RNA Therapeutics: A Healthcare Paradigm Shift
Abstract
1. Introduction
2. Understanding mRNA
2.1. RNA Modifications
2.2. Self-Amplifying mRNA
2.3. Circular mRNA
2.4. siRNA
2.5. miRNA
2.6. lncRNA
2.7. Antisense RNA
2.8. RNAi
2.9. Aptamers
3. Approved Therapies
3.1. “Biosimilar” mRNA Products
3.2. Synthetic Messenger RNA
3.3. mRNA Construct Design
3.4. Large-Scale mRNA Production
3.4.1. Template DNA Design and Preparation
3.4.2. DNA Template Linearization
- Restriction enzyme digestion: Restriction enzymes, also known as restriction endonucleases, such as XbaI, cleave DNA at specific recognition sites. Selecting a restriction enzyme that recognizes a site within the circular DNA molecule makes it possible to generate linear DNA fragments with defined ends. The choice of restriction enzyme depends on the recognition site sequence and the desired DNA fragment size.
- PCR amplification with primers containing restriction sites: PCR (polymerase chain reaction) can amplify a specific region of the circular DNA using primers containing restriction sites. The resulting PCR product can be digested with the corresponding restriction enzyme to linearize the DNA at the desired site.
- CRISPR-Cas9 cleavage: CRISPR-Cas9 is a powerful gene editing tool that can be used to cleave DNA at specific target sites. By designing guide RNAs (sgRNAs) that target specific sites on the circular DNA, Cas9 nuclease can create double-stranded breaks, resulting in linear DNA fragments when repaired via cellular DNA repair mechanisms.
- Chemical cleavage: Certain chemicals, such as hydroxylamine or osmium tetroxide, can cleave DNA at specific sites, resulting in linear DNA fragments. Chemical cleavage methods are less commonly used than restriction enzyme digestion or CRISPR-Cas9 cleavage, but can be useful in specific situations.
3.5. Final Formulation
3.6. Testing
4. Examples of mRNA Products
5. Perspectives
5.1. Therapeutics vs. Immunization
5.2. Optimization
6. Delivery Systems
6.1. Lipid-Based Delivery
6.2. Nanotechnology
6.3. Cell-Based Delivery
6.4. Extracellular Vesicles
6.5. Biomimetic Delivery
6.6. Tissue Targeting
6.7. Inhalation, Intranasal, and Injection Delivery
6.8. Chronic Dosing
6.9. Intracellular Delivery
6.10. Gene Editing
7. Autoimmune Disorders
- Addison disease
- Alopecia areata
- Alzheimer’s disease
- Ankylosing spondylitis
- Celiac disease
- Dementia
- Dermatomyositis
- Graves’ disease
- Hashimoto’s thyroiditis
- Multiple sclerosis
- Myasthenia gravis
- Parkinson’s disease
- Pemphigus
- Pernicious anemia
- Polymyalgia rheumatica
- Psoriasis
- Reactive arthritis
- Rheumatoid arthritis
- Scleroderma
- Sjögren’s syndrome
- Systemic lupus erythematosus
- Temporal arteritis
- Type I diabetes
- Vasculitis
8. Regulatory Status
9. Conclusions
- Rapid development and manufacturing: the mRNA-based production of therapeutic proteins offers a faster and more efficient approach compared to recombinant technology or in vitro translation. Traditional recombinant technology requires cloning and expression in host cells, which can be time-consuming and complex. In contrast, mRNA technology involves synthesizing mRNA molecules in vitro, and then, introducing them into cells for translation. The procedure of mRNA transfection is quicker and more effective. mRNA is directly transferred to and expressed in the cytoplasm and has a smaller build than plasmid DNA, never crossing the nuclear membrane. This allows for the rapid and scalable production of mRNA, making it an attractive option for producing therapeutic proteins with shorter development timelines. Producing therapeutic proteins necessitates extensive cell culture and time-consuming, protein-specific purification procedures.
- Flexibility and adaptability: mRNA technology offers greater flexibility and adaptability compared to recombinant technology or in vitro translation. mRNA molecules can be easily modified by adding or removing specific sequences, allowing to produce a wide range of therapeutic proteins with different properties. This flexibility makes mRNA technology well-suited to producing complex proteins, including those that are difficult to express using recombinant methods. Additionally, mRNA technology can be easily adapted to produce new proteins in response to changing medical needs, making it a versatile platform for therapeutic protein production.
- Reduced risk of contamination: Unlike recombinant technology, which involves the use of genetically modified organisms (GMOs) for protein production, mRNA technology does not require the use of living cells. This reduces the risk of contamination with unwanted or harmful substances, such as endotoxins or adventitious agents that may be present in cell-based production systems. This makes mRNA technology a safer option for producing therapeutic proteins, with fewer concerns related to safety and regulatory compliance.
- Lower manufacturing costs: mRNA technology has the potential to lower the manufacturing costs associated with producing therapeutic proteins compared to recombinant technology or in vitro translation. Traditional recombinant technology often requires extensive downstream processing steps, such as protein purification and refolding, which can be costly and time-consuming. In contrast, mRNA technology eliminates the need for these labor-intensive steps, as the proteins are produced directly from the mRNA molecules inside the cells. No matter the coding sequence, mRNA is generated in a typical one-vessel reaction utilizing the same procedure [82]. Synthetic mRNA can be created, using mRNA technology, to look like molecules that naturally exist in the cytoplasm of cells and transiently deliver the desired proteins into cells [81,83]. This can result in a more cost-effective production process with reduced manufacturing expenses.
- Enhanced safety profile: mRNA technology offers an improved safety profile compared to traditional recombinant technology or in vitro translation methods. mRNA molecules are non-infectious and do not integrate into the host genome, reducing the risk of unintended genetic modifications or insertional mutagenesis. Additionally, mRNA technology allows for precise control over the expression of therapeutic proteins, reducing the risk of overexpression or off-target effects. Misfolded or poorly changed proteins can have negative effects and can be immunogenic. Plasmid DNA transfection is less effective in dormant cells, and the necessity for a particular promoter and crossing of the nuclear membrane complicates the procedure [84]. This makes the mRNA-based production of therapeutic proteins a safer option with fewer safety concerns.
- Scalability: mRNA technology offers scalability advantages compared to in vitro translation methods. In vitro translation methods can be limited by the availability of appropriate cell-free systems and may have lower yields. In contrast, mRNA technology can be scaled up to meet larger production demands by simply increasing the amount of mRNA synthesized and introduced into cells. The complexity of the protein synthesis process frequently necessitates lengthy development cycles and makes GMP compliance difficult. This scalability makes mRNA technology suitable for the commercial production of therapeutic proteins on a large scale.
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, C.X.; Chen, L.L. Circular RNAs: Characterization, cellular roles, and applications. Cell 2022, 185, 2016–2034, Erratum in Cell 2022, 185, 2390. [Google Scholar] [CrossRef] [PubMed]
- Kolata, G.; Mueller, B. Halting Progress and Happy Accidents: How mRNA Vaccines Were Made. Available online: https://www.nytimes.com/2022/01/15/health/mrna-vaccine.html?smid=li-share (accessed on 15 January 2022).
- Xu, S.; Yang, K.; Li, R.; Zhang, L. mRNA vaccine era—mechanisms, drug platform and clinical prospection. Int. J. Mol. Sci. 2020, 21, 6582. [Google Scholar] [CrossRef] [PubMed]
- Niazi, S. mRNA Therapeutics Fast-to-Market Strategies, 1st ed.; CRC Press: Boca Raton, FL USA, 2023. [Google Scholar]
- Liang, X.; Li, D.; Leng, S.; Zhu, X. RNA-based pharmacotherapy for tumors: From bench to clinic and back. Biomed. Pharmacother. 2020, 125, 109997. [Google Scholar] [CrossRef] [PubMed]
- Davis, F.F.; Allen, F.W. Ribonucleic acids from yeast which contain a fifth nucleotide. J. Biol. Chem. 1957, 227, 907–915. [Google Scholar] [CrossRef] [PubMed]
- Wei, C.M.; Gershowitz, A.; Moss, B. Methylated nucleotides block 5’ terminus of HeLa cell messenger RNA. Cell 1975, 4, 379–386. [Google Scholar] [CrossRef]
- Cohn, W.E. Pseudouridine, a carbon-carbon linked ribonucleoside in ribonucleic acids: Isolation, structure, and chemical characteristics. J. Biol. Chem. 1960, 235, 1488–1498. [Google Scholar] [CrossRef] [PubMed]
- Dubin, D.T.; Taylor, R.H. The methylation state of poly A-containing messenger RNA from cultured hamster cells. Nucleic Acids Res. 1975, 2, 1653–1668. [Google Scholar] [CrossRef] [PubMed]
- Desrosiers, R.; Friderici, K.; Rottman, F. Identification of methylated nucleosides in messenger RNA from Novikoff hepatoma cells. Proc. Natl. Acad. Sci. USA 1974, 71, 3971–3975. [Google Scholar] [CrossRef]
- Karikó, K.; Muramatsu, H.; Welsh, F.A.; Ludwig, J.; Kato, H.; Akira, S.; Weissman, D. Incorporation of pseudour idine into MRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability. Mol. Ther. J. Am. Soc. Gene Ther. 2008, 16, 1833–1840. [Google Scholar] [CrossRef] [PubMed]
- Dolgin, E. CureVac COVID Vaccine Let-Down Spotlights mRNA Design Challenges. Available online: https://www.nature.com/articles/d41586-021-01661-0 (accessed on 18 June 2021).
- Juhling, F.; Morl, M.; Hartmann, R.K.; Sprinzl, M.; Stadler, P.F.; Putz, J. tRNAdb 2009: Compilation of tRNA sequences and tRNA genes. Nucleic Acids Res. 2009, 37, D159–D162. [Google Scholar] [CrossRef]
- Seto, A.G.; Beatty, X.; Lynch, J.M.; Hermreck, M.; Tetzlaff, M.; Duvic, M.; Jackson, A.L. Cobomarsen, an oligonucleotide inhibitor of miR-155, co-ordinately regulates multiple survival pathways to reduce cellular proliferation and survival in cutaneous T-cell lymphoma. Br. J. Haematol. 2018, 183, 428–444. [Google Scholar] [CrossRef] [PubMed]
- Gallant-Behm, C.L.; Piper, J.; Lynch, J.M.; Seto, A.G.; Hong, S.J.; Mustoe, T.A.; Maari, C.; Pestano, L.A.; Dalby, C.M.; Jackson, A.L.; et al. A MicroRNA-29 Mimic (Remlarsen) Represses Extracellular Matrix Expression and Fibroplasia in the Skin. J. Invest. Dermatol. 2019, 139, 1073–1081. [Google Scholar] [CrossRef]
- Zhang, X.; Wang, W.; Zhu, W.; Dong, J.; Cheng, Y.; Yin, Z.; Shen, F. Mechanisms and Functions of Long Non-Coding RNAs at Multiple Regulatory Levels. Int. J. Mol. Sci. 2019, 20, 5573. [Google Scholar] [CrossRef] [PubMed]
- FDA. Development and Licensure of Vaccines to Prevent COVID-19: Guidance for Industry. Available online: https://www.fda.gov/media/139638/download (accessed on 10 April 2023).
- Niazi, S. Biosimilar mRNA Vaccines, Part 1. Regulatory Revolution. Available online: https://www.centerforbiosimilars.com/view/biosimilar-mrna-vaccines-part-1-regulatory-revolution- (accessed on 31 July 2022).
- Li, M.; Wang, Z.; Xie, C.; Xia, X. Advances in mRNA vaccines. Int. Rev. Cell Mol. Biol. 2022, 372, 295–316. [Google Scholar] [CrossRef] [PubMed]
- Bloom, K.; van den Berg, F.; Arbuthnot, P. Self-amplifying RNA vaccines for infectious diseases. Gene Ther. 2021, 28, 117–129. [Google Scholar] [CrossRef]
- Adams, D.; Gonzalez-Duarte, A.; O’Riordan, W.D.; Yang, C.C.; Ueda, M.; Kristen, A.V.; Tournev, I.; Schmidt, H.H.; Coelho, T.; Berk, J.L.; et al. Patisiran, an RNAi Therapeutic, for Hereditary Transthyretin Amyloidosis. N. Engl. J. Med. 2018, 379, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Syed, Y.Y. Givosiran: A Review in Acute Hepatic Porphyria. Drugs 2021, 81, 841–848. [Google Scholar] [CrossRef]
- Chioccioli, M.; Roy, S.; Newell, R.; Pestano, L.; Dickinson, B.; Rigby, K.; Herazo-Maya, J.; Jenkins, G.; Ian, S.; Saini, G.; et al. A lung targeted miR-29 mimic as a therapy for pulmonary fibrosis. EBioMedicine 2022, 85, 104304. [Google Scholar] [CrossRef]
- Gallant-Behm, C.L.; Piper, J.; Dickinson, B.A.; Dalby, C.M.; Pestano, L.A.; Jackson, A.L. A synthetic microRNA-92a inhibitor (MRG-110) accelerates angiogenesis and wound healing in diabetic and nondiabetic wounds. Wound Repair Regen. 2018, 26, 311–323. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.; Zhang, S.; He, J. The Mechanism of Long Non-coding RNA in Cancer Radioresistance/Radiosensitivity: A Systematic Review. Front Pharmacol. 2022, 13, 879704. [Google Scholar] [CrossRef] [PubMed]
- Lan, Z.; Chen, Y.; Jin, J.; Xu, Y.; Zhu, X. Long Non-coding RNA: Insight into Mechanisms of Alzheimer’s Disease. Front Mol. Neurosci. 2022, 14, 821002. [Google Scholar] [CrossRef]
- Niazi, S. Biosimilar mRNA Vaccines, Part 2: Fast-to-Market Approach. Available online: https://www.centerforbiosimilars.com/view/biosimilar-mrna-vaccines-part-2-fast-to-market-approach- (accessed on 7 August 2022).
- Damase, T.R.; Sukhovershin, R.; Boada, C.; Taraballi, F.; Pettigrew, R.I.; Cooke, J.P. The Limitless Future of RNA Therapeutics. Front. Bioeng. Biotechnol. 2021, 9, 628137. [Google Scholar] [CrossRef]
- Gupta, A.; Andresen, J.L.; Manan, R.S.; Langer, R. Nucleic Acid Delivery for Therapeutic Applications. Adv. Drug Deliv. Rev. 2021, 178, 113834. [Google Scholar] [CrossRef]
- Wayment-Steele, H.K.; Kim, D.S.; Choe, C.A.; Nicol, J.J.; Wellington-Oguri, R.; Watkins, A.M.; Sperberg, R.A.P.; Huang, P.; Das, R. Theoretical Basis for Stabilizing Messenger RNA through Secondary Structure Design. Nucleic Acids Res. 2021, 49, 10604–10617. [Google Scholar] [CrossRef]
- Pardi, N.; Muramatsu, H.; Weissman, D.; Karikó, K. In vitro transcription of long RNA containing modified nucleosides. Methods Mol. Biol. 2013, 969, 29–42. [Google Scholar] [PubMed]
- Kallen, K.-J. Theß; AA Development That May Evolve into a Revolution in Medicine: MRNA as the Basis for Novel, Nucleotide Based Vaccines and Drugs. Ther. Adv. Vaccines 2014, 2, 10–31. [Google Scholar]
- PCR Technology-based RNA Manufacturing Equipment. Available online: https://quantoom.com/ (accessed on 10 April 2023).
- Jackson, N.A.C.; Kester, K.E.; Casimiro, D.; Gurunathan, S.; DeRosa, F. The promise of mRNA vaccines: A biotech and industrial perspective. Vaccines 2020, 5, 11. [Google Scholar] [CrossRef] [PubMed]
- Midoux, P.; Pichon, C. Lipid-Based MRNA Vaccine Delivery Systems. Expert Rev. Vaccines 2015, 14, 221–234. [Google Scholar] [CrossRef]
- Shafee, T.; Lowe, R. Eukaryotic and prokaryotic gene structure. WikiJ. Med. 2017, 4, 1–5. [Google Scholar]
- Gallie, D.R. The cap and poly(A) tail function synergistically to regulate mRNA translational efficiency. Genes Dev. 1991, 5, 2108–2116. [Google Scholar] [CrossRef]
- Ross, J.; Sullivan, T.D. Half-lives of beta and gamma globin messenger RNAs and of protein synthetic capacity in cultured human reticulocytes. Blood 1985, 66, 1149–1154. [Google Scholar]
- Holtkamp, S.; Kreiter, S.; Selmi, A.; Simon, P.; Koslowski, M.; Huber, C.; Tureci, O.; Sahin, U. Modification of antigen-encoding RNA increases stability, translational efficacy, and T-cell stimulatory capacity of dendritic cells. Blood 2006, 108, 4009–4017. [Google Scholar] [CrossRef]
- Hia, F.; Yang, S.F.; Shichino, Y.; Yoshinaga, M.; Murakawa, Y.; Vandenbon, A.; Fukao, A.; Fujiwara, T.; Landthaler, M.; Natsume, T.; et al. Codon bias confers stability to human mRNAs. EMBO Rep. 2019, 20, e48220. [Google Scholar] [CrossRef] [PubMed]
- Xiang, K.; Bartel, D.P. The molecular basis of coupling between poly(A)-tail length and translational efficiency. Elife 2021, 10, e66493. [Google Scholar] [CrossRef]
- Karikó, K.; Buckstein, M.; Ni, H.; Weissman, D. Suppression of RNA recognition by Toll-like receptors: The impact of nucleoside modification and the evolutionary origin of RNA. Immunity 2005, 23, 165–175. [Google Scholar]
- Cunningham, P.R.; Ofengand, J. Use of inorganic pyrophosphatase to improve the yield of in vitro transcription reactions catalyzed by T7 RNA polymerase. Biotechniques 1990, 9, 713–714. [Google Scholar]
- Stepinski, J.; Waddell, C.; Stolarski, R.; Darzynkiewicz, E.; Rhoads, R.E. (Synthesis and properties of mRNAs containing the novel “anti-reverse” cap analogs 7- methyl(3′-O-methyl) GpppG and 7-methyl(3′-deoxy) GpppG. RNA 2001, 7, 1486–1495. [Google Scholar] [PubMed]
- Grudzien-Nogalska, E.; Stepinski, J.; Jemielity, J.; Zuberek, J.; Stolarski, R.; Rhoads, R.E.; Darzynkiewicz, E. Synthesis of anti-reverse cap analogs (ARCAs) and their applications in mRNA translation and stability. Methods Enzymol. 2007, 431, 203–227. [Google Scholar] [PubMed]
- Martin, S.; Moss, B.J. Modification of RNA by mRNA guanylyltransferase and mRNA (guanine 7) methyltransferase from vaccinia virions. Bio. Chem. 1975, 250, 9330–9335. [Google Scholar] [CrossRef]
- Malone, R.S.; Felgner, R.W. Verma PLIM Cationic liposome-mediated RNA transfection. Proc. Natl. Acad. Sci. USA 1989, 86, 6077–6081. [Google Scholar] [CrossRef] [PubMed]
- United State Pharmacopoeia. Available online: https://www.usp.org/mrna (accessed on 20 March 2023).
- Sanz, L.; Álvarez-Vallina, L. Engineered mRNA and the Rise of Next-Generation Antibodies. Antibodies 2021, 26, 37. [Google Scholar] [CrossRef]
- Vlatkovic, I. Non-immunotherapy application of LNP-mRNA: Maximizing efficacy and safety. Biomedicines 2021, 9, 530. [Google Scholar] [CrossRef] [PubMed]
- Shi, D.; Beasock, D.; Fessler, A.; Szebeni, J.; Ljubimova, J.Y.; Afonin, K.A.; Dobrovolskaia, M.A. To PEGylate or not to PEGylate: Immunological properties of nanomedicine’s most popular component, polyethylene glycol and its alternatives. Adv. Drug Deliv. Rev. 2022, 180, 114079. [Google Scholar] [CrossRef]
- Dong, Y.; Dorkin, J.R.; Wang, W.; Chang, P.H.; Webber, M.J.; Tang, B.C.; Yang, J.; Abutbul–Ionita, I.; Danino, D.; DeRosa, F.; et al. Poly(glycoamidoamine) brushes formulated nanomaterials for systemic siRNA and mRNA delivery in vivo. Nano Lett. 2016, 16, 842–848. [Google Scholar] [CrossRef]
- Krienke, C.; Kolb, L.; Diken, E.; Streuber, M.; Kirchhoff, S.; Bukur, T.; Akilli-Öztürk, Ö.; Kranz, L.M.; Berger, H.; Petschenka, J.; et al. A noninflammatory mRNA vaccine for treatment of experimental autoimmune encephalomyelitis. Science 2021, 371, 145–153. [Google Scholar] [CrossRef]
- Henderson, J.M.; Ujita, A.; Hill, E.; Yousif-Rosales, S.; Smith, C.; Ko, N.; McReynolds, T.; Cabral, C.R.; Escamilla-Powers, J.R.; Houston, M.E. Cap 1 messenger RNA synthesis with co-transcriptional CleanCap® analog by in vitro transcription. Curr. Protoc. 2021, 1, e39. [Google Scholar] [CrossRef]
- Grier, A.E.; Burleigh, S.; Sahni, J.; Clough, C.A.; Cardot, V.; Choe, D.C.; Krutein, M.C.; Rawlings, D.J.; Scharenberg, A.M.; Jacoby, K. pEVL: A linear plasmid for generating mRNA IVT templates with extended encoded poly(A) sequences. Mol. Ther. Nucleic. Acids 2016, 5, e306. [Google Scholar] [CrossRef]
- Mockey, M.; Gonçalves, C.; Dupuy, F.P.; Lemoine, F.M.; Pichon, C.; Midoux, P. mRNA transfection of dendritic cells: Synergistic effect of ARCA mRNA capping with poly(A) chains in cis and in trans for a high protein expression level. Biochem. Biophys. Res. Commun. 2006, 340, 1062–1068. [Google Scholar] [CrossRef]
- Gebre, M.S.; Rauch, S.; Roth, N.; Yu, J.; Chandrashekar, A.; Mercado, N.B.; He, X.; Liu, J.; Mcmahan, K.; Martinot, A.; et al. Optimization of non-coding regions for a non-modified mRNA COVID-19 vaccine. Nature 2021, 601, 410–414. [Google Scholar] [CrossRef]
- Sultana, N.; Hadas, Y.; Sharkar MT, K.; Kaur, K.; Magadum, A.; Kurian, A.A.; Hossain, N.; Alburquerque, B.; Ahmed, S.; Chepurko, E.; et al. Optimization of 5′ untranslated region of modified mRNA for use in cardiac or hepatic ischemic injury. Mol. Ther. Methods Clin. Dev. 2020, 17, 622–633. [Google Scholar] [CrossRef]
- Cui, L.; Ma, R.; Cai, J.; Guo, C.; Chen, Z.; Yao, L.; Wang, Y.; Fan, R.; Wang, X.; Shi, Y. RNA modifications: Importance in immune cell biology and related diseases. Signal Transduct. Target Ther. 2022, 22, 334. [Google Scholar] [CrossRef]
- Bangham, A.D.; Standish, M.M.; Watkins, J.C. Diffusion of univalent ions across the lamellae of swollen phospholipids. J. Mol. Biol. 1965, 13, 238–252. [Google Scholar] [CrossRef]
- Pardi, N. mRNA innovates the vaccine field. Vaccines 2021, 9, 486. [Google Scholar] [CrossRef]
- Briuglia, M.-L.; Rotella, C.; McFarlane, A.; Lamprou, D.A. Influence of cholesterol on liposome stability and on in vitro drug release. Drug Deliv. Transl. Res. 2015, 5, 231–242. [Google Scholar] [CrossRef]
- Castells, M.C.; Phillips, E.J. Maintaining safety with SARS-CoV-2 vaccines. N. Engl. J. Med. 2021, 384, 643–649. [Google Scholar] [CrossRef]
- Nogueira, S.S.; Schlegel, A.; Maxeiner, K.; Weber, B.; Barz, M.; Schroer, M.A.; Blanchet, C.E.; Svergun, D.I.; Ramishetti, S.; Peer, D.; et al. Polysarcosine-functionalized lipid nanoparticles for therapeutic mRNA delivery. ACS Appl. Nano Mater. 2020, 3, 10634–10645. [Google Scholar] [CrossRef]
- György, B.; Szabó, T.G.; Pásztói, M.; Pál, Z.; Misják, P.; Aradi, B.; László, V.; Pállinger, É.; Pap, E.; Kittel, Á.; et al. Membrane vesicles, current state-of-the-art: Emerging role of extracellular vesicles. Cell. Mol. Life Sci. 2011, 68, 2667–2688. [Google Scholar] [CrossRef]
- Sahoo, S.; Adamiak, M.; Mathiyalagan, P.; Kenneweg, F.; Kafert-Kasting, S.; Thum, T. Therapeutic and diagnostic translation of extracellular vesicles in cardiovascular diseases. Circulation 2021, 143, 1426–1449. [Google Scholar]
- Fang, R.H.; Kroll, A.V.; Gao, W.; Zhang, L. Cell membrane coating nanotechnology. Adv. Mater. 2018, 30, e1706759. [Google Scholar] [CrossRef]
- Sahoo, S.; Adamiak, M.; Mathiyalagan, P.; Kenneweg, F.; Kafert-Kasting, S.; Thum, T. Engineering hybrid exosomes by membrane fusion with liposomes. Sci. Rep. 2016, 6, 21933. [Google Scholar]
- Li, Y.J.; Wu, J.Y.; Liu, J.; Xu, W.; Qiu, X.; Huang, S.; Hu, X.-B.; Xiang, D.-X. Artificial exosomes for translational nanomedicine. J. Nanobiotechnology 2021, 19, 242. [Google Scholar] [CrossRef]
- Grankvist, R.; Jensen-Urstad, M.; Clarke, J.; Lehtinen, M.; Little, P.; Lundberg, N.; Arnberg, F.; Jonsson, S.; Chien, K.R.; Holmin, S. Superselective endovascular tissue access using trans-vessel wall technique: Feasibility study for treatment applications in heart, pancreas and kidney in swine. J. Intern. Med. 2019, 285, 398–406. [Google Scholar] [CrossRef] [PubMed]
- Mali, S. Delivery systems for gene therapy. Indian J. Hum. Genet. 2013, 19, 3–8. [Google Scholar] [CrossRef] [PubMed]
- Merkel, O.M.; Rubinstein, I.; Kissel, T. siRNA delivery to the lung: What’s new? Adv. Drug Deliv. Rev. 2014, 75, 112–128. [Google Scholar] [PubMed]
- Thorne, R.G.; Frey, W.H. Delivery of neurotrophic factors to the central nervous system. Clin. Pharmacokinet. 2001, 40, 907–946. [Google Scholar] [CrossRef]
- Cafuir, L.A.; Kempton, C.L. Current and emerging factor VIII replacement products for hemophilia A. Therapeutic Adv. Hematol. 2017, 8, 303–313. [Google Scholar] [CrossRef]
- Apgar, J.F.; Tang, J.P.; Singh, P.; Balasubramanian, N.; Burke, J.; Hodges, M.R.; Lasaro, M.A.; Lin, L.; Milliard, B.L.; Moore, K.; et al. Quantitative systems pharmacology model of hUGT1A1-modRNA encoding for the UGT1A1 enzyme to treat Crigler–Najjar syndrome type 1. CPT Pharm. Syst. Pharmacol. 2018, 7, 404–412. [Google Scholar] [CrossRef] [PubMed]
- An, D.; Schneller, J.L.; Frassetto, A.; Liang, S.; Zhu, X.; Park, J.S.; Theisen, M.; Hong, S.-J.; Zhou, J.; Rajendran, R.; et al. Systemic messenger RNA therapy as a treatment for methylmalonic acidemia. Cell Rep. 2017, 21, 3548–3558. [Google Scholar] [CrossRef]
- Jiang, L.; Park, J.S.; Yin, L.; Laureano, R.; Jacquinet, E.; Yang, J.; Liang, S.; Frassetto, A.; Zhao, J.; Yan, X.; et al. Dual mRNA therapy restores metabolic function in long-term studies in mice with propionic acidemia. Nat. Commun. 2020, 11, 5339. [Google Scholar] [CrossRef]
- Thess, A.; Grund, S.; Mui, B.L.; Hope, M.J.; Baumhof, P.; Fotin-Mleczek, M.; Schlake, T. Sequence-engineered mRNA without chemical nucleoside modifications enables an effective protein therapy in large animals. Mol. Ther. 2015, 23, 1456–1464. [Google Scholar] [CrossRef]
- Pardi, N.; Secreto, A.J.; Shan, X.; Debonera, F.; Glover, J.; Yi, Y.; Muramatsu, H.; Ni, H.; Mui, B.L.; Ta, Y.K.; et al. Administration of nucleoside-modified mRNA encoding broadly neutralizing antibody protects humanized mice from HIV-1 challenge. Nat. Commun. 2017, 8, 14630. [Google Scholar] [CrossRef] [PubMed]
- FDA. Guidance for Industry: Guidance for Human Somatic Cell Therapy and Gene Therapy; FDA: Silver Spring, MD, USA, 1998. [Google Scholar] [CrossRef]
- Sahin, U.; Karikó, K.; Türeci, Ö. mRNA-based therapeutics—Developing a new class of drugs. Nat. Rev. Drug. Discov. 2014, 13, 759–780. [Google Scholar] [CrossRef] [PubMed]
- European Medicines Agency (EMA). Available online: https://www.ema.europa.eu/en (accessed on 10 April 2023).
- Schlake, T.; Thess, A.; Fotin-Mleczek, M.; Kallen, K.J. Developing mRNA-vaccine technologies. RNA Biol. 2012, 9, 1319–1330. [Google Scholar] [CrossRef] [PubMed]
- Pardi, N.; Hogan, M.J.; Porter, F.W.; Weissman, D. mRNA vaccines–A new era in vaccinology. Nat. Rev. Drug. Discov. 2018, 17, 261–279. [Google Scholar] [CrossRef]
Products | Gene Target | Indication | Administration | Approval Year | Cost (USD/Treatment) |
---|---|---|---|---|---|
ASOs | |||||
Vitravene, fomivirsen (Ionis Pharmaceuticals) | Cytomegalovirus gene (UL123) | Cytomegalovirus infection | Intravitreal | 1998 (withdrawn in 2002/2006) | 10.4 k/year |
Exondys 51, eteplirsen (Sarepta Therapeutics) | Dystrophin (exon 51) | Duchenne muscular dystrophy | Intrathecal | 2016 | 300 k/year |
Tegsedi, inotersen (Ionis Pharmaceuticals) | Transthyretin (TTR) | TTR-mediated amyloidosis | Subcutaneous | 2018 | 450 k/year |
Spinraza, nusinersen (Ionis Pharmaceuticals) | Survival of motor neuron 2 (SMN2) | Spinal muscular atrophy | Intrathecal | 2016 | 750 k/year, 375 k/year |
Kynamro, mipomersen (Ionis Pharmaceuticals) | Apolipoprotein B-100 | Hypercholesterolemia | Subcutaneous | 2013 | 176 k/year |
Waylivra, Volanesoren (Ionis Pharmaceuticals/Akcea) | Apolipoprotein CIII | Familial chylomicronemia syndrome | Subcutaneous | 2019 | 395 k/year |
Vyondys 53, golodirsen (Sarepta Therapeutics) | Dystrophin (exon 53) | Duchenne muscular dystrophy | Subcutaneous | 2019 (confirmatory trial required) | 300 k/year |
Amondys 45, casimersen (Sarepta Therapeutics) | Dystrophin (exon 45) | Duchenne muscular dystrophy | Subcutaneous | 2021 | |
GalNAc-siRNA conjugates | |||||
Givlaari, Givosiran (Alnylam Pharmaceuticals) | ALAS1 | Acute hepatic porphyria | Subcutaneous | 2019 | 575 k/year |
Leqvio, inclisiran (Novartis/Alnylam Pharmaceuticals) | PCSK9 | Hypercholesterolemia | Subcutaneous | 2020 | |
Oxlumo, lumasiran (Alnylam Pharmaceuticals) | Glycolate oxidase | Primary hyperoxaluria type 1 | Subcutaneous | 2020 | 493 k/year |
LNP-RNA | |||||
Onpattro, patisiran (Alnylam Pharmaceuticals) | TTR siRNA | TTR-mediated amyloidosis | Intravenous | 2018 | 450 k/year |
Comirnaty, tozinameran (BioNTech/Pfizer) | SARS-CoV-2 spike protein mRNA | COVID-19 (FDA, emergency use; Switzerland, full approval) | Intramuscular | 2020 | 30−40/dose |
mRNA-1273 (Moderna/NIAID/BARDA) | SARS-CoV-2 spike protein mRNA | COVID-19 (FDA, emergency use) | Intramuscular | 2020 | 30−36/dose |
AAV vectors | |||||
Glybera, alipogene tiparvovec (uniQure) | Lipoprotein lipase (LPL) (AAV1) | LPL deficiency | Intramuscular | 2012 (withdrawn in 2017) | 1 M |
Luxturna, voretigene neparvovec-rzyl (Spark Therapeutics) | RPE65 (AAV2) | Leber congenital amaurosis | Subretinal | 2017 | 850 k |
Zolgensma, onasemnogene abeparvovec (AveXis/Novartis) | SMN1 (AAV9) | Spinal muscular atrophy | Intravenous | 2019 | 2.1 M |
Adenovirus (Ad) vectors | |||||
Vaxzevria, AZD1222, ChAdOx1 nCoV-19 (AstraZeneca) | SARS-CoV-2 spike protein DNA(ChAdOx1) | COVID-19 (FDA, and EMA emergency use) | Intramuscular | 2021 | 4−8/dose |
Ad26.COV2.S (Johnson & Johnson) | SARS-CoV-2 spike protein DNA (Ad26) | COVID-19 (FDA, and EMA emergency use) | Intramuscular | 2021 | 8.5−10/dose |
Convidecia, Ad5-nCoV (CanSinoBIO) | SARS-CoV-2 spike protein DNA (Ad5) | COVID-19 (Approved in China) | Intramuscular | 2021 | 30/dose |
5′UTR cap |
GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGT TCGTGTTCCTGGTGCTGCTGCCTCTGGTGTCCA |
A start codon (Kozak) |
GCAGCCAGTGCGTGAACCTGACCACCCGGACCCAGCTGCCACCAGCCTACACCAACAGCTTCA CCCGGGGCGTCTACTACCCCGACAAGGT |
OPEN READING FRAME. |
3′UTR |
GCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCC ACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCA ATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTT TAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAG CCACACCCTGGAGCTAGCA |
poly(A) chain. |
Category | Tests | ASOs | siRNAs | mRNAs |
---|---|---|---|---|
Active substance | Identification | Duplex melting temperature (UV absorbance) | Circular dichroism | Capillary gel electrophoresis |
FTIR | Duplex melting temperature (UV absorbance) | RT-Sanger sequencing | ||
IP-RPLC-UV-MS | FTIR | RT-PCR | ||
MS-MS | IP-RPLC UV-MS | |||
NMR spectroscopy (1H, 13C and 31P) | MS-MS | |||
X-ray diffraction | NMR spectroscopy (1H, 13C and 31P) | |||
SEC-UV | ||||
UV spectroscopy | ||||
Assay | IP-RPLC-UV-MS | AEX-UV | UV spectroscopy | |
UV spectroscopy | ||||
Impurities | IP-RPLC-UV-MS | AEX -UV | ddPCR | |
IP-RPLC-UV-MS | Immunoblot | |||
SEC-UV | IP-RPLC | |||
2D-LC (AEX -UV (first dimension) and IP-RPLC-MS (second dimension)) | qPCR | |||
Finished medicinal product | Identification | Duplex melting temperature (UV spectroscopy) | AEX-UV | Capillary gel electrophoresis |
IP-RPLC-UV-MS | Duplex melting temperature (UV spectroscopy) | RT-Sanger sequencing | ||
FTIR | ||||
IP-RPLC-UV-MS | ||||
Assay | IP-RPLC-UV-MS | AEX-UV | AEX-UV | |
UV spectroscopy | Fluorescence assay | |||
Impurities | IP-RPLC-UV-MS | AEX-UV | IP-RPLC-UV-MS | |
IP-RPLC-UV-MS |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the author. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Niazi, S.K. RNA Therapeutics: A Healthcare Paradigm Shift. Biomedicines 2023, 11, 1275. https://doi.org/10.3390/biomedicines11051275
Niazi SK. RNA Therapeutics: A Healthcare Paradigm Shift. Biomedicines. 2023; 11(5):1275. https://doi.org/10.3390/biomedicines11051275
Chicago/Turabian StyleNiazi, Sarfaraz K. 2023. "RNA Therapeutics: A Healthcare Paradigm Shift" Biomedicines 11, no. 5: 1275. https://doi.org/10.3390/biomedicines11051275
APA StyleNiazi, S. K. (2023). RNA Therapeutics: A Healthcare Paradigm Shift. Biomedicines, 11(5), 1275. https://doi.org/10.3390/biomedicines11051275