Evaluation of the LightCycler® PRO Instrument as a Platform for Rhesus D Typing
Abstract
1. Introduction
2. Materials and Methods
2.1. Setup
2.2. Sample Collection
2.3. Real-Time PCR for Weak D Types 1, 2, and 3 and DVII
2.4. Sanger Sequencing of RHD Exons 1–10
| PCR Reaction | Primer ID | Primer Sequence 5′-3′ | Concentration [µM] | Tm [°C] |
|---|---|---|---|---|
| RHD Exon 1 | RHD_E1_2f_M13 | CAGGAAACAGCTATGACGCTTCCGTGTTAACTCCATAGAG | 0.5 | 88.4 |
| RHD_E1_2r | GGGGGAATCTTTTTCCTT | 0.5 | ||
| RHD Exon 2 | RHD-E2_936_F6 | ATGACAGTAACAGCACGCAC [31] | 0.25 | 89.0 |
| RHD_i2+61R7_M13 | CAGGAAACAGCTATGACTATCCCAGATCTTCTGGAACC | 0.25 | ||
| RHD Exon 3 | Ds3s_M13 | CAGGAAACAGCTATGACGTCGTCCTGGCTCTCCCTCTCT [32] | 0.25 | 86.5 |
| RH_E3_r1 | GAGATGAGGATCTTGCTATGATG | 0.25 | ||
| RHD Exon 4 | RHD_E4_1f_M13 | CAGGAAACAGCTATGACTATCAGGGCTTGCCCC | 0.25 | 85.8 |
| RHD_E4_2r | TCAGACACCCAGGGGAAC | 0.25 | ||
| RHD Exon 5 | RH_E5_1f_M13 | CAGGAAACAGCTATGACGACCTTTGGAGCAGGAGTG | 0.15 | 88.7 |
| RHD_E5_2r | TGTGACCACCCAGCATTCTA | 0.15 | ||
| RHD Exon 6 | Ds6a_M13 | CAGGAAACAGCTATGACCTTCAGCCAAAGCAGAGGAGG [32] | 0.25 | 88.3 |
| Ds6-s | CAGGGTTGCCTTGTTCCCA [32] | 0.25 | ||
| RHD Exon 7 | RHD_E7_1f_M13 | CAGGAAACAGCTATGACCCCCCTTTGGTGGCC | 0.25 | 87.1 |
| RHD_E7_2r | CTTTGGTCTATACCTAGGTGGC | 0.25 | ||
| RHD Exon 8 | RHD_E8_3f | GGAGGCTCTGAGAGGTTGAG | 0.25 | 87.2 |
| RH_E8_2r_M13 | CAGGAAACAGCTATGACAATTATGTGATCCTCAGGGAAG | 0.25 | ||
| RHD Exon 9 | RHD_E9_2s_M13 | CAGGAAACAGCTATGACTCCAGGAATGACAGGGCT | 0.15 | 78.4 |
| RH_E9_2r | TTAAGTTCATGCACTCAAAATCTAT | 0.15 | ||
| RHD Exon 10 | RH_E10_1f_M13 | CAGGAAACAGCTATGACAGAGATCAAGCCAAAATCAGTAT | 0.15 | 85.6 |
| RHD_E10_1r | ATGGTGAGATTCTCCTCAAAG | 0.15 |
3. Results
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wagner, F.F.; Flegel, W.A. Review: The molecular basis of the Rh blood group phenotypes. Immunohematology 2004, 20, 23–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flegel, W.A. Molecular genetics and clinical applications for RH. Transfus. Apher. Sci. 2011, 44, 81–91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- The RhesusBase. Available online: https://www.rhesusbase.info/ (accessed on 27 May 2024).
- International Society of Blood Transfusion (ISBT). Available online: https://www.isbtweb.org/resource/004rhd.html (accessed on 27 May 2024).
- Sandler, S.G.; Chen, L.N.; Flegel, W.A. Serological weak D phenotypes: A review and guidance for interpreting the RhD blood type using the RHD genotype. Br. J. Haematol. 2017, 179, 10–19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gane, P.; Le Van Kim, C.; Bony, V.; El Nemer, W.; Mouro, I.; Nicolas, V.; Colin, Y.; Cartron, J.P. Flow cytometric analysis of the association between blood group-related proteins and the detergent-insoluble material of K562 cells and erythroid precursors. Br. J. Haematol. 2001, 113, 680–688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wagner, F.F.; Gassner, C.; Müller, T.H.; Schönitzer, D.; Schunter, F.; Flegel, W.A. Molecular basis of weak D phenotypes. Blood 1999, 93, 385–393. [Google Scholar] [CrossRef] [Scilit]
- Flegel, W.A. How I manage donors and patients with a weak D phenotype. Curr. Opin. Hematol. 2006, 13, 476–483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flegel, W.A. Blood group genotyping in Germany. Transfusion 2007, 47, 47S–53S. [Google Scholar] [CrossRef] [Scilit]
- Wagner, F.F.; Eicher, N.I.; Jørgensen, J.R.; Lonicer, C.B.; Flegel, W.A. DNB: A partial D with anti-D frequent in Central Europe. Blood 2002, 100, 2253–2256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Toly-Ndour, C.; Huguet-Jacquot, H.; Mailloux, A.; Delaby, H.; Canellini, G.; Olsson, M.L.; Wikman, A.; Koelewijn, J.M.; Minon, J.M.; Legler, T.J.; et al. Rh disease prevention: The European Perspective. ISBT Sci. Ser. 2021, 16, 106–118. [Google Scholar] [CrossRef] [Scilit]
- Von Zabern, I.; Wager, F.F.; Moulds, J.M.; Moulds, J.J.; Flegel, W.A. D category IV: A group of clinically relevant and phylogenetically diverse partial D. Transfusion 2013, 53, 2960–2973. [Google Scholar] [CrossRef] [Scilit]
- Polin, H.; Danzer, M.; Gaszner, W.; Broda, D.; St-Louis, M.; Pröll, J.; Hofer, K.; Gabriel, C. Identification of RHD alleles with the potential of anti-D immunization among seemingly D- blood donors in Upper Austria. Transfusion 2009, 49, 676–681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reid, M.E. Applications of DNA-based assays in blood group antigen and antibody identification. Transfusion 2003, 43, 1748–1757. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daniels, G. Variants of RhD--current testing and clinical consequences. Br. J. Haematol. 2013, 161, 461–470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ansart-Pirenn, H.; Asso-Bonnet, M.; Le Pennec, P.-Y.; Roussel, M.; Patereau, C.; Noizat-Pirenne, F. RhD variants in Caucasians: Consequences for checking clinically relevant alleles. Transfusion 2004, 44, 1282–1286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Denomme, G.A.; Wagner, F.F.; Fernandes, B.J.; Li, W.; Flegel, W.A. Partial D, weak D types, and novel RHD alleles among 33,864 multiethnic patients: Implications for anti-D alloimmunization and prevention. Transfusion 2005, 45, 1554–1560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Polin, H.; Danzer, M.; Hofer, K.; Gassner, W.; Gabriel, C. Effective molecular RHD typing strategy for blood donations. Transfusion 2007, 47, 1350–1355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Sandt, V.S.T.; Gassner, C.; Emonds, M.-P.; Legler, T.J.; Mahieu, S.; Körmöczi, G.F. RHD variants in Flanders, Belgium. Transfusion 2015, 55 Pt 2, 1411–1417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Müller, T.H.; Wagner, F.F.; Trockenbacher, A.; Eicher, N.I.; Flegel, W.A.; Schönitzer, D.; Schunter, F.; Gassner, C. PCR screening for common weak D types shows different distributions in three Central European populations. Transfusion 2001, 41, 45–52. [Google Scholar] [CrossRef] [Scilit]
- Matzhold, E.M.; Bemelmans, M.; Polin, H.; Körmöczi, G.F.; Schönbacher, M.; Wagner, T. Characterization of Novel RHD Allele Variants and Their Implications for Routine Blood Group Diagnostics. Biomedicines 2024, 12, 456. [Google Scholar] [CrossRef] [Scilit]
- Hutchison, C.J.; Srivastava, K.; Polin, H.; Bueno, M.U.; Flegel, W.A. Rh flow cytometry: An updated methodology for D antigen density applied to weak D types 164 and 165. Transfusion 2023, 63, 2141–2151. [Google Scholar] [CrossRef] [Scilit]
- Polin, H.; Brisner, M.; Reiter, A.; Danzer, M. Identification of four novel RHD alleles by weakened antigen D expression. Transfusion 2018, 58, 267–268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stabentheiner, S.; Danzer MNiklas, N.; Atzmüller, S.; Pröll, J.; Hackl, C.; Polin, H.; Hofer, K.; Gabriel, C. Overcoming methodical limits of standard RHD genotyping by next-generation sequencing. Vox Sang. 2011, 100, 381–388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flegel, W.A.; Chiosea, I.; Sachs, U.J.; Bein, G. External quality assessment in molecular immunohematology: The INSTAND proficiency test program. Transfusion 2013, 53 (Suppl. 2), 2850–2858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Olerup, O.; Aldener, A.; Fogdell, A. HLA-DQB1 and -DQA1 typing by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours. Tissue Antigens 1993, 41, 119–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gassner, C.; Schmarda, A.; Kilga-Nogler, S.; Jenny-Feldkircher, B.; Rainer, E.; Müller, T.H.; Wagner, F.F.; Flegel, W.A.; Schönitzer, D. RHD/CE typing by polymerase chain reaction using sequence-specific primers. Transfusion 1997, 37, 1020–1026. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brajovich, M.E.L.; Trucco Boggione, C.; Biondi, C.S.; Racca, A.L.; Tarragó, M.; Nogués, N.; Cotorruelo, C.M. Comprehensive analysis of RHD alleles in Argentineans with variant D phenotypes. Transfusion 2011, 52, 389–396. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Messing, J.; Crea, R.; Seeburg, P.H. A system for shotgun DNA 361 sequencing. Nucleic Acids Res. 1981, 9, 309–321. [Google Scholar] [CrossRef] [Scilit]
- Ewing, B.; Green, P. Base-Calling of Automated Sequencer Traces Using Phred. II. Error Probabilities. Genome Res. 1998, 8, 186–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gassner, C.; Doescher, A.; Drnovsek, T.D.; Rozman, P.; Eicher, N.I.; Legler, T.J.; Lukin, S.; Garritsen, H.; Kleinrath, T.; Egger, B.; et al. Presence of RHD in serologically D-, C/E+ individuals: A European multicenter study. Transfusion 2005, 45, 527–538. [Google Scholar] [CrossRef] [Scilit]
- Legler, T.J.; Maas, J.H.; Kohler, M.; Wagner, T.; Daniels, G.L.; Perco, P.; Panzer, S. RHD sequencing: A new tool for decision making on transfusion therapy and provision of Rh prophylaxis. Transfus. Med. 2001, 11, 383–388. [Google Scholar] [CrossRef] [Scilit]
- Srivathsa, N.; Dendukuri, D. Automated ABO Rh-D blood type detection using smartphone imaging for point-of-care medical diagnostics. In Proceedings of the 2016 38th Annual International Conference of the IEEE Engineering in Medicine and Biology Society (EMBC), Orlando, FL, USA, 16–20 August 2016. [Google Scholar]
- Hillyer, C.D.; Shaz, B.H.; Winkler, A.M.; Reid, M. Integrating molecular technologies for red blood cell typing and compatibility testing into blood centers and transfusion services. Transfus. Med. Rev. 2008, 22, 117–132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jennings, W.B.; Ruschi, P.A.; Ferraro, G.; Quijada, C.C.; Silva-Malanski, A.C.G.; Prosdocimi, F.; Buckup, P.A. Barcoding the Neotropical freshwater fish fauna using a new pair of universal COI primers with a discussion of primer dimers and M13 primer tails. Genome 2019, 62, 77–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ririe, K.M.; Rasmussen, R.P.; Wittwer, C.T. Product Differentiation by Analysis of DNA Melting Curves during the Polymerase Chain Reaction. Anal. Biochem. 1997, 245, 154–160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aslanzadeh, J. Preventing PCR amplification carryover contamination in a clinical laboratory. Ann. Clin. Lab. Sci. 2004, 34, 389–396. [Google Scholar] [PubMed]
- Greub, G.; Sahli, R.; Brouillet, R.; Jaton, K. Ten years of R&D and full automation in molecular diagnosis. Future Microbiol. 2016, 11, 403–425. [Google Scholar]
- Zhang, C.; Xing, D. Miniaturized PCR chips for nucleic acid amplification and analysis: Latest advances and future trends. Nucleic Acids Res. 2007, 35, 4223–4237. [Google Scholar] [CrossRef] [Scilit]


| Specificity | rs No | Primer ID | Primer Sequence 5′-3′ | Concentration [µM] | Tm [°C] |
|---|---|---|---|---|---|
| RHD*01W.1 | rs121912763 | WD1-809G-f | acacgctatttctttgcagACTTATGG [20] | 0.25 | 83 |
| (NM_016124.6:c.809T>G) | WD1-r | GGTACTTGGCTCCCCCGAC [20] | 0.5 | ||
| RHD*01W.2 | rs71652374 | WD2-1154C-f | ctccaaatcttttaacattaaattatgcatttaaacagC [20] | 0.5 | 74.4 |
| (NM_016124.6:c.1154G>C) | WD2-r | gtgaaaaatcttacCTTCCAGAAAACTTGGTCATC [20] | 0.5 | ||
| RHD*01W.3 | rs144969459 | WD3-8G-f | acagagacggacacaggATGAGATG [20] | 0.25 | 86.4 |
| (NM_016124.6:c.8C>G) | WD3-r | CTTGATAGGATGCCACGAGCCC [20] | 0.5 | ||
| RHD*07.01 | rs121912762 | RHD-E2-201-f | GCTTGGGCTTCCTCACCTCG [27] | 0.25 | 85.8 |
| (NM_016124.6:c.329T>C) | RHD-329C-r | ccaccatcccaatacCTGAACG [28] | 0.15 | ||
| ß-Globin | G107F | CTGGGCAGGTTGGTATCA [13] | 0.25 | 80.7 | |
| (chr11:5234243-5234349) 1 | G107R | GAGAGTCAGTGCCTATCAGAAAC [13] | 0.25 | ||
| ß-Globin | globin F | CAACTTCATCCACGTTCACC [13] | 0.25 | 86 | |
| (chr11:5226949-5227216) 2 | globin R | GAAGAGCCAAGGACAGGTAC [13] | 0.25 |
| Year | Sample | INSTAND-Published Results | This Study | ||
|---|---|---|---|---|---|
| SSP PCR Results | Sanger Sequencing Results | Determined Genotype (Phenotype) | |||
| 2019 | 31 | RHD gene (normal) | negative for target SNPs | NM_016124.6:c.1_1254= | RHD*01 (normal D antigen) |
| 32 | RHD gene (normal) | negative for target SNPs | NM_016124.6:c.1_1254= | RHD*01 (normal D antigen) | |
| 33 | DIV | negative for target SNPs | no amplification of RHD exons 6–9 | RHD*04.03 * (DIV type 3) | |
| 34 | weak D type 5 | negative for target SNPs | NM_016124.6:c.446C>A | RHD*01W.5 (weak D type 5) | |
| 2020 | 31 | RHD gene absent on both chr | negative for target SNPs | no amplification of RHD exons 1–10 | RHD*01N.01 * (D−) |
| 32 | RHD gene absent on both chr | negative for target SNPs | no amplification of RHD exons 1–10 | RHD*01N.01 * (D−) | |
| 33 | weak D type 1 | RHD*01W.1 | NM_016124.6:c.809T>G | RHD*01W.1 (weak D type 1) | |
| 34 | DVII | RHD*07.01 | NM_016124.6:c.329T>C | RHD*07.01 (DVII) | |
| 2021 | 31 | RHD gene absent on both chr | negative for target SNPs | no amplification of RHD exons 1–10 | RHD*01N.01 * (D−) |
| 32 | RHD(K409K) | negative for target SNPs | NM_016124.6:c.1227G>A | RHD*01EL.01 (Del) | |
| 33 | RHD gene (normal) | negative for target SNPs | NM_016124.6:c.1_1254= | RHD*01 (normal D antigen) | |
| 34 | RHD gene (normal) | negative for target SNPs | NM_016124.6:c.1_1254= | RHD*01 (normal D antigen) | |
| 2022 | 31 | DHMi | negative for target SNPs | NM_016124.6:c.848C>T | RHD*19 (DHMi) |
| 32 | weak D type 1 | RHD*01W.1 | NM_016124.6:c.809T>G | RHD*01W.1 (weak D type 1) | |
| 33 | RHD gene absent on both chr | negative for target SNPs | no amplification of RHD exons 1–10 | RHD*01N.01 * (D−) | |
| 34 | RHD gene (normal) | negative for target SNPs | NM_016124.6:c.1_1254= | RHD*01 (normal D antigen) | |
| 2023 | 31 | RHD gene (normal) | negative for target SNPs | NM_016124.6:c.1_1254= | RHD*01 (normal D antigen) |
| 32 | RHD gene absent on both chr | negative for target SNPs | no amplification of RHD exons 1–10 | RHD*01N.01 * (D−) | |
| 33 | DNB | negative for target SNPs | NM016124.6:c.[1063G>A];[1063=] | RHD*25/RHD*01 (DNB het.) | |
| 34 | weak D type 2 | RHD*01W.2 | NM_016124.6:c.1154G>C | RHD*01W.2 (weak D type 2) | |
| 2024 | 31 | RHD gene (normal) | negative for target SNPs | NM_016124.6:c.1_1254= | RHD*01 (normal D antigen) |
| 32 | RHD gene (normal) | negative for target SNPs | NM_016124.6:c.1_1254= | RHD*01 (normal D antigen) | |
| 33 | weak D type 3 | RHD*01W.3 | NM_016124.6:c.8C>G | RHD*01W.3 (weak D type 3) | |
| 34 | weak D type 11 | negative for target SNPs | NM_016124.6:c.885G>T | RHD*11 (weak partial type 11) | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Polin, H.; Wenighofer, B.; Polonyi, N.; Danzer, M. Evaluation of the LightCycler® PRO Instrument as a Platform for Rhesus D Typing. Biomedicines 2024, 12, 1785. https://doi.org/10.3390/biomedicines12081785
Polin H, Wenighofer B, Polonyi N, Danzer M. Evaluation of the LightCycler® PRO Instrument as a Platform for Rhesus D Typing. Biomedicines. 2024; 12(8):1785. https://doi.org/10.3390/biomedicines12081785
Chicago/Turabian StylePolin, Helene, Barbara Wenighofer, Nina Polonyi, and Martin Danzer. 2024. "Evaluation of the LightCycler® PRO Instrument as a Platform for Rhesus D Typing" Biomedicines 12, no. 8: 1785. https://doi.org/10.3390/biomedicines12081785
APA StylePolin, H., Wenighofer, B., Polonyi, N., & Danzer, M. (2024). Evaluation of the LightCycler® PRO Instrument as a Platform for Rhesus D Typing. Biomedicines, 12(8), 1785. https://doi.org/10.3390/biomedicines12081785
