Enhancing the Anticancer and Anti-Inflammatory Properties of Curcumin in Combination with Quercetin, for the Prevention and Treatment of Prostate Cancer
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Cultures and Treatments
2.2. Preparation of Curcumin and Quercetin Stock Solution
2.3. Cell Viability Assay
2.4. Cell Cycle Analysis
2.5. Reactive Oxygen Species (ROS) Production Assay
2.6. Tunel Assay
2.7. Inhibition of Nitric Oxide (NO) Production in Lipopolysaccharide (LPS)-Stimulated RAW 264.7 Cells
2.8. RNA Extraction, cDNA Synthesis, and qRT-PCR
- IL-6:
- -
- Fw: CTGCAAGAGACTTCCATCCAG
- -
- Rv: AGTGGTATAGACAGGTCTGTTGG
- IL-1β:
- -
- Fw: GAAATGCCACCTTTTGACAGTG
- -
- Rv: TGGATGCTCTCATCAGGACAG
- TNF-α:
- -
- Fw: CAGGCGGTGCCTATGTCTC
- -
- Rv: CGATCACCCCGAAGTTCAGTAG
- GAPDH
- -
- Fw: ACCACAGTCCATGCCATCAC
- -
- Rv: TCCACCACCCTGTTGCTGTA
2.9. Statistical Analysis
3. Results and Discussion
3.1. Curcumin in Combination with Quercetin Increases its Antiproliferative Effects in Prostate Cancer Cell Line
3.2. Curcumin and Quercetin Induce Cell Cycle Arrest
3.3. Curcumin and Quercetin Induce Cell Death by Activation of Apoptotic Pathways
3.4. The Combination Treatment Induces ROS Levels
3.5. Effects of Curcumin and Quercetin on Nitric Oxide Production in LPS-Activated RAW 264.7 Macrophages
3.6. Curcumin and Quercetin Modulate Pro-Inflammatory Cytokines
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Fuchs, H.E.; Jemal, A. Cancer statistics, 2022. CA Cancer J. Clin. 2022, 72, 7–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kimura, T.; Egawa, S. Epidemiology of prostate cancer in Asian countries. Int. J. Urol. 2018, 25, 524–531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsing, A.W.; Tsao, L.; Devesa, S.S. International trends and patterns of prostate cancer incidence and mortality. Int. J. Cancer 2000, 85, 60–67. [Google Scholar] [CrossRef]
- Mantovani, A.; Barajon, I.; Garlanda, C. IL-1 and IL-1 regulatory pathways in cancer progression and therapy. Immunol. Rev. 2018, 281, 57–61. [Google Scholar] [CrossRef] [Scilit]
- Galdiero, M.R.; Marone, G.; Mantovani, A. Cancer Inflammation and Cytokines. Cold Spring Harb. Perspect. Biol. 2018, 10, a028662. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coussens, L.M.; Werb, Z. Inflammation and cancer. Nature 2002, 420, 860–867. [Google Scholar] [CrossRef] [Scilit]
- Bevacqua, E.; Ammirato, S.; Cione, E.; Curcio, R.; Dolce, V.; Tucci, P. The Potential of MicroRNAs as Non-Invasive Prostate Cancer Biomarkers: A Systematic Literature Review Based on a Machine Learning Approach. Cancers 2022, 14, 5418. [Google Scholar] [CrossRef] [Scilit]
- Kim, W.Y.; Whang, Y.E.; Pruthi, R.S.; Baggstrom, M.Q.; Rathmell, W.K.; Rosenman, J.G.; Wallen, E.M.; Goyal, L.K.; Grigson, G.; Watkins, C.; et al. Neoadjuvant docetaxel/estramustine prior to radical prostatectomy or external beam radiotherapy in high risk localized prostate cancer: A phase II trial. Urol. Oncol. 2011, 29, 608–613. [Google Scholar] [CrossRef] [Scilit]
- Abd Wahab, N.A.; Lajis, N.H.; Abas, F.; Othman, I.; Naidu, R. Mechanism of Anti-Cancer Activity of Curcumin on Androgen-Dependent and Androgen-Independent Prostate Cancer. Nutrients 2020, 12, 679. [Google Scholar] [CrossRef] [Scilit]
- Mosillo, C.; Iacovelli, R.; Ciccarese, C.; Fantinel, E.; Bimbatti, D.; Brunelli, M.; Bisogno, I.; Kinspergher, S.; Buttigliero, C.; Tucci, M.; et al. De novo metastatic castration sensitive prostate cancer: State of art and future perspectives. Cancer Treat. Rev. 2018, 70, 67–74. [Google Scholar] [CrossRef] [Scilit]
- Barry, M.J.; Simmons, L.H. Prevention of Prostate Cancer Morbidity and Mortality: Primary Prevention and Early Detection. Med. Clin. N. Am. 2017, 101, 787–806. [Google Scholar] [CrossRef] [Scilit]
- Klein, E.A. Can prostate cancer be prevented? Nat. Clin. Pract. Urol. 2005, 2, 24–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hazafa, A.; Rehman, K.U.; Jahan, N.; Jabeen, Z. The Role of Polyphenol (Flavonoids) Compounds in the Treatment of Cancer Cells. Nutr. Cancer 2020, 72, 386–397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deepika; Maurya, P.K. Health Benefits of Quercetin in Age-Related Diseases. Molecules 2022, 27, 2498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akbari, B.; Baghaei-Yazdi, N.; Bahmaie, M.; Mahdavi Abhari, F. The role of plant-derived natural antioxidants in reduction of oxidative stress. Biofactors 2022, 48, 611–633. [Google Scholar] [CrossRef] [Scilit]
- Loeb, S.; Fu, B.C.; Bauer, S.R.; Pernar, C.H.; Chan, J.M.; Van Blarigan, E.L.; Giovannucci, E.L.; Kenfield, S.A.; Mucci, L.A. Association of plant-based diet index with prostate cancer risk. Am. J. Clin. Nutr. 2022, 115, 662–670. [Google Scholar] [CrossRef] [Scilit]
- Kabir, M.T.; Rahman, M.H.; Akter, R.; Behl, T.; Kaushik, D.; Mittal, V.; Pandey, P.; Akhtar, M.F.; Saleem, A.; Albadrani, G.M.; et al. Potential Role of Curcumin and Its Nanoformulations to Treat Various Types of Cancers. Biomolecules 2021, 11, 392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pricci, M.; Girardi, B.; Giorgio, F.; Losurdo, G.; Ierardi, E.; Di Leo, A. Curcumin and Colorectal Cancer: From Basic to Clinical Evidences. Int. J. Mol. Sci. 2020, 21, 2364. [Google Scholar] [CrossRef] [Scilit]
- Yang, Z.J.; Huang, S.Y.; Zhou, D.D.; Xiong, R.G.; Zhao, C.N.; Fang, A.P.; Zhang, Y.J.; Li, H.B.; Zhu, H.L. Effects and Mechanisms of Curcumin for the Prevention and Management of Cancers: An Updated Review. Antioxidants 2022, 11, 1481. [Google Scholar] [CrossRef] [Scilit]
- Boccellino, M.; Ambrosio, P.; Ballini, A.; De Vito, D.; Scacco, S.; Cantore, S.; Feola, A.; Di Donato, M.; Quagliuolo, L.; Sciarra, A.; et al. The Role of Curcumin in Prostate Cancer Cells and Derived Spheroids. Cancers 2022, 14, 3348. [Google Scholar] [CrossRef] [Scilit]
- Bevacqua, E.; Curcio, M.; Saletta, F.; Vittorio, O.; Cirillo, G.; Tucci, P. Dextran-Curcumin Nanosystems Inhibit Cell Growth and Migration Regulating the Epithelial to Mesenchymal Transition in Prostate Cancer Cells. Int. J. Mol. Sci. 2021, 22, 7013. [Google Scholar] [CrossRef] [Scilit]
- Termini, D.; Den Hartogh, D.J.; Jaglanian, A.; Tsiani, E. Curcumin against Prostate Cancer: Current Evidence. Biomolecules 2020, 10, 1536. [Google Scholar] [CrossRef] [Scilit]
- Shankar, S.; Srivastava, R.K. Involvement of Bcl-2 family members, phosphatidylinositol 3 ‘-kinase/AKT and mitochondrial p53 in curcumin (diferulolylmethane)-induced apoptosis in prostate cancer. Int. J. Oncol. 2007, 30, 905–918. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dorai, T.; Gehani, N.; Katz, A. Therapeutic potential of curcumin in human prostate cancer—I. curcumin induces apoptosis in both androgen-dependent and androgen-independent prostate cancer cells. Prostate Cancer Prostatic Dis. 2000, 3, 84–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mukhopadhyay, A.; Bueso-Ramos, C.; Chatterjee, D.; Pantazis, P.; Aggarwal, B.B. Curcumin downregulates cell survival mechanisms in human prostate cancer cell lines. Oncogene 2001, 20, 7597–7609. [Google Scholar] [CrossRef] [Scilit]
- Teiten, M.H.; Gaascht, F.; Cronauer, M.; Henry, E.; Dicato, M.; Diederich, M. Anti-proliferative potential of curcumin in androgen-dependent prostate cancer cells occurs through modulation of the Wingless signaling pathway. Int. J. Oncol. 2011, 38, 603–611. [Google Scholar] [CrossRef] [Scilit]
- Srivastava, R.K.; Chen, Q.H.; Siddiqui, I.; Sarva, K.; Shankar, S. Linkage of curcumin-induced cell cycle arrest and apoptosis by cyclin-dependent kinase inhibitor p21(/WAF1/CIP1). Cell Cycle 2007, 6, 2953–2961. [Google Scholar] [CrossRef] [Scilit]
- Deeb, D.; Xu, Y.X.; Jiang, H.; Gao, X.H.; Janakiraman, N.; Chapman, R.A.; Gautam, S.C. Curcumin (diferuloyl-methane) enhances tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis in LNCaP prostate cancer cells. Mol. Cancer Ther. 2003, 2, 95–103. [Google Scholar] [PubMed]
- Curcio, M.; Cirillo, G.; Tucci, P.; Farfalla, A.F.; Bevacqua, E.; Vittorio, O.; Iemma, F.; Nicoletta, F.P. Dextran-Curcumin nanoparticles as methotrexate delivery vehicle: A step forward in breast cancer combination therapy. Pharmaceuticals. 2020, 13, 2. [Google Scholar] [CrossRef] [Scilit]
- Feng, T.; Wei, Y.; Lee, R.J.; Zhao, L. Liposomal curcumin and its application in cancer. Int J Nanomedicine. 2017, 12, 6027–6044. [Google Scholar] [CrossRef] [Scilit]
- Yang, F.; Song, L.; Wang, H.; Wang, J.; Xu, Z.; Xing, N. Quercetin in prostate cancer: Chemotherapeutic and chemopreventive effects, mechanisms and clinical application potential (Review). Oncol. Rep. 2015, 33, 2659–2668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wach, A.; Pyrzyńska, K.; Biesaga, M. Quercetin content in some food and herbal samples. Food Chem. 2007, 100, 699–704. [Google Scholar] [CrossRef] [Scilit]
- Rauf, A.; Imran, M.; Khan, I.A.; Mujeeb-ur-Rehman; Gilani, S.A.; Mehmood, Z.; Mubarak, M.S. Anticancer potential of quercetin: A comprehensive review. Phytother. Res. 2018, 32, 2109–2130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghafouri-Fard, S.; Shabestari, F.A.; Vaezi, S.; Abak, A.; Shoorei, H.; Karimi, A.; Taheri, M.; Basiri, A. Emerging impact of quercetin in the treatment of prostate cancer. Biomed. Pharmacother. 2021, 138, 111548. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.H.; Sun, N.; Mo, N.; Lu, S.; Song, E.; Ren, C.C.; Li, Z.Z. Quercetin inhibits kidney fibrosis and the epithelial to mesenchymal transition of the renal tubular system involving suppression of the Sonic Hedgehog signaling pathway. Food Funct. 2019, 10, 3782–3797. [Google Scholar] [CrossRef] [Scilit]
- Sundaram, M.K.; Raina, R.; Afroze, N.; Bajbouj, K.; Hamad, M.; Haque, S.; Hussain, A. Quercetin modulates signaling pathways and induces apoptosis in cervical cancer cells. Biosci. Rep. 2019, 39, BSR20190720. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jeong, J.H.; An, J.Y.; Kwon, Y.T.; Rhee, J.G.; Lee, Y.J. Effects of Low Dose Quercetin: Cancer Cell-Specific Inhibition of Cell Cycle Progression. J. Cell Biochem. 2009, 106, 73–82. [Google Scholar] [CrossRef] [Scilit]
- Hegde, M.; Girisa, S.; BharathwajChetty, B.; Vishwa, R.; Kunnumakkara, A.B. Curcumin Formulations for Better Bioavailability: What We Learned from Clinical Trials Thus Far? ACS Omega 2023, 8, 10713–10746. [Google Scholar] [CrossRef] [Scilit]
- Sabet, S.; Rashidinejad, A.; Melton, L.D.; McGillivray, D.J. Recent advances to improve curcumin oral bioavailability. Trends Food Sci. Tech. 2021, 110, 253–266. [Google Scholar] [CrossRef] [Scilit]
- McClements, D.J. Advances in nanoparticle and microparticle delivery systems for increasing the dispersibility, stability, and bioactivity of phytochemicals. Biotechnol. Adv. 2020, 38, 107287. [Google Scholar] [CrossRef] [Scilit]
- Gohlke, A.; Ingelmann, C.J.; Nurnberg, G.; Starke, A.; Wolffram, S.; Metges, C.C. Bioavailability of quercetin from its aglycone and its glucorhamnoside rutin in lactating dairy cows after intraduodenal administration. J. Dairy. Sci. 2013, 96, 2303–2313. [Google Scholar] [CrossRef] [Scilit]
- Almeida, A.F.; Borge, G.I.A.; Piskula, M.; Tudose, A.; Tudoreanu, L.; Valentova, K.; Williamson, G.; Santos, C.N. Bioavailability of Quercetin in Humans with a Focus on Interindividual Variation. Compr. Rev. Food Sci. Food Saf. 2018, 17, 714–731. [Google Scholar] [CrossRef] [Scilit]
- Hollman, P.C.H.; Katan, M.B. Health effects and bioavailability of dietary flavonols. Free. Radic. Res. 1999, 31, S75–S80. [Google Scholar] [CrossRef] [Scilit]
- Cermak, R.; Wolffram, S. The potential of flavonoids to influence drug metabolism and pharmacokinetics by local gastrointestinal mechanisms. Curr. Drug Metab. 2006, 7, 729–744. [Google Scholar] [CrossRef] [Scilit]
- Bhalani, D.V.; Nutan, B.; Kumar, A.; Chandel, A.K.S. Bioavailability Enhancement Techniques for Poorly Aqueous Soluble Drugs and Therapeutics. Biomedicines 2022, 10, 2055. [Google Scholar] [CrossRef] [Scilit]
- Niedzwiecki, A.; Roomi, M.W.; Kalinovsky, T.; Rath, M. Anticancer Efficacy of Polyphenols and Their Combinations. Nutrients 2016, 8, 552. [Google Scholar] [CrossRef] [Scilit]
- Armentano, B.; Curcio, R.; Brindisi, M.; Mancuso, R.; Rago, V.; Ziccarelli, I.; Frattaruolo, L.; Fiorillo, M.; Dolce, V.; Gabriele, B.; et al. 5-(Carbamoylmethylene)-oxazolidin-2-ones as a Promising Class of Heterocycles Inducing Apoptosis Triggered by Increased ROS Levels and Mitochondrial Dysfunction in Breast and Cervical Cancer. Biomedicines 2020, 8, 35. [Google Scholar] [CrossRef] [Scilit]
- Tundis, R.; Frattaruolo, L.; Carullo, G.; Armentano, B.; Badolato, M.; Loizzo, M.R.; Aiello, F.; Cappello, A.R. An ancient remedial repurposing: Synthesis of new pinocembrin fatty acid acyl derivatives as potential antimicrobial/anti-inflammatory agents. Nat. Prod. Res. 2019, 33, 162–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brindisi, M.; Bouzidi, C.; Frattaruolo, L.; Loizzo, M.R.; Cappello, M.S.; Dugay, A.; Deguin, B.; Lauria, G.; Cappello, A.R.; Tundis, R. New Insights into the Antioxidant and Anti-Inflammatory Effects of Italian Salvia officinalis Leaf and Flower Extracts in Lipopolysaccharide and Tumor-Mediated Inflammation Models. Antioxidants 2021, 10, 311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, B.; Ross, S.M.; Trask, O.J.; Carmichael, P.L.; Dent, M.; White, A.; Andersen, M.E.; Clewell, R.A. Assessing dose-dependent differences in DNA-damage, p53 response and genotoxicity for quercetin and curcumin. Toxicol In Vitro 2013, 27, 1877–1887. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mutlu Altundağ, E.; Yılmaz, A.M.; Koçtürk, S.; Taga, Y.; Yalçın, A.S. Synergistic Induction of Apoptosis by Quercetin and Curcumin in Chronic Myeloid Leukemia (K562) Cells. Nutr. Cancer 2018, 70, 97–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chikara, S.; Nagaprashantha, L.D.; Singhal, J.; Horne, D.; Awasthi, S.; Singhal, S.S. Oxidative stress and dietary phytochemicals: Role in cancer chemoprevention and treatment. Cancer Lett. 2018, 413, 122–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Halliwell, B. The antioxidant paradox: Less paradoxical now? Brit J. Clin. Pharmaco 2013, 75, 637–644. [Google Scholar] [CrossRef] [Scilit]
- Koelwyn, G.J.; Wennerberg, E.; Demaria, S.; Jones, L.W. Exercise in Regulation of Inflammation-Immune Axis Function in Cancer Initiation and Progression. Oncology 2015, 29, 908–920, 922. [Google Scholar]
- Dhanasekar, C.; Kalaiselvan, S.; Rasool, M. Morin, a Bioflavonoid Suppresses Monosodium Urate Crystal-Induced Inflammatory Immune Response in RAW 264.7 Macrophages through the Inhibition of Inflammatory Mediators, Intracellular ROS Levels and NF-κB Activation. PLoS ONE 2015, 10, e0145093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stachlewitz, R.; Lohinai, Z.; Virag, L.; Southan, G.J.; Salzman, A.L.; Szabo, C. Role of nitric oxide and peroxynitrite production in the development of inflammatory injury in a rat model of periodontal disease. Portland Press Proc. 2000, 16, 192. [Google Scholar]
- Lee, W.; Ku, S.K.; Bae, J.S. Barrier protective effects of rutin in LPS-induced inflammation in vitro and in vivo. Food Chem. Toxicol. 2012, 50, 3048–3055. [Google Scholar] [CrossRef] [Scilit]
- Nunes, C.D.R.; Barreto Arantes, M.; Menezes de Faria Pereira, S.; Leandro da Cruz, L.; de Souza Passos, M.; Pereira de Moraes, L.; Vieira, I.J.C.; Barros de Oliveira, D. Plants as Sources of Anti-Inflammatory Agents. Molecules 2020, 25, 3726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waltz, P.; Escobar, D.; Botero, A.M.; Zuckerbraun, B.S. Nitrate/Nitrite as Critical Mediators to Limit Oxidative Injury and Inflammation. Antioxid. Redox Signal 2015, 23, 328–339. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Yu, R.; Cai, T.; Chen, Z.; Lan, M.; Zou, T.; Wang, B.; Wang, Q.; Zhao, Y.; Cai, Y. Effects of immune cells and cytokines on inflammation and immunosuppression in the tumor microenvironment. Int. Immunopharmacol. 2020, 88, 106939. [Google Scholar] [CrossRef] [Scilit]
- Santangelo, C.; Vari, R.; Scazzocchio, B.; De Sanctis, P.; Giovannini, C.; D’Archivio, M.; Masella, R. Anti-inflammatory Activity of Extra Virgin Olive Oil Polyphenols: Which Role in the Prevention and Treatment of Immune-Mediated Inflammatory Diseases? Endocr. Metab. Immune Disord. Drug Targets 2018, 18, 36–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, A.; Yan, H.; Han, C.; Wang, W.; Tian, Y.; Chen, X. Polyphenols from blueberries modulate inflammation cytokines in LPS-induced RAW264.7 macrophages. Int. J. Biol. Macromol. 2014, 69, 382–387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cho, S.Y.; Park, S.J.; Kwon, M.J.; Jeong, T.S.; Bok, S.H.; Choi, W.Y.; Jeong, W.I.; Ryu, S.Y.; Do, S.H.; Lee, C.S.; et al. Quercetin suppresses proinflammatory cytokines production through MAP kinases and NF-kappa B pathway in lipopolysaccharide-stimulated macrophage. Mol. Cell Biochem. 2003, 243, 153–160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wadsworth, T.L.; Koop, D.R. Effects of the wine polyphenolics quercetin and resveratrol on pro-inflammatory cytokine expression in RAW 264.7 macrophages. Biochem. Pharmacol. 1999, 57, 941–949. [Google Scholar] [CrossRef] [Scilit]
- Singh, S.; Aggarwal, B.B. Activation of Transcription Factor Nf-Kappa-B Is Suppressed by Curcumin (Diferuloylmethane) (Vol 270, Pg 24995, 1995). J. Biol. Chem. 1995, 270, 30235. [Google Scholar] [CrossRef] [Scilit]
- Chairez-Ramirez, M.H.; de la Cruz-Lopez, K.G.; Garcia-Carranca, A. Polyphenols as Antitumor Agents Targeting Key Players in Cancer-Driving Signaling Pathways. Front. Pharmacol. 2021, 12, 710304. [Google Scholar] [CrossRef] [Scilit]






Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pellegrino, M.; Bevacqua, E.; Frattaruolo, L.; Cappello, A.R.; Aquaro, S.; Tucci, P. Enhancing the Anticancer and Anti-Inflammatory Properties of Curcumin in Combination with Quercetin, for the Prevention and Treatment of Prostate Cancer. Biomedicines 2023, 11, 2023. https://doi.org/10.3390/biomedicines11072023
Pellegrino M, Bevacqua E, Frattaruolo L, Cappello AR, Aquaro S, Tucci P. Enhancing the Anticancer and Anti-Inflammatory Properties of Curcumin in Combination with Quercetin, for the Prevention and Treatment of Prostate Cancer. Biomedicines. 2023; 11(7):2023. https://doi.org/10.3390/biomedicines11072023
Chicago/Turabian StylePellegrino, Michele, Emilia Bevacqua, Luca Frattaruolo, Anna Rita Cappello, Stefano Aquaro, and Paola Tucci. 2023. "Enhancing the Anticancer and Anti-Inflammatory Properties of Curcumin in Combination with Quercetin, for the Prevention and Treatment of Prostate Cancer" Biomedicines 11, no. 7: 2023. https://doi.org/10.3390/biomedicines11072023
APA StylePellegrino, M., Bevacqua, E., Frattaruolo, L., Cappello, A. R., Aquaro, S., & Tucci, P. (2023). Enhancing the Anticancer and Anti-Inflammatory Properties of Curcumin in Combination with Quercetin, for the Prevention and Treatment of Prostate Cancer. Biomedicines, 11(7), 2023. https://doi.org/10.3390/biomedicines11072023

