plscr4 | ATCCTGTGACGAATCAGCCTGC | GAGGCTCAACATGCTGAAGAACG | 60 |
| Scd1 | GCAAGCTCTACACCTGCCTCTT | CGTGCCTTGTAAGTTCTGTGGC | 60 |
| Plin4 | GCACTAAGGACACGGTGACCAC | GACCACAGACTTGGTAGTGTCC | 60 |
| Serum Parameter | Control Male | 9-HODE Male |
|---|---|---|
| Cholesterol (mg/dL) | 95.68 ± 4.733 | 97.23 ± 3.236 |
| Triglycerides (mg/dL) | 67.28 ± 2.832 | 64.75 ± 2.843 |
| HDL (mg/dL) | 59.44 ± 2.536 | 57.79 ± 1.597 |
| LDL (mg/dL) | 2.924 ± 0.2501 | 3.672 ± 0.2044 * |
| VLDL (mg/dL) | 13.36 ± 0.5657 | 12.95 ± 0.5682 |
| Serum Parameter | Control Female | 9-HODE Female |
| Cholesterol (mg/dL) | 73.08 ± 3.458 | 75.11 ± 1.789 |
| Triglycerides (mg/dL) | 47.5 ± 3.711 | 66.3 ± 2.012 ** |
| HDL (mg/dL) | 43.33 ± 2.105 | 43.11 ± 1.859 |
| LDL (mg/dL) | 3.763 ± 0.4153 | 4.128 ± 0.3377 |
| VLDL (mg/dL) | 9.503 ± 0.7429 | 13.26 ± 0.4023 ** |
| Serum Parameter | Control Male | 9-HOT9-HOTrE Male |
|---|---|---|
| Cholesterol (mg/dL) | 95.68 ± 4.733 | 102.4 ± 3.529 |
| Triglycerides (mg/dL) | 67.28 ± 2.832 | 63.23 ± 5.781 |
| HDL (mg/dL) | 59.44 ± 2.536 | 61.2 ± 1.995 |
| LDL (mg/dL) | 2.924 ± 0.2501 | 3.916 ± 0.3611 |
| VLDL (mg/dL) | 13.36 ± 0.5657 | 12.64 ± 1.156 |
| Serum Parameter | Control Female | 9-HOTrE Female |
| Cholesterol (mg/dL) | 61.27 ± 3.395 | 83.57 ± 3.203 ** |
| Triglycerides (mg/dL) | 68.45 ± 5.27 | 62.1 ± 2.438 |
| HDL (mg/dL) | 29.92 ± 0.9884 | 37.61 ± 1.104 ** |
| LDL (mg/dL) | 1.438 ± 0.09801 | 1.815 ± 0.06538 * |
| VLDL (mg/dL) | 9.503 ± 0.7429 | 13.26 ± 0.4023 ** |
| Serum Parameter | Cyp2-Null Male | hCYP2B6-Tg Male |
|---|---|---|
| Cholesterol (mg/dL) | 104.1 ± 2.863 | 117.1 ± 2.289 * |
| Triglycerides (mg/dL) | 82.18 ± 4.017 | 132 ± 6.781 *** |
| HDL (mg/dL) | 54.54 ± 1.709 | 62.77 ± 1.331 * |
| LDL (mg/dL) | 2.938 ± 0.1074 | 3.305 ± 0.6967 |
| VLDL (mg/dL) | 16.44 ± 0.8024 | 26.4 ± 1.356 *** |
| Serum Parameter | Cyp2-Null Female | hCYP2B6-Tg Female |
| Cholesterol (mg/dL) | 74.5 ± 1.829 | 77.64 ± 4.385 |
| Triglycerides (mg/dL) | 95.96 ± 4.5 | 67.18 ± 5.404 ** |
| HDL (mg/dL) | 37.76 ± 0.8123 | 38.55 ± 1.162 |
| LDL (mg/dL) | 4.736 ± 0.2744 | 4.72 ± 0.8014 |
| VLDL (mg/dL) | 19.19 ± 0.8999 | 13.44 ± 1.08 ** |
| Comparison | Total DEG | Enriched in hCYP2B6-Tg Mice | Enriched in Cyp2b-Null Mice |
|---|---|---|---|
| Male Cyp2b-null vs. Male hCYP2B6-Tg | 807 | 414 | 393 |
| Female Cyp2b-null vs. Female hCYP2B6-Tg | 1224 | 623 | 601 |
| Males and Females SHARED | 152 | 58 | 38 |
| Males—Fold Change | Females—Fold Change | |||
|---|---|---|---|---|
| Gene | RNAseq | qPCR | RNAseq | qPCR |
| Ppp1r3c | −1.044 ** | −0.639 * | −0.696 | 0.101 |
| Lipc | 0.556 *** | 0.143 | −0.725 *** | −0.704 * |
| Lpin1 | 1.117 ** | 1.294 | 1.528 *** | 1.550 ** |
| Igfbp2 | 0.760 * | 0.616 * | −0.496 | −0.668 |
| Plscr4 | −0.669 * | −0.893 ** | 0.505 | 0.268 |
| Scd1 | −1.390 *** | −1.471 *** | −1.253 * | −0.934 *** |
| Plin4 | −0.775 * | −1.618 *** | −0.736 * | 0.110 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Eccles-Miller, J.A.; Johnson, T.D.; Baldwin, W.S. Sexually Dimorphic Effects of CYP2B6 in the Development of Fasting-Mediated Steatosis in Mice: Role of the Oxylipin Products 9-HODE and 9-HOTrE. Biomedicines 2025, 13, 295. https://doi.org/10.3390/biomedicines13020295
Eccles-Miller JA, Johnson TD, Baldwin WS. Sexually Dimorphic Effects of CYP2B6 in the Development of Fasting-Mediated Steatosis in Mice: Role of the Oxylipin Products 9-HODE and 9-HOTrE. Biomedicines. 2025; 13(2):295. https://doi.org/10.3390/biomedicines13020295
Chicago/Turabian StyleEccles-Miller, Jazmine A., Tyler D. Johnson, and William S. Baldwin. 2025. "Sexually Dimorphic Effects of CYP2B6 in the Development of Fasting-Mediated Steatosis in Mice: Role of the Oxylipin Products 9-HODE and 9-HOTrE" Biomedicines 13, no. 2: 295. https://doi.org/10.3390/biomedicines13020295
APA StyleEccles-Miller, J. A., Johnson, T. D., & Baldwin, W. S. (2025). Sexually Dimorphic Effects of CYP2B6 in the Development of Fasting-Mediated Steatosis in Mice: Role of the Oxylipin Products 9-HODE and 9-HOTrE. Biomedicines, 13(2), 295. https://doi.org/10.3390/biomedicines13020295

