Effect of Comparable Carbon Chain Length Short- and Branched-Chain Fatty Acids on Adipokine Secretion from Normoxic and Hypoxic Lipopolysaccharide-Stimulated 3T3-L1 Adipocytes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture Conditions and Differentiation
2.2. Experimental Treatment Conditions
2.3. Gene Expression Analysis
2.4. Secreted Protein Analysis
2.5. Intracellular Protein Analysis
2.6. Statistical Analysis
3. Results
3.1. Effect of SCFA and BCFA on Secreted Inflammatory Mediators in LPS-Stimulated Adipocytes
3.2. Effect of SCFA and BCFA on Transcription Factor Activtation in LPS-Stimulated Adipocytes
3.3. Effect of SCFA and BCFA on the Expression of Hypoxia-Sensitive Genes in Combined LPS/CC-Stimulated Adipocytes
3.4. Effect of SCFA and BCFA on the Secretion of Inflammatory Mediators in LPS/CC-Stimulated Adipocytes
3.5. Effect of SCFA and BCFA on Transcription Factor Activtation in LPS/CC-Stimulated Adipocytes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Obesity and Overweight. Available online: https://www.who.int/news-room/fact-sheets/detail/obesity-and-overweight (accessed on 14 August 2024).
- Hotamisligil, G.S. Inflammation and Metabolic Disorders. Nature 2006, 444, 860–867. [Google Scholar] [CrossRef] [PubMed]
- Piché, M.-E.; Tchernof, A.; Després, J.-P. Obesity Phenotypes, Diabetes, and Cardiovascular Diseases. Circ. Res. 2020, 126, 1477–1500. [Google Scholar] [CrossRef] [PubMed]
- Ruck, L.; Wiegand, S.; Kühnen, P. Relevance and Consequence of Chronic Inflammation for Obesity Development. Mol. Cell Pediatr. 2023, 10, 16. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.S.; Olefsky, J. Chronic Tissue Inflammation and Metabolic Disease. Genes Dev. 2021, 35, 307–328. [Google Scholar] [CrossRef] [PubMed]
- Pradhan, A. Obesity, Metabolic Syndrome, and Type 2 Diabetes: Inflammatory Basis of Glucose Metabolic Disorders. Nutr. Rev. 2007, 65, S152–S156. [Google Scholar] [CrossRef]
- Ye, J.; Gao, Z.; Yin, J.; He, Q. Hypoxia Is a Potential Risk Factor for Chronic Inflammation and Adiponectin Reduction in Adipose Tissue of Ob/Ob and Dietary Obese Mice. Am. J. Physiol.-Endocrinol. Metab. 2007, 293, E1118–E1128. [Google Scholar] [CrossRef]
- Trayhurn, P. Hypoxia and Adipose Tissue Function and Dysfunction in Obesity. Physiol. Rev. 2013, 93, 1–21. [Google Scholar] [CrossRef]
- Trayhurn, P.; Wang, B.; Wood, I.S. Hypoxia in Adipose Tissue: A Basis for the Dysregulation of Tissue Function in Obesity? Br. J. Nutr. 2008, 100, 227–235. [Google Scholar] [CrossRef]
- Norouzirad, R.; González-Muniesa, P.; Ghasemi, A. Hypoxia in Obesity and Diabetes: Potential Therapeutic Effects of Hyperoxia and Nitrate. Oxidative Med. Cell. Longev. 2017, 2017, 5350267. [Google Scholar] [CrossRef]
- Khan, M.J.; Gerasimidis, K.; Edwards, C.A.; Shaikh, M.G. Role of Gut Microbiota in the Aetiology of Obesity: Proposed Mechanisms and Review of the Literature. J. Obes. 2016, 2016, 7353642. [Google Scholar] [CrossRef]
- Green, M.; Arora, K.; Prakash, S. Microbial Medicine: Prebiotic and Probiotic Functional Foods to Target Obesity and Metabolic Syndrome. Int. J. Mol. Sci. 2020, 21, 2890. [Google Scholar] [CrossRef] [PubMed]
- Morrison, D.J.; Preston, T. Formation of Short Chain Fatty Acids by the Gut Microbiota and Their Impact on Human Metabolism. Gut Microbes 2016, 7, 189–200. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Wichienchot, S.; He, X.; Fu, X.; Huang, Q.; Zhang, B. In Vitro Colonic Fermentation of Dietary Fibers: Fermentation Rate, Short-Chain Fatty Acid Production and Changes in Microbiota. Trends Food Sci. Technol. 2019, 88, 1–9. [Google Scholar] [CrossRef]
- Chen, T.; Young Kim, C.; Kaur, A.; Lamothe, L.; Shaikh, M.; Keshavarzian, A.R.; Hamaker, B. Dietary Fibre-Based SCFA Mixtures Promote Both Protection and Repair of Intestinal Epithelial Barrier Function in a Caco-2 Cell Model. Food Funct. 2017, 8, 1166–1173. [Google Scholar] [CrossRef] [PubMed]
- Karimi, R.; Azizi, M.H.; Sahari, M.A.; Kazem, A.E. In Vitro Fermentation Profile of Soluble Dietary Fibers Obtained by Different Enzymatic Extractions from Barley Bran. Bioact. Carbohydr. Diet. Fibre 2020, 21, 100205. [Google Scholar] [CrossRef]
- Kaur, A.; Rose, D.J.; Rumpagaporn, P.; Patterson, J.A.; Hamaker, B.R. In Vitro Batch Fecal Fermentation Comparison of Gas and Short-Chain Fatty Acid Production Using “Slowly Fermentable” Dietary Fibers. J. Food Sci. 2011, 76, H137–H142. [Google Scholar] [CrossRef]
- Neis, E.P.; van Eijk, H.M.; Lenaerts, K.; Damink, S.W.O.; Blaak, E.E.; Dejong, C.H.; Rensen, S.S. Distal versus Proximal Intestinal Short-Chain Fatty Acid Release in Man. Gut 2019, 68, 764–765. [Google Scholar] [CrossRef]
- Sowah, S.A.; Hirche, F.; Milanese, A.; Johnson, T.S.; Grafetstätter, M.; Schübel, R.; Kirsten, R.; Ulrich, C.M.; Kaaks, R.; Zeller, G.; et al. Changes in Plasma Short-Chain Fatty Acid Levels after Dietary Weight Loss among Overweight and Obese Adults over 50 Weeks. Nutrients 2020, 12, 452. [Google Scholar] [CrossRef]
- Cummings, J.H.; Pomare, E.W.; Branch, W.J.; Naylor, C.P.; Macfarlane, G.T. Short Chain Fatty Acids in Human Large Intestine, Portal, Hepatic and Venous Blood. Gut 1987, 28, 1221–1227. [Google Scholar] [CrossRef]
- Rahat-Rozenbloom, S.; Fernandes, J.; Cheng, J.; Gloor, G.B.; Wolever, T.M.S. The Acute Effects of Inulin and Resistant Starch on Postprandial Serum Short-Chain Fatty Acids and Second-Meal Glycemic Response in Lean and Overweight Humans. Eur. J. Clin. Nutr. 2017, 71, 227–233. [Google Scholar] [CrossRef]
- Mueller, N.T.; Zhang, M.; Juraschek, S.P.; Miller, E.R.; Appel, L.J. Effects of High-Fiber Diets Enriched with Carbohydrate, Protein, or Unsaturated Fat on Circulating Short Chain Fatty Acids: Results from the OmniHeart Randomized Trial. Am. J. Clin. Nutr. 2020, 111, 545–554. [Google Scholar] [CrossRef] [PubMed]
- Bloemen, J.G.; Venema, K.; van de Poll, M.C.; Olde Damink, S.W.; Buurman, W.A.; Dejong, C.H. Short Chain Fatty Acids Exchange across the Gut and Liver in Humans Measured at Surgery. Clin. Nutr. 2009, 28, 657–661. [Google Scholar] [CrossRef] [PubMed]
- Ganapathy, V.; Thangaraju, M.; Prasad, P.D.; Martin, P.M.; Singh, N. Transporters and Receptors for Short-Chain Fatty Acids as the Molecular Link between Colonic Bacteria and the Host. Curr. Opin. Pharmacol. 2013, 13, 869–874. [Google Scholar] [CrossRef] [PubMed]
- Louis, P.; Flint, H.J. Diversity, Metabolism and Microbial Ecology of Butyrate-Producing Bacteria from the Human Large Intestine. FEMS Microbiol. Lett. 2009, 294, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Wong, J.M.W.; de Souza, R.; Kendall, C.W.C.; Emam, A.; Jenkins, D.J.A. Colonic Health: Fermentation and Short Chain Fatty Acids. J. Clin. Gastroenterol. 2006, 40, 235. [Google Scholar] [CrossRef]
- Canfora, E.E.; Jocken, J.W.; Blaak, E.E. Short-Chain Fatty Acids in Control of Body Weight and Insulin Sensitivity. Nat. Rev. Endocrinol. 2015, 11, 577–591. [Google Scholar] [CrossRef]
- Mandaliya, D.K.; Seshadri, S. Short Chain Fatty Acids, Pancreatic Dysfunction and Type 2 Diabetes. Pancreatology 2019, 19, 617–622. [Google Scholar] [CrossRef]
- Frampton, J.; Murphy, K.G.; Frost, G.; Chambers, E.S. Short-Chain Fatty Acids as Potential Regulators of Skeletal Muscle Metabolism and Function. Nat. Metab. 2020, 2, 840–848. [Google Scholar] [CrossRef]
- Rahat-Rozenbloom, S.; Fernandes, J.; Gloor, G.B.; Wolever, T.M.S. Evidence for Greater Production of Colonic Short-Chain Fatty Acids in Overweight than Lean Humans. Int. J. Obes. 2014, 38, 1525–1531. [Google Scholar] [CrossRef]
- Lorenz, W.; Buhrmann, C.; Mobasheri, A.; Lueders, C.; Shakibaei, M. Bacterial Lipopolysaccharides Form Procollagen-Endotoxin Complexes That Trigger Cartilage Inflammation and Degeneration: Implications for the Development of Rheumatoid Arthritis. Arthritis Res. Ther. 2013, 15, R111. [Google Scholar] [CrossRef]
- Canfora, E.E.; van der Beek, C.M.; Jocken, J.W.E.; Goossens, G.H.; Holst, J.J.; Olde Damink, S.W.M.; Lenaerts, K.; Dejong, C.H.C.; Blaak, E.E. Colonic Infusions of Short-Chain Fatty Acid Mixtures Promote Energy Metabolism in Overweight/Obese Men: A Randomized Crossover Trial. Sci. Rep. 2017, 7, 2360. [Google Scholar] [CrossRef] [PubMed]
- Yan, H.; Ajuwon, K.M. Mechanism of Butyrate Stimulation of Triglyceride Storage and Adipokine Expression during Adipogenic Differentiation of Porcine Stromovascular Cells. PLoS ONE 2015, 10, e0145940. [Google Scholar] [CrossRef] [PubMed]
- Kimura, I.; Ozawa, K.; Inoue, D.; Imamura, T.; Kimura, K.; Maeda, T.; Terasawa, K.; Kashihara, D.; Hirano, K.; Tani, T.; et al. The Gut Microbiota Suppresses Insulin-Mediated Fat Accumulation via the Short-Chain Fatty Acid Receptor GPR43. Nat. Commun. 2013, 4, 1829. [Google Scholar] [CrossRef] [PubMed]
- Yamashita, H.; Fujisawa, K.; Ito, E.; Idei, S.; Kawaguchi, N.; Kimoto, M.; Hiemori, M.; Tsuji, H. Improvement of Obesity and Glucose Tolerance by Acetate in Type 2 Diabetic Otsuka Long-Evans Tokushima Fatty (OLETF) Rats. Biosci. Biotechnol. Biochem. 2007, 71, 1236–1243. [Google Scholar] [CrossRef]
- Ohira, H.; Fujioka, Y.; Katagiri, C.; Mamoto, R.; Aoyama-Ishikawa, M.; Amako, K.; Izumi, Y.; Nishiumi, S.; Yoshida, M.; Usami, M.; et al. Butyrate Attenuates Inflammation and Lipolysis Generated by the Interaction of Adipocytes and Macrophages. J. Atheroscler. Thromb. 2013, 20, 425–442. [Google Scholar] [CrossRef]
- Naraoka, Y.; Yamaguchi, T.; Hu, A.; Akimoto, K.; Kobayashi, H. Short Chain Fatty Acids Upregulate Adipokine Production in Type 2 Diabetes-Derived Human Adipocytes. Acta Endocrinol. 2018, 14, 287–293. [Google Scholar] [CrossRef]
- Sahuri-Arisoylu, M.; Brody, L.P.; Parkinson, J.R.; Parkes, H.; Navaratnam, N.; Miller, A.D.; Thomas, E.L.; Frost, G.; Bell, J.D. Reprogramming of Hepatic Fat Accumulation and “browning” of Adipose Tissue by the Short-Chain Fatty Acid Acetate. Int. J. Obes. 2016, 40, 955–963. [Google Scholar] [CrossRef]
- Han, J.-H.; Kim, I.-S.; Jung, S.-H.; Lee, S.-G.; Son, H.-Y.; Myung, C.-S. The Effects of Propionate and Valerate on Insulin Responsiveness for Glucose Uptake in 3T3-L1 Adipocytes and C2C12 Myotubes via G Protein-Coupled Receptor 41. PLoS ONE 2014, 9, e95268. [Google Scholar] [CrossRef]
- Peng, K.; Dong, W.; Luo, T.; Tang, H.; Zhu, W.; Huang, Y.; Yang, X. Butyrate and Obesity: Current Research Status and Future Prospect. Front. Endocrinol. 2023, 14, 1098881. [Google Scholar] [CrossRef]
- Martin, J.L.A.; Cartwright, N.M.; Hutchinson, A.L.; Robinson, L.E.; Ma, D.W.L.; Monk, J.M. Differential Effects of Short-Chain Fatty Acids on L6 Myotube Inflammatory Mediator Production in Response to Lipopolysaccharide- or Palmitic Acid-Stimulation. Nutrients 2022, 14, 2826. [Google Scholar] [CrossRef]
- Van, K.; Burns, J.L.; Monk, J.M. Effect of Short-Chain Fatty Acids on Inflammatory and Metabolic Function in an Obese Skeletal Muscle Cell Culture Model. Nutrients 2024, 16, 500. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Fan, C.; Liang, A.; Fan, X.; Wang, R.; Li, P.; Qi, K. Effects of SCFA on the DNA Methylation Pattern of Adiponectin and Resistin in High-Fat-Diet-Induced Obese Male Mice. Br. J. Nutr. 2018, 120, 385–392. [Google Scholar] [CrossRef] [PubMed]
- Xiong, Y.; Miyamoto, N.; Shibata, K.; Valasek, M.A.; Motoike, T.; Kedzierski, R.M.; Yanagisawa, M. Short-Chain Fatty Acids Stimulate Leptin Production in Adipocytes through the G Protein-Coupled Receptor GPR41. Proc. Natl. Acad. Sci. USA 2004, 101, 1045–1050. [Google Scholar] [CrossRef] [PubMed]
- García-Carrizo, F.; Cannon, B.; Nedergaard, J.; Picó, C.; Dols, A.; Rodríguez, A.M.; Palou, A. Regulation of Thermogenic Capacity in Brown and White Adipocytes by the Prebiotic High-Esterified Pectin and Its Postbiotic Acetate. Int. J. Obes. 2020, 44, 715–726. [Google Scholar] [CrossRef]
- Al-Lahham, S.; Roelofsen, H.; Rezaee, F.; Weening, D.; Hoek, A.; Vonk, R.; Venema, K. Propionic Acid Affects Immune Status and Metabolism in Adipose Tissue from Overweight Subjects. Eur. J. Clin. Investig. 2012, 42, 357–364. [Google Scholar] [CrossRef]
- Taormina, V.M.; Unger, A.L.; Schiksnis, M.R.; Torres-Gonzalez, M.; Kraft, J. Branched-Chain Fatty Acids—An Underexplored Class of Dairy-Derived Fatty Acids. Nutrients 2020, 12, 2875. [Google Scholar] [CrossRef]
- Rios-Covian, D.; González, S.; Nogacka, A.M.; Arboleya, S.; Salazar, N.; Gueimonde, M.; de los Reyes-Gavilán, C.G. An Overview on Fecal Branched Short-Chain Fatty Acids Along Human Life and as Related With Body Mass Index: Associated Dietary and Anthropometric Factors. Front. Microbiol. 2020, 11, 973. [Google Scholar] [CrossRef]
- Jie, Z.; Bang-yao, L.; Ming-jie, X.; Hai-wei, L.; Zu-kang, Z.; Ting-song, W.; Craig, S.A. Studies on the Effects of Polydextrose Intake on Physiologic Functions in Chinese People123. Am. J. Clin. Nutr. 2000, 72, 1503–1509. [Google Scholar] [CrossRef]
- Ran-Ressler, R.R.; Bae, S.; Lawrence, P.; Wang, D.H.; Brenna, J.T. Branched-Chain Fatty Acid Content of Foods and Estimated Intake in the USA. Br. J. Nutr. 2014, 112, 565–572. [Google Scholar] [CrossRef]
- Su, X.; Magkos, F.; Zhou, D.; Eagon, J.C.; Fabbrini, E.; Okunade, A.L.; Klein, S. Adipose Tissue Monomethyl Branched-Chain Fatty Acids and Insulin Sensitivity: Effects of Obesity and Weight Loss. Obesity 2015, 23, 329–334. [Google Scholar] [CrossRef]
- Czumaj, A.; Śledziński, T.; Mika, A. Branched-Chain Fatty Acids Alter the Expression of Genes Responsible for Lipid Synthesis and Inflammation in Human Adipose Cells. Nutrients 2022, 14, 2310. [Google Scholar] [CrossRef] [PubMed]
- Heimann, E.; Nyman, M.; Pålbrink, A.-K.; Lindkvist-Petersson, K.; Degerman, E. Branched Short-Chain Fatty Acids Modulate Glucose and Lipid Metabolism in Primary Adipocytes. Adipocyte 2016, 5, 359–368. [Google Scholar] [CrossRef] [PubMed]
- Cranmer-Byng, M.M.; Liddle, D.M.; De Boer, A.A.; Monk, J.M.; Robinson, L.E. Proinflammatory Effects of Arachidonic Acid in a Lipopolysaccharide-Induced Inflammatory Microenvironment in 3T3-L1 Adipocytes in Vitro. Appl. Physiol. Nutr. Metab. 2015, 40, 142–154. [Google Scholar] [CrossRef] [PubMed]
- Al-Lahham, S.H.; Roelofsen, H.; Priebe, M.; Weening, D.; Dijkstra, M.; Hoek, A.; Rezaee, F.; Venema, K.; Vonk, R.J. Regulation of Adipokine Production in Human Adipose Tissue by Propionic Acid. Eur. J. Clin. Investig. 2010, 40, 401–407. [Google Scholar] [CrossRef] [PubMed]
- Creely, S.J.; McTernan, P.G.; Kusminski, C.M.; Fisher, M.; Da Silva, N.F.; Khanolkar, M.; Evans, M.; Harte, A.L.; Kumar, S. Lipopolysaccharide Activates an Innate Immune System Response in Human Adipose Tissue in Obesity and Type 2 Diabetes. Am. J. Physiol.-Endocrinol. Metab. 2007, 292, E740–E747. [Google Scholar] [CrossRef]
- Cani, P.D.; Amar, J.; Iglesias, M.A.; Poggi, M.; Knauf, C.; Bastelica, D.; Neyrinck, A.M.; Fava, F.; Tuohy, K.M.; Chabo, C.; et al. Metabolic Endotoxemia Initiates Obesity and Insulin Resistance. Diabetes 2007, 56, 1761–1772. [Google Scholar] [CrossRef]
- Laugerette, F.; Furet, J.-P.; Debard, C.; Daira, P.; Loizon, E.; Géloën, A.; Soulage, C.O.; Simonet, C.; Lefils-Lacourtablaise, J.; Bernoud-Hubac, N.; et al. Oil Composition of High-Fat Diet Affects Metabolic Inflammation Differently in Connection with Endotoxin Receptors in Mice. Am. J. Physiol.-Endocrinol. Metab. 2012, 302, E374–E386. [Google Scholar] [CrossRef]
- Wang, B.; Wood, I.S.; Trayhurn, P. Dysregulation of the Expression and Secretion of Inflammation-Related Adipokines by Hypoxia in Human Adipocytes. Pflug. Arch-Eur. J. Physiol. 2007, 455, 479–492. [Google Scholar] [CrossRef]
- Liddle, D.M.; Kavanagh, M.E.; Wright, A.J.; Robinson, L.E. Apple Flavonols Mitigate Adipocyte Inflammation and Promote Angiogenic Factors in LPS- and Cobalt Chloride-Stimulated Adipocytes, in Part by a Peroxisome Proliferator-Activated Receptor-γ-Dependent Mechanism. Nutrients 2020, 12, 1386. [Google Scholar] [CrossRef]
- Boer, A.A.D.; Monk, J.M.; Robinson, L.E. Docosahexaenoic Acid Decreases Pro-Inflammatory Mediators in an In Vitro Murine Adipocyte Macrophage Co-Culture Model. PLoS ONE 2014, 9, e85037. [Google Scholar] [CrossRef]
- González-Muniesa, P.; de Oliveira, C.; Pérez de Heredia, F.; Thompson, M.P.; Trayhurn, P. Fatty Acids and Hypoxia Stimulate the Expression and Secretion of the Adipokine ANGPTL4 (Angiopoietin-like Protein 4/Fasting-Induced Adipose Factor) by Human Adipocytes. J. Nutr. Nutr. 2011, 4, 146–153. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Autieri, M.V.; Scalia, R. Adipose Tissue Inflammation and Metabolic Dysfunction in Obesity. Am. J. Physiol.-Cell Physiol. 2021, 320, C375–C391. [Google Scholar] [CrossRef] [PubMed]
- Maruta, H.; Yoshimura, Y.; Araki, A.; Kimoto, M.; Takahashi, Y.; Yamashita, H. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells. PLoS ONE 2016, 11, e0158055. [Google Scholar] [CrossRef] [PubMed]
- Maruta, H.; Yamashita, H. Acetic Acid Stimulates G-Protein-Coupled Receptor GPR43 and Induces Intracellular Calcium Influx in L6 Myotube Cells. PLoS ONE 2020, 15, e0239428. [Google Scholar] [CrossRef]
- Tilves, C.; Yeh, H.; Maruthur, N.; Juraschek, S.P.; Miller, E.; White, K.; Appel, L.J.; Mueller, N.T. Increases in Circulating and Fecal Butyrate Are Associated With Reduced Blood Pressure and Hypertension: Results From the SPIRIT Trial. J. Am. Heart Assoc. 2022, 11, e024763. [Google Scholar] [CrossRef]
- Stachowska, E.; Maciejewska-Markiewicz, D.; Palma, J.; Mielko, K.A.; Qasem, B.; Kozłowska-Petriczko, K.; Ufnal, M.; Sokolowska, K.E.; Hawryłkowicz, V.; Załęska, P.; et al. Precision Nutrition in NAFLD: Effects of a High-Fiber Intervention on the Serum Metabolome of NAFD Patients—A Pilot Study. Nutrients 2022, 14, 5355. [Google Scholar] [CrossRef]
- Blachier, F.; Beaumont, M.; Portune, K.J.; Steuer, N.; Lan, A.; Audebert, M.; Khodorova, N.; Andriamihaja, M.; Airinei, G.; Benamouzig, R.; et al. High-Protein Diets for Weight Management: Interactions with the Intestinal Microbiota and Consequences for Gut Health. A Position Paper by the My New Gut Study Group. Clin. Nutr. 2019, 38, 1012–1022. [Google Scholar] [CrossRef]
- Liu, Y.; Zhang, C.; Zhang, Y.; Jiang, X.; Liang, Y.; Wang, H.; Li, Y.; Sun, G. Association between Excessive Dietary Branched-Chain Amino Acids Intake and Hypertension Risk in Chinese Population. Nutrients 2022, 14, 2582. [Google Scholar] [CrossRef]
- Hutson, S.M.; Sweatt, A.J.; LaNoue, K.F. Branched-Chain Amino Acid Metabolism: Implications for Establishing Safe Intakes12. J. Nutr. 2005, 135, 1557S–1564S. [Google Scholar] [CrossRef]
- Rogero, M.M.; Calder, P.C. Obesity, Inflammation, Toll-Like Receptor 4 and Fatty Acids. Nutrients 2018, 10, 432. [Google Scholar] [CrossRef]
- Kolb, H. Obese Visceral Fat Tissue Inflammation: From Protective to Detrimental? BMC Med. 2022, 20, 494. [Google Scholar] [CrossRef] [PubMed]
- Al-Mansoori, L.; Al-Jaber, H.; Prince, M.S.; Elrayess, M.A. Role of Inflammatory Cytokines, Growth Factors and Adipokines in Adipogenesis and Insulin Resistance. Inflammation 2022, 45, 31–44. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.S.; Kim, J.; Osborne, O.; Oh, D.Y.; Sasik, R.; Schenk, S.; Chen, A.; Chung, H.; Murphy, A.; Watkins, S.M.; et al. Increased Adipocyte O2 Consumption Triggers HIF-1α, Causing Inflammation and Insulin Resistance in Obesity. Cell 2014, 157, 1339–1352. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
Rplpo | ACTGGTCTAGGACCCGAGAAG | TCCCACCTTGTCTCCAGTCT |
Hif1a | AGGCTGGGAAAAGTTAGGAGTG | GGCAGCGATGACACAGAAAC |
Angptl4 | AGAAAACATGGGCTCGAGGG | TGGGAACCACAGTTAGCACC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alzubi, A.; Monk, J.M. Effect of Comparable Carbon Chain Length Short- and Branched-Chain Fatty Acids on Adipokine Secretion from Normoxic and Hypoxic Lipopolysaccharide-Stimulated 3T3-L1 Adipocytes. Biomedicines 2024, 12, 2621. https://doi.org/10.3390/biomedicines12112621
Alzubi A, Monk JM. Effect of Comparable Carbon Chain Length Short- and Branched-Chain Fatty Acids on Adipokine Secretion from Normoxic and Hypoxic Lipopolysaccharide-Stimulated 3T3-L1 Adipocytes. Biomedicines. 2024; 12(11):2621. https://doi.org/10.3390/biomedicines12112621
Chicago/Turabian StyleAlzubi, Ala, and Jennifer M. Monk. 2024. "Effect of Comparable Carbon Chain Length Short- and Branched-Chain Fatty Acids on Adipokine Secretion from Normoxic and Hypoxic Lipopolysaccharide-Stimulated 3T3-L1 Adipocytes" Biomedicines 12, no. 11: 2621. https://doi.org/10.3390/biomedicines12112621
APA StyleAlzubi, A., & Monk, J. M. (2024). Effect of Comparable Carbon Chain Length Short- and Branched-Chain Fatty Acids on Adipokine Secretion from Normoxic and Hypoxic Lipopolysaccharide-Stimulated 3T3-L1 Adipocytes. Biomedicines, 12(11), 2621. https://doi.org/10.3390/biomedicines12112621