The Novel MDM4 Inhibitor CEP-1347 Activates the p53 Pathway and Blocks Malignant Meningioma Growth In Vitro and In Vivo
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Antibodies
2.2. Cell Culture
2.3. Western Blot Analysis
2.4. Reverse Transcription (RT)-PCR Analyses
2.5. cDNA Sequencing of p53
2.6. Gene Silencing by siRNA
2.7. Trypan Blue Dye Exclusion Assay
2.8. Propidium Iodide (PI) Incorporation Assay
2.9. Hoechst33342 Staining to Detect Nuclear Condensation
2.10. Colony Formation Assay
2.11. Mouse Study
2.12. Statistical Analysis
3. Results
3.1. CEP-1347 Preferentially Inhibits the Growth of Malignant Meningioma Cells Expressing Wild-Type p53 over Those Expressing a Mutant p53 Protein
3.2. CEP-1347 Reduces the Expression of MDM4 and Activates the p53 Pathway in Malignant Meningioma Cells with Wild-Type p53
3.3. Reductions in MDM4 Expression Levels Activate the p53 Pathway in Malignant Meningioma Cells with Wild-Type p53
3.4. Anti-Tumor Activity of CEP-1347 against Malignant Meningioma In Vivo
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Marosi, C.; Hassler, M.; Roessler, K.; Reni, M.; Sant, M.; Mazza, E.; Vecht, C. Meningioma. Crit. Rev. Oncol. Hematol. 2008, 67, 153–171. [Google Scholar] [CrossRef] [PubMed]
- Ostrom, Q.T.; Price, M.; Neff, C.; Cioffi, G.; Waite, K.A.; Kruchko, C.; Barnholtz-Sloan, J.S. CBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2015-2019. Neuro-Oncology 2022, 24, v1–v95. [Google Scholar] [CrossRef] [PubMed]
- Mawrin, C.; Perry, A. Pathological classification and molecular genetics of meningiomas. J. Neurooncol. 2010, 99, 379–391. [Google Scholar] [CrossRef] [PubMed]
- Wilson, T.A.; Huang, L.; Ramanathan, D.; Lopez-Gonzalez, M.; Pillai, P.; De Los Reyes, K.; Kumal, M.; Boling, W. Review of Atypical and Anaplastic Meningiomas: Classification, Molecular Biology, and Management. Front. Oncol. 2020, 10, 565582. [Google Scholar] [CrossRef] [PubMed]
- Brastianos, P.K.; Galanis, E.; Butowski, N.; Chan, J.W.; Dunn, I.F.; Goldbrunner, R.; Herold-Mende, C.; Ippen, F.M.; Mawrin, C.; McDermott, M.W.; et al. Advances in multidisciplinary therapy for meningiomas. Neuro Oncol. 2019, 21, i18–i31. [Google Scholar] [CrossRef] [PubMed]
- Hwang, K.L.; Hwang, W.L.; Bussiere, M.R.; Shih, H.A. The role of radiotherapy in the management of high-grade meningiomas. Chin. Clin. Oncol. 2017, 6, S5. [Google Scholar] [CrossRef]
- Lynes, J.; Flores-Milan, G.; Rubino, S.; Arrington, J.; Macaulay, R.; Liu, J.K.C.; Beer-Furlan, A.; Tran, N.D.; Vogelbaum, M.A.; Etame, A.B. Molecular determinants of outcomes in meningiomas. Front. Oncol. 2022, 12, 962702. [Google Scholar] [CrossRef]
- Mair, M.J.; Berghoff, A.S.; Brastianos, P.K.; Preusser, M. Emerging systemic treatment options in meningioma. J. Neurooncol. 2023, 161, 245–258. [Google Scholar] [CrossRef]
- Okano, A.; Miyawaki, S.; Teranishi, Y.; Ohara, K.; Hongo, H.; Sakai, Y.; Ishigami, D.; Nakatomi, H.; Saito, N. Advances in Molecular Biological and Translational Studies in World Health Organization Grades 2 and 3 Meningiomas: A Literature Review. Neurol. Med. Chir. 2022, 62, 347–360. [Google Scholar] [CrossRef]
- Patel, B.; Desai, R.; Pugazenthi, S.; Butt, O.H.; Huang, J.; Kim, A.H. Identification and Management of Aggressive Meningiomas. Front. Oncol. 2022, 12, 851758. [Google Scholar] [CrossRef]
- Di Nunno, V.; Giannini, C.; Asioli, S.; Conti, A.; Furtner, J.; Balestrini, D.; Tosoni, A. Diagnostic and Therapeutic Strategy in Anaplastic (Malignant) Meningioma, CNS WHO Grade 3. Cancers 2022, 14, 4689. [Google Scholar] [CrossRef] [PubMed]
- Shahbandi, A.; Shah, D.S.; Hadley, C.C.; Patel, A.J. The Role of Pharmacotherapy in Treatment of Meningioma: A Systematic Review. Cancers 2023, 15, 483. [Google Scholar] [CrossRef] [PubMed]
- Levine, A.J. p53: 800 million years of evolution and 40 years of discovery. Nat. Rev. Cancer 2020, 20, 471–480. [Google Scholar] [CrossRef]
- Joachim, T.; Ram, Z.; Rappaport, Z.H.; Simon, M.; Schramm, J.; Wiestler, O.D.; von Deimling, A. Comparative analysis of the NF2, TP53, PTEN, KRAS, NRAS and HRAS genes in sporadic and radiation-induced human meningiomas. Int. J. Cancer 2001, 94, 218–221. [Google Scholar] [CrossRef]
- Pecina-Slaus, N.; Kafka, A.; Lechpammer, M. Molecular Genetics of Intracranial Meningiomas with Emphasis on Canonical Wnt Signalling. Cancers 2016, 8, 67. [Google Scholar] [CrossRef]
- Aguilar, A.; Wang, S. Therapeutic Strategies to Activate p53. Pharmaceuticals 2022, 16, 24. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Lou, J.; Li, Y.; Zhou, F.; Yan, Z.; Lyu, X.; Zhao, Y. Recent Progress and Clinical Development of Inhibitors that Block MDM4/p53 Protein-Protein Interactions. J. Med. Chem. 2021, 64, 10621–10640. [Google Scholar] [CrossRef]
- Duffy, M.J.; Synnott, N.C.; O’Grady, S.; Crown, J. Targeting p53 for the treatment of cancer. Semin. Cancer Biol. 2022, 79, 58–67. [Google Scholar] [CrossRef]
- Togashi, K.; Okada, M.; Suzuki, S.; Sanomachi, T.; Seino, S.; Yamamoto, M.; Yamashita, H.; Kitanaka, C. Inhibition of Retinoblastoma Cell Growth by CEP1347 Through Activation of the P53 Pathway. Anticancer Res. 2020, 40, 4961–4968. [Google Scholar] [CrossRef]
- Mitobe, Y.; Nakagawa-Saito, Y.; Togashi, K.; Suzuki, S.; Sugai, A.; Matsuda, K.I.; Sonoda, Y.; Kitanaka, C.; Okada, M. CEP-1347 Targets MDM4 Protein Expression to Activate p53 and Inhibit the Growth of Glioma Cells. Anticancer Res. 2022, 42, 4727–4733. [Google Scholar] [CrossRef]
- Okada, M.; Nakagawa-Saito, Y.; Mitobe, Y.; Sugai, A.; Togashi, K.; Suzuki, S.; Kitanaka, C. Inhibition of the Phospholipase Cepsilon-c-Jun N-Terminal Kinase Axis Suppresses Glioma Stem Cell Properties. Int. J. Mol. Sci. 2022, 23, 8785. [Google Scholar] [CrossRef] [PubMed]
- Okada, M.; Suzuki, S.; Togashi, K.; Sugai, A.; Yamamoto, M.; Kitanaka, C. Targeting Folate Metabolism Is Selectively Cytotoxic to Glioma Stem Cells and Effectively Cooperates with Differentiation Therapy to Eliminate Tumor-Initiating Cells in Glioma Xenografts. Int. J. Mol. Sci. 2021, 22, 11633. [Google Scholar] [CrossRef]
- Yamamoto, M.; Sanomachi, T.; Suzuki, S.; Togashi, K.; Sugai, A.; Seino, S.; Sato, A.; Okada, M.; Kitanaka, C. Gemcitabine radiosensitization primes irradiated malignant meningioma cells for senolytic elimination by navitoclax. Neurooncol. Adv. 2021, 3, 148. [Google Scholar] [CrossRef]
- Okada, M.; Takeda, H.; Sakaki, H.; Kuramoto, K.; Suzuki, S.; Sanomachi, T.; Togashi, K.; Seino, S.; Kitanaka, C. Repositioning CEP-1347, a chemical agent originally developed for the treatment of Parkinson’s disease, as an anti-cancer stem cell drug. Oncotarget 2017, 8, 94872–94882. [Google Scholar] [CrossRef]
- Yamamoto, M.; Suzuki, S.; Togashi, K.; Sugai, A.; Okada, M.; Kitanaka, C. Gemcitabine Cooperates with Everolimus to Inhibit the Growth of and Sensitize Malignant Meningioma Cells to Apoptosis Induced by Navitoclax, an Inhibitor of Anti-Apoptotic BCL-2 Family Proteins. Cancers 2022, 14, 1706. [Google Scholar] [CrossRef]
- Faraco, G.; Fossati, S.; Bianchi, M.E.; Patrone, M.; Pedrazzi, M.; Sparatore, B.; Moroni, F.; Chiarugi, A. High mobility group box 1 protein is released by neural cells upon different stresses and worsens ischemic neurodegeneration in vitro and in vivo. J. Neurochem. 2007, 103, 590–603. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Dube, C.; Gibert, M., Jr.; Cruickshanks, N.; Wang, B.; Coughlan, M.; Yang, Y.; Setiady, I.; Deveau, C.; Saoud, K.; et al. The p53 Pathway in Glioblastoma. Cancers 2018, 10, 297. [Google Scholar] [CrossRef] [PubMed]
- McEvoy, J.D.; Dyer, M.A. Genetic and Epigenetic Discoveries in Human Retinoblastoma. Crit. Rev. Oncog. 2015, 20, 217–225. [Google Scholar] [CrossRef]
- Maroney, A.C.; Glicksman, M.A.; Basma, A.N.; Walton, K.M.; Knight, E., Jr.; Murphy, C.A.; Bartlett, B.A.; Finn, J.P.; Angeles, T.; Matsuda, Y.; et al. Motoneuron apoptosis is blocked by CEP-1347 (KT 7515), a novel inhibitor of the JNK signaling pathway. J. Neurosci. 1998, 18, 104–111. [Google Scholar] [CrossRef]
- Maroney, A.C.; Finn, J.P.; Connors, T.J.; Durkin, J.T.; Angeles, T.; Gessner, G.; Xu, Z.; Meyer, S.L.; Savage, M.J.; Greene, L.A.; et al. Cep-1347 (KT7515), a semisynthetic inhibitor of the mixed lineage kinase family. J. Biol. Chem. 2001, 276, 25302–25308. [Google Scholar] [CrossRef]
- Saporito, M.S.; Brown, E.M.; Miller, M.S.; Carswell, S. CEP-1347/KT-7515, an inhibitor of c-jun N-terminal kinase activation, attenuates the 1-methyl-4-phenyl tetrahydropyridine-mediated loss of nigrostriatal dopaminergic neurons In vivo. J. Pharmacol. Exp. Ther. 1999, 288, 421–427. [Google Scholar] [PubMed]
- Saporito, M.S.; Thomas, B.A.; Scott, R.W. MPTP activates c-Jun NH(2)-terminal kinase (JNK) and its upstream regulatory kinase MKK4 in nigrostriatal neurons in vivo. J. Neurochem. 2000, 75, 1200–1208. [Google Scholar] [CrossRef] [PubMed]
- Parkinson Study Group, P.I. Mixed lineage kinase inhibitor CEP-1347 fails to delay disability in early Parkinson disease. Neurology 2007, 69, 1480–1490. [Google Scholar] [CrossRef]
- Carlsen, L.; El-Deiry, W.S. Differential p53-Mediated Cellular Responses to DNA-Damaging Therapeutic Agents. Int. J. Mol. Sci. 2021, 22, 11828. [Google Scholar] [CrossRef] [PubMed]
- Reed, S.M.; Quelle, D.E. p53 Acetylation: Regulation and Consequences. Cancers 2014, 7, 30–69. [Google Scholar] [CrossRef]
- Yun, T.; Yu, K.; Yang, S.; Cui, Y.; Wang, Z.; Ren, H.; Chen, S.; Li, L.; Liu, X.; Fang, M.; et al. Acetylation of p53 Protein at Lysine 120 Up-regulates Apaf-1 Protein and Sensitizes the Mitochondrial Apoptotic Pathway. J. Biol. Chem. 2016, 291, 7386–7395. [Google Scholar] [CrossRef]
- Nair, R.S.; Kumar, S.; Das, S.; Singh, S.K.; Srivastava, P.; Sondarva, G.; Rao, A.; Sinha, S.C.; Xiong, R.; Bloem, L.; et al. TrkA expression directs the anti-neoplastic activity of MLK3 inhibitors in triple-negative breast cancer. Oncogene 2023, 42, 1132–1143. [Google Scholar] [CrossRef]
- Casey, G.; Lo-Hsueh, M.; Lopez, M.E.; Vogelstein, B.; Stanbridge, E.J. Growth suppression of human breast cancer cells by the introduction of a wild-type p53 gene. Oncogene 1991, 6, 1791–1797. [Google Scholar]
- Pomerantz, J.H.; Blau, H.M. Tumor suppressors: Enhancers or suppressors of regeneration? Development 2013, 140, 2502–2512. [Google Scholar] [CrossRef]
- Kim, H.; Kwak, N.J.; Lee, J.Y.; Choi, B.H.; Lim, Y.; Ko, Y.J.; Kim, Y.H.; Huh, P.W.; Lee, K.H.; Rha, H.K.; et al. Merlin neutralizes the inhibitory effect of Mdm2 on p53. J. Biol. Chem. 2004, 279, 7812–7818. [Google Scholar] [CrossRef]
- Ammoun, S.; Schmid, M.C.; Zhou, L.; Hilton, D.A.; Barczyk, M.; Hanemann, C.O. The p53/mouse double minute 2 homolog complex deregulation in merlin-deficient tumours. Mol. Oncol. 2015, 9, 236–248. [Google Scholar] [CrossRef] [PubMed]
- Graillon, T.; Tabouret, E.; Chinot, O. Chemotherapy and targeted therapies for meningiomas: What is the evidence? Curr. Opin. Neurol. 2021, 34, 857–867. [Google Scholar] [CrossRef] [PubMed]
- Berghoff, A.S.; Hielscher, T.; Ricken, G.; Furtner, J.; Schrimpf, D.; Widhalm, G.; Rajky, U.; Marosi, C.; Hainfellner, J.A.; von Deimling, A.; et al. Prognostic impact of genetic alterations and methylation classes in meningioma. Brain Pathol. 2022, 32, e12970. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.Z.; Nassiri, F.; Landry, A.P.; Patil, V.; Liu, J.; Aldape, K.; Gao, A.; Zadeh, G. The multiomic landscape of meningiomas: A review and update. J. Neurooncol. 2023, 161, 405–414. [Google Scholar] [CrossRef] [PubMed]
- Fang, Y.; Liao, G.; Yu, B. Small-molecule MDM2/X inhibitors and PROTAC degraders for cancer therapy: Advances and perspectives. Acta Pharm. Sin. B 2020, 10, 1253–1278. [Google Scholar] [CrossRef] [PubMed]
- Konopleva, M.; Martinelli, G.; Daver, N.; Papayannidis, C.; Wei, A.; Higgins, B.; Ott, M.; Mascarenhas, J.; Andreeff, M. MDM2 inhibition: An important step forward in cancer therapy. Leukemia 2020, 34, 2858–2874. [Google Scholar] [CrossRef] [PubMed]
- Mitobe, Y.; Suzuki, S.; Nakagawa-Saito, Y.; Togashi, K.; Sugai, A.; Sonoda, Y.; Kitanaka, C.; Okada, M. Antagonizing MDM2 overexpression induced by MDM4 inhibitor CEP-1347 effectively reactivates wild-type p53 in malignant brain tumor cells. Cancers 2023. submitted. [Google Scholar]







| Gene Name | Forward | Reverse |
|---|---|---|
| MDM4 | AGGTACGACCAAAACTGCCG | CTGCACTTTGCTTCAGTTGGT |
| MDM2 | GGTGCTGTAACCACCTCACA | TGAGTCCGATGATTCCTGCTG |
| TP53 | ACAACGTTCTGTCCCCCTTG | CTCCGTCATGTGCTGTGACT |
| CDKN1A | GGGATTTCTTCTGTTCAGGCG | TGGTAGAAATCTGTCATGCTGGT |
| PUMA | TACGAGCGGCGGAGACAAG | AGCACAACAGCCTTTCCTGA |
| BAX | CGGGGAGCAGCCCAGA | GGCAGCCCCCAACCAC |
| ACTB | CCCATGCCATCCTGCGTCTG | CGTCATACTCCTGCTTGCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mitobe, Y.; Suzuki, S.; Nakagawa-Saito, Y.; Togashi, K.; Sugai, A.; Sonoda, Y.; Kitanaka, C.; Okada, M. The Novel MDM4 Inhibitor CEP-1347 Activates the p53 Pathway and Blocks Malignant Meningioma Growth In Vitro and In Vivo. Biomedicines 2023, 11, 1967. https://doi.org/10.3390/biomedicines11071967
Mitobe Y, Suzuki S, Nakagawa-Saito Y, Togashi K, Sugai A, Sonoda Y, Kitanaka C, Okada M. The Novel MDM4 Inhibitor CEP-1347 Activates the p53 Pathway and Blocks Malignant Meningioma Growth In Vitro and In Vivo. Biomedicines. 2023; 11(7):1967. https://doi.org/10.3390/biomedicines11071967
Chicago/Turabian StyleMitobe, Yuta, Shuhei Suzuki, Yurika Nakagawa-Saito, Keita Togashi, Asuka Sugai, Yukihiko Sonoda, Chifumi Kitanaka, and Masashi Okada. 2023. "The Novel MDM4 Inhibitor CEP-1347 Activates the p53 Pathway and Blocks Malignant Meningioma Growth In Vitro and In Vivo" Biomedicines 11, no. 7: 1967. https://doi.org/10.3390/biomedicines11071967
APA StyleMitobe, Y., Suzuki, S., Nakagawa-Saito, Y., Togashi, K., Sugai, A., Sonoda, Y., Kitanaka, C., & Okada, M. (2023). The Novel MDM4 Inhibitor CEP-1347 Activates the p53 Pathway and Blocks Malignant Meningioma Growth In Vitro and In Vivo. Biomedicines, 11(7), 1967. https://doi.org/10.3390/biomedicines11071967

