A Novel Benchtop Device for Efficient and Simple Purification of Cytokines, Growth Factors and Stem Cells from Adipose Tissue
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Lipoaspirates Collection
2.3. Mesenchymal Cells Extraction from Adipose Tissue Using IStemRewind
2.4. Mesenchymal Cells Extraction Using Collagenase
2.5. Cell Seeding and Expansion
2.6. Freezing and Thawing
2.7. Flow Cytometry
2.8. Quantification of Growth Factors Content
2.9. ADSCs Differentiation Assays
2.10. RNA Extraction and qRT-PCR
- LEPTIN
- Fw: GTGCGGATTCTTGTGGCTTT
- Rv: GGAATGAAGTCCAAACCGGTG
- FABP4
- Fw: GCCAGGAATTTGACGAAGTCAC
- Rv: TTCTGCACATGTACCAGGACAC
- RUNX2
- Fw: CTCCGGCCCACAAATCTC
- Rv: CACGACAACCGCACCAT
- BGLAP (OSTEOCALCIN)
- Fw: AGCAAAGGTGCAGCCTTTGT
- Rv: GCGCCTGGGTCTTCACT
- β-ACTIN
- Fw: AGAGCTACGACTGCCTGAC
- Rv: GGATGCCACAGGACTCCA.
2.11. Statistical Analysis
3. Results
3.1. Lipoaspirate Processing Using IStemRewind
3.2. Lipoaspirate-Derived Cells Can Be Expanded in Culture
3.3. Lipoaspirate-Derived Isolates Contain Cells with MSCs Markers
3.4. Cells Isolated from Lipoaspirates Can Be Differentiated into Adipocytes and Osteocytes
3.5. IStemRewind Isolates Are Enriched in CD73+ MSCs Compared to MSCs from Enzymatic Dissociation Procedure
3.6. The Total Fraction and Liquid Phase Isolated Using IStemRewind Contain Anti-Inflammatory Cytokines and Growth Factors
3.7. Adipose Tissue Derived Cells Can Be Cryopreserved
4. Discussion
5. Conclusions
6. Patents
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zuk, P.A.; Zhu, M.; Mizuno, H.; Huang, J.; Futrell, J.W.; Katz, A.J.; Benhaim, P.; Lorenz, H.P.; Hedrick, M.H. Multilineage cells from human adipose tissue: Implications for cell-based therapies. Tissue Eng. 2001, 7, 211–228. [Google Scholar] [CrossRef]
- Beltrami, A.P.; Cesselli, D.; Bergamin, N.; Marcon, P.; Rigo, S.; Puppato, E.; D’Aurizio, F.; Verardo, R.; Piazza, S.; Pignatelli, A.; et al. Multipotent cells can be generated in vitro from several adult human organs (heart, liver, and bone marrow). Blood 2007, 110, 3438–3446. [Google Scholar] [CrossRef]
- De Coppi, P.; Bartsch, G., Jr.; Siddiqui, M.M.; Xu, T.; Santos, C.C.; Perin, L.; Mostoslavsky, G.; Serre, A.C.; Snyder, E.Y.; Yoo, J.J.; et al. Isolation of amniotic stem cell lines with potential for therapy. Nat. Biotechnol. 2007, 25, 100–106. [Google Scholar] [CrossRef]
- Erices, A.; Conget, P.; Minguell, J.J. Mesenchymal progenitor cells in human umbilical cord blood. Br. J. Haematol. 2000, 109, 235–242. [Google Scholar] [CrossRef]
- Bressan, E.; Ferroni, L.; Gardin, C.; Pinton, P.; Stellini, E.; Botticelli, D.; Sivolella, S.; Zavan, B. Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds. PLoS ONE 2012, 7, e49146. [Google Scholar] [CrossRef]
- Margiana, R.; Markov, A.; Zekiy, A.O.; Hamza, M.U.; Al-Dabbagh, K.A.; Al-Zubaidi, S.H.; Hameed, N.M.; Ahmad, I.; Sivaraman, R.; Kzar, H.H. Clinical application of mesenchymal stem cell in regenerative medicine: A narrative review. Stem Cell Res. Ther. 2022, 13, 366. [Google Scholar] [CrossRef]
- Jovic, D.; Yu, Y.; Wang, D.; Wang, K.; Li, H.; Xu, F.; Liu, C.; Liu, J.; Luo, Y. A Brief Overview of Global Trends in MSC-Based Cell Therapy. Stem Cell Rev. Rep. 2022, 18, 1525–1545. [Google Scholar] [CrossRef]
- Gerdoni, E.; Gallo, B.; Casazza, S.; Musio, S.; Bonanni, I.; Pedemonte, E.; Mantegazza, R.; Frassoni, F.; Mancardi, G.; Pedotti, R. Mesenchymal stem cells effectively modulate pathogenic immune response in experimental autoimmune encephalomyelitis. Ann. Neurol. Off. J. Am. Neurol. Assoc. Child Neurol. Soc. 2007, 61, 219–227. [Google Scholar] [CrossRef]
- Bonfield, T.L.; Lennon, D.; Ghosh, S.K.; DiMarino, A.M.; Weinberg, A.; Caplan, A.I. Cell based therapy aides in infection and inflammation resolution in the murine model of cystic fibrosis lung disease. Stem Cell Discov. 2013, 3, 139–153. [Google Scholar] [CrossRef]
- Yokota, N.; Yamakawa, M.; Shirata, T.; Kimura, T.; Kaneshima, H. Clinical results following intra-articular injection of adipose-derived stromal vascular fraction cells in patients with osteoarthritis of the knee. Regen. Ther. 2017, 6, 108–112. [Google Scholar] [CrossRef]
- Rodriguez, J.P.; Murphy, M.P.; Hong, S.; Madrigal, M.; March, K.L.; Minev, B.; Harman, R.J.; Chen, C.-S.; Timmons, R.B.; Marleau, A.M. Autologous stromal vascular fraction therapy for rheumatoid arthritis: Rationale and clinical safety. Int. Arch. Med. 2012, 5, 5. [Google Scholar] [CrossRef]
- Merckx, G.; Hosseinkhani, B.; Kuypers, S.; Deville, S.; Irobi, J.; Nelissen, I.; Michiels, L.; Lambrichts, I.; Bronckaers, A. Angiogenic effects of human dental pulp and bone marrow-derived mesenchymal stromal cells and their extracellular vesicles. Cells 2020, 9, 312. [Google Scholar] [CrossRef]
- Qayyum, A.A.; Mathiasen, A.B.; Mygind, N.D.; Kühl, J.T.; Jørgensen, E.; Helqvist, S.; Elberg, J.J.; Kofoed, K.F.; Vejlstrup, N.G.; Fischer-Nielsen, A. Adipose-derived stromal cells for treatment of patients with chronic ischemic heart disease (MyStromalCell trial): A randomized placebo-controlled study. Stem Cells Int. 2017, 2017, 5237063. [Google Scholar] [CrossRef]
- Kastrup, J.; Haack-Sørensen, M.; Juhl, M.; Harary Søndergaard, R.; Follin, B.; Drozd Lund, L.; Mønsted Johansen, E.; Ali Qayyum, A.; Bruun Mathiasen, A.; Jørgensen, E. Cryopreserved off-the-shelf allogeneic adipose-derived stromal cells for therapy in patients with ischemic heart disease and heart failure—A safety study. Stem Cells Transl. Med. 2017, 6, 1963–1971. [Google Scholar] [CrossRef]
- Liang, W.; Chen, X.; Zhang, S.; Fang, J.; Chen, M.; Xu, Y.; Chen, X. Mesenchymal stem cells as a double-edged sword in tumor growth: Focusing on MSC-derived cytokines. Cell. Mol. Biol. Lett. 2021, 26, 3. [Google Scholar] [CrossRef]
- Castro-Oropeza, R.; Vazquez-Santillan, K.; Díaz-Gastelum, C.; Melendez-Zajgla, J.; Zampedri, C.; Ferat-Osorio, E.; Rodríguez-González, A.; Arriaga-Pizano, L.; Maldonado, V. Adipose-derived mesenchymal stem cells promote the malignant phenotype of cervical cancer. Sci. Rep. 2020, 10, 14205. [Google Scholar] [CrossRef]
- Wei, H.-J.; Zeng, R.; Lu, J.-H.; Lai, W.-F.T.; Chen, W.-H.; Liu, H.-Y.; Chang, Y.-T.; Deng, W.-P. Adipose-derived stem cells promote tumor initiation and accelerate tumor growth by interleukin-6 production. Oncotarget 2015, 6, 7713. [Google Scholar] [CrossRef]
- Pilgaard, L.; Lund, P.; Rasmussen, J.G.; Fink, T.; Zachar, V. Comparative analysis of highly defined proteases for the isolation of adipose tissue-derived stem cells. Regen. Med. 2008, 3, 705–715. [Google Scholar] [CrossRef]
- Trivisonno, A.; Alexander, R.W.; Baldari, S.; Cohen, S.R.; Di Rocco, G.; Gentile, P.; Magalon, G.; Magalon, J.; Miller, R.B.; Womack, H.; et al. Intraoperative Strategies for Minimal Manipulation of Autologous Adipose Tissue for Cell- and Tissue-Based Therapies: Concise Review. Stem Cells Transl. Med. 2019, 8, 1265–1271. [Google Scholar] [CrossRef]
- Ye, Y.; Zou, J.; Tan, M.; Hu, K.; Jiang, J. Phenotypic and Cellular Characteristics of a Stromal Vascular Fraction/Extracellular Matrix Gel Prepared Using Mechanical Shear Force on Human Fat. Front. Bioeng. Biotechnol. 2021, 9, 638415. [Google Scholar] [CrossRef]
- Bianchi, F.; Maioli, M.; Leonardi, E.; Olivi, E.; Pasquinelli, G.; Valente, S.; Mendez, A.J.; Ricordi, C.; Raffaini, M.; Tremolada, C.; et al. A new nonenzymatic method and device to obtain a fat tissue derivative highly enriched in pericyte-like elements by mild mechanical forces from human lipoaspirates. Cell Transplant. 2013, 22, 2063–2077. [Google Scholar] [CrossRef]
- Aronowitz, J.A.; Lockhart, R.A.; Hakakian, C.S. Mechanical versus enzymatic isolation of stromal vascular fraction cells from adipose tissue. Springerplus 2015, 4, 713. [Google Scholar] [CrossRef]
- Sanna, M.; Franzin, C.; Pozzobon, M.; Favaretto, F.; Alberto Rossi, C.; Calcagno, A.; Scarda, A.; Dal Pra, C.; Pilon, C.; Milan, G. Adipogenic potential of skeletal muscle satellite cells. Clin. Lipidol. 2009, 4, 245–265. [Google Scholar] [CrossRef]
- Mildmay-White, A.; Khan, W. Cell Surface Markers on Adipose-Derived Stem Cells: A Systematic Review. Curr. Stem Cell Res. 2017, 12, 484–492. [Google Scholar] [CrossRef]
- Sidney, L.E.; Branch, M.J.; Dunphy, S.E.; Dua, H.S.; Hopkinson, A. Concise review: Evidence for CD34 as a common marker for diverse progenitors. Stem Cells 2014, 32, 1380–1389. [Google Scholar] [CrossRef]
- Taghizadeh, R.R.; Cetrulo, K.J.; Cetrulo, C.L. Collagenase Impacts the Quantity and Quality of Native Mesenchymal Stem/Stromal Cells Derived during Processing of Umbilical Cord Tissue. Cell Transplant. 2018, 27, 181–193. [Google Scholar] [CrossRef]
- Tan, K.; Zhu, H.; Zhang, J.; Ouyang, W.; Tang, J.; Zhang, Y.; Qiu, L.; Liu, X.; Ding, Z.; Deng, X. CD73 expression on mesenchymal stem cells dictates the reparative properties via its anti-inflammatory activity. Stem Cells Int. 2019, 2019, 8717694. [Google Scholar] [CrossRef]
- Chrobak, P.; Charlebois, R.; Rejtar, P.; El Bikai, R.; Allard, B.; Stagg, J. CD73 plays a protective role in collagen-induced arthritis. J. Immunol. 2015, 194, 2487–2492. [Google Scholar] [CrossRef]
- Al-Ghadban, S.; Artiles, M.; Bunnell, B.A. Adipose Stem Cells in Regenerative Medicine: Looking Forward. Front. Bioeng. Biotechnol. 2022, 9, 1486. [Google Scholar] [CrossRef]
- Frese, L.; Dijkman, P.E.; Hoerstrup, S.P. Adipose Tissue-Derived Stem Cells in Regenerative Medicine. Transfus. Med. Hemother. 2016, 43, 268–274. [Google Scholar] [CrossRef]
- Trzyna, A.; Banaś-Ząbczyk, A. Adipose-Derived Stem Cells Secretome and Its Potential Application in “Stem Cell-Free Therapy”. Biomolecules 2021, 11, 878. [Google Scholar] [CrossRef] [PubMed]
- Oberbauer, E.; Steffenhagen, C.; Wurzer, C.; Gabriel, C.; Redl, H.; Wolbank, S. Enzymatic and non-enzymatic isolation systems for adipose tissue-derived cells: Current state of the art. Cell Regen. 2015, 4, 7. [Google Scholar] [CrossRef]
- Maumus, M.; Peyrafitte, J.A.; D’Angelo, R.; Fournier-Wirth, C.; Bouloumié, A.; Casteilla, L.; Sengenès, C.; Bourin, P. Native human adipose stromal cells: Localization, morphology and phenotype. Int. J. Obes. 2011, 35, 1141–1153. [Google Scholar] [CrossRef]
- Planat-Benard, V.; Silvestre, J.S.; Cousin, B.; André, M.; Nibbelink, M.; Tamarat, R.; Clergue, M.; Manneville, C.; Saillan-Barreau, C.; Duriez, M.; et al. Plasticity of human adipose lineage cells toward endothelial cells: Physiological and therapeutic perspectives. Circulation 2004, 109, 656–663. [Google Scholar] [CrossRef] [PubMed]
- Suga, H.; Shigeura, T.; Matsumoto, D.; Inoue, K.; Kato, H.; Aoi, N.; Murase, S.; Sato, K.; Gonda, K.; Koshima, I.; et al. Rapid expansion of human adipose-derived stromal cells preserving multipotency. Cytotherapy 2007, 9, 738–745. [Google Scholar] [CrossRef]
- Suto, E.G.; Mabuchi, Y.; Toyota, S.; Taguchi, M.; Naraoka, Y.; Itakura, N.; Matsuoka, Y.; Fujii, Y.; Miyasaka, N.; Akazawa, C. Advantage of fat-derived CD73 positive cells from multiple human tissues, prospective isolated mesenchymal stromal cells. Sci. Rep. 2020, 10, 15073. [Google Scholar] [CrossRef]
- Zhu, X.Y.; Zhang, X.Z.; Xu, L.; Zhong, X.Y.; Ding, Q.; Chen, Y.X. Transplantation of adipose-derived stem cells overexpressing hHGF into cardiac tissue. Biochem. Biophys. Res. Commun. 2009, 379, 1084–1090. [Google Scholar] [CrossRef]
- Mancuso, P.; Bouchard, B. The Impact of Aging on Adipose Function and Adipokine Synthesis. Front. Endocrinol. 2019, 10, 137. [Google Scholar] [CrossRef]
- Dos-Anjos Vilaboa, S.; Navarro-Palou, M.; Llull, R. Age influence on stromal vascular fraction cell yield obtained from human lipoaspirates. Cytotherapy 2014, 16, 1092–1097. [Google Scholar] [CrossRef]







Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Semenzato, M.; Zambello, L.; Fumarola, S.; Motta, E.; Piroli, L.; Scorrano, L.; Bean, C. A Novel Benchtop Device for Efficient and Simple Purification of Cytokines, Growth Factors and Stem Cells from Adipose Tissue. Biomedicines 2023, 11, 1006. https://doi.org/10.3390/biomedicines11041006
Semenzato M, Zambello L, Fumarola S, Motta E, Piroli L, Scorrano L, Bean C. A Novel Benchtop Device for Efficient and Simple Purification of Cytokines, Growth Factors and Stem Cells from Adipose Tissue. Biomedicines. 2023; 11(4):1006. https://doi.org/10.3390/biomedicines11041006
Chicago/Turabian StyleSemenzato, Martina, Ludovica Zambello, Stefania Fumarola, Enrico Motta, Luana Piroli, Luca Scorrano, and Camilla Bean. 2023. "A Novel Benchtop Device for Efficient and Simple Purification of Cytokines, Growth Factors and Stem Cells from Adipose Tissue" Biomedicines 11, no. 4: 1006. https://doi.org/10.3390/biomedicines11041006
APA StyleSemenzato, M., Zambello, L., Fumarola, S., Motta, E., Piroli, L., Scorrano, L., & Bean, C. (2023). A Novel Benchtop Device for Efficient and Simple Purification of Cytokines, Growth Factors and Stem Cells from Adipose Tissue. Biomedicines, 11(4), 1006. https://doi.org/10.3390/biomedicines11041006

