siRNA-Mediated B7H7 Knockdown in Gastric Cancer Lysate-Loaded Dendritic Cells Amplifies Expansion and Cytokine Secretion of Autologous T Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Tumor Cell Culture and Preparation of Tumor Lysate
2.3. Isolation of Peripheral Blood Mononuclear Cells (PBMCs) and DCs Generation
2.4. Characterization of DCs’ Morphology and Phenotype
2.5. siRNA Delivery in DCs by Electroporation and Gene Silencing
2.6. Isolation of Autologous CD3+ T Lymphocytes
2.7. CD3+ T Lymphocytes’ CFSE Labeling and Proliferation Assay
2.8. RNA Extraction and qRT-PCR
2.9. Cytokine Secretion Assay
2.10. Statistical Analysis
3. Results
3.1. Transfection of siRNA Resulted in Diminished B7H7 Molecule’s Gene Expression in DCs
3.2. DCs’ Maturation and Activation Are Augmented by siRNA-Mediated B7H7 Knockdown
3.3. B7H7 siRNA Transfected DCs Showed the Enhanced Capability to Stimulate T-Cell Responses
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Ikenoyama, Y.; Hirasawa, T.; Ishioka, M.; Namikawa, K.; Yoshimizu, S.; Horiuchi, Y.; Ishiyama, A.; Yoshio, T.; Tsuchida, T.; Takeuchi, Y.; et al. Detecting early gastric cancer: Comparison between the diagnostic ability of convolutional neural networks and endoscopists. Dig. Endosc. 2021, 33, 141–150. [Google Scholar] [CrossRef] [PubMed]
- Biagioni, A.; Skalamera, I.; Peri, S.; Schiavone, N.; Cianchi, F.; Giommoni, E.; Magnelli, L.; Papucci, L. Update on gastric cancer treatments and gene therapies. Cancer Metastasis Rev. 2019, 38, 537–548. [Google Scholar] [CrossRef] [PubMed]
- Tao, X.; Cheng, L.; Li, Y.; Ci, H.; Xu, J.; Wu, S.; Tao, Y. Expression of CRYAB with the angiogenesis and poor prognosis for human gastric cancer. Medicine 2019, 98, e17799. [Google Scholar] [CrossRef] [PubMed]
- Ni, L. Advances in Human Dendritic Cell-Based Immunotherapy Against Gastrointestinal Cancer. Front. Immunol. 2022, 13, 887189. [Google Scholar] [CrossRef] [PubMed]
- Kono, K.; Takahashi, A.; Sugai, H.; Fujii, H.; Choudhury, A.R.; Kiessling, R.; Matsumoto, Y. Dendritic cells pulsed with HER-2/neu-derived peptides can induce specific T-cell responses in patients with gastric cancer. Clin. Cancer Res. 2002, 8, 3394–3400. [Google Scholar] [PubMed]
- Schreiber, S.; Hammers, C.M.; Kaasch, A.J.; Schraven, B.; Dudeck, A.; Kahlfuss, S. Metabolic Interdependency of Th2 Cell-Mediated Type 2 Immunity and the Tumor Microenvironment. Front. Immunol. 2021, 12, 632581. [Google Scholar] [CrossRef]
- Kindlund, B.; Sjöling, Å.; Yakkala, C.; Adamsson, J.; Janzon, A.; Hansson, L.E.; Hermansson, M.; Janson, P.; Winqvist, O.; Lundin, S.B. CD4+ regulatory T cells in gastric cancer mucosa are proliferating and express high levels of IL-10 but little TGF-β. Gastric Cancer 2017, 20, 116–125. [Google Scholar] [CrossRef]
- Wu, D.; Wang, Z. Gastric Cancer Cell-Derived Kynurenines Hyperactive Regulatory T Cells to Promote Chemoresistance via the IL-10/STAT3/BCL2 Signaling Pathway. DNA Cell Biol. 2022, 41, 447–455. [Google Scholar] [CrossRef]
- Tewari, M.; Sahai, S.; Mishra, R.R.; Shukla, S.K.; Shukla, H.S. Dendritic cell therapy in advanced gastric cancer: A promising new hope? Surg. Oncol. 2012, 21, 164–171. [Google Scholar] [CrossRef]
- Ni, L.; Chen, J.; Deng, M.; Tang, H.; Bao, M. Editorial: Involvement of dendritic cells in gastrointestinal cancer. Front. Immunol. 2023, 14, 1178075. [Google Scholar] [CrossRef] [PubMed]
- Kohnepoushi, C.; Nejati, V.; Delirezh, N.; Biparva, P. Poly Lactic-co-Glycolic Acid Nanoparticles Containing Human Gastric Tumor Lysates as Antigen Delivery Vehicles for Dendritic Cell-Based Antitumor Immunotherapy. Immunol. Investig. 2019, 48, 794–808. [Google Scholar] [CrossRef]
- Guo, Z.; Yuan, Y.; Chen, C.; Lin, J.; Ma, Q.; Liu, G.; Gao, Y.; Huang, Y.; Chen, L.; Chen, L.Z.; et al. Durable complete response to neoantigen-loaded dendritic-cell vaccine following anti-PD-1 therapy in metastatic gastric cancer. NPJ Precis. Oncol. 2022, 6, 34. [Google Scholar] [CrossRef] [PubMed]
- Bagheri, V.; Abbaszadegan, M.R.; Memar, B.; Motie, M.R.; Asadi, M.; Mahmoudian, R.A.; Gholamin, M. Induction of T cell-mediated immune response by dendritic cells pulsed with mRNA of sphere-forming cells isolated from patients with gastric cancer. Life Sci. 2019, 219, 136–143. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Lu, X.; Cui, P.; Piao, C.; Xiao, M.; Liu, X.; Wang, Y.; Wu, X.; Liu, J.; Yang, L. Phase I/II clinical trial of a Wilms’ tumor 1-targeted dendritic cell vaccination-based immunotherapy in patients with advanced cancer. Cancer Immunol. Immunother. 2019, 68, 121–130. [Google Scholar] [CrossRef] [PubMed]
- Ghorbaninezhad, F.; Asadzadeh, Z.; Masoumi, J.; Mokhtarzadeh, A.; Kazemi, T.; Aghebati-Maleki, L.; Shotorbani, S.S.; Shadbad, M.A.; Baghbanzadeh, A.; Hemmat, N.; et al. Dendritic cell-based cancer immunotherapy in the era of immune checkpoint inhibitors: From bench to bedside. Life Sci. 2022, 297, 120466. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.B.; Fan, Z.Z.; Anton, D.; Vollenhoven, A.V.; Ni, Z.H.; Chen, X.F.; Lefvert, A.K. CTLA4 is expressed on mature dendritic cells derived from human monocytes and influences their maturation and antigen presentation. BMC Immunol. 2011, 12, 21. [Google Scholar] [CrossRef]
- Ge, Y.; Xi, H.; Ju, S.; Zhang, X. Blockade of PD-1/PD-L1 immune checkpoint during DC vaccination induces potent protective immunity against breast cancer in hu-SCID mice. Cancer Lett. 2013, 336, 253–259. [Google Scholar] [CrossRef]
- Chiba, S.; Baghdadi, M.; Akiba, H.; Yoshiyama, H.; Kinoshita, I.; Dosaka-Akita, H.; Fujioka, Y.; Ohba, Y.; Gorman, J.V.; Colgan, J.D.; et al. Tumor-infiltrating DCs suppress nucleic acid-mediated innate immune responses through interactions between the receptor TIM-3 and the alarmin HMGB1. Nat. Immunol. 2012, 13, 832–842. [Google Scholar] [CrossRef]
- Buisson, S.; Triebel, F. LAG-3 (CD223) reduces macrophage and dendritic cell differentiation from monocyte precursors. Immunology 2005, 114, 369–374. [Google Scholar] [CrossRef]
- Xu, W.; Dong, J.; Zheng, Y.; Zhou, J.; Yuan, Y.; Ta, H.M.; Miller, H.E.; Olson, M.; Rajasekaran, K.; Ernstoff, M.S.; et al. Immune-Checkpoint Protein VISTA Regulates Antitumor Immunity by Controlling Myeloid Cell-Mediated Inflammation and Immunosuppression. Cancer Immunol. Res. 2019, 7, 1497–1510. [Google Scholar] [CrossRef] [PubMed]
- Jones, A.; Bourque, J.; Kuehm, L.; Opejin, A.; Teague, R.M.; Gross, C.; Hawiger, D. Immunomodulatory Functions of BTLA and HVEM Govern Induction of Extrathymic Regulatory T Cells and Tolerance by Dendritic Cells. Immunity 2016, 45, 1066–1077. [Google Scholar] [CrossRef] [PubMed]
- Zhao, R.; Chinai, J.M.; Buhl, S.; Scandiuzzi, L.; Ray, A.; Jeon, H.; Ohaegbulam, K.C.; Ghosh, K.; Zhao, A.; Scharff, M.D.; et al. HHLA2 is a member of the B7 family and inhibits human CD4 and CD8 T-cell function. Proc. Natl. Acad. Sci. USA 2013, 110, 9879–9884. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Yao, S.; Iliopoulou, B.P.; Han, X.; Augustine, M.M.; Xu, H.; Phennicie, R.T.; Flies, S.J.; Broadwater, M.; Ruff, W.; et al. B7-H5 costimulates human T cells via CD28H. Nat. Commun. 2013, 4, 2043. [Google Scholar] [CrossRef] [PubMed]
- Janakiram, M.; Chinai, J.M.; Fineberg, S.; Fiser, A.; Montagna, C.; Medavarapu, R.; Castano, E.; Jeon, H.; Ohaegbulam, K.C.; Zhao, R.; et al. Expression, Clinical Significance, and Receptor Identification of the Newest B7 Family Member HHLA2 Protein. Clin. Cancer Res. 2015, 21, 2359–2366. [Google Scholar] [CrossRef] [PubMed]
- Li, D.; Xiang, S.; Shen, J.; Xiao, M.; Zhao, Y.; Wu, X.; Du, F.; Ji, H.; Li, M.; Zhao, Q.; et al. Comprehensive understanding of B7 family in gastric cancer: Expression profile, association with clinicopathological parameters and downstream targets. Int. J. Biol. Sci. 2020, 16, 568–582. [Google Scholar] [CrossRef] [PubMed]
- Wei, L.; Tang, L.; Chang, H.; Huo, S.; Li, Y. HHLA2 overexpression is a novel biomarker of malignant status and poor prognosis in gastric cancer. Hum. Cell 2020, 33, 116–122. [Google Scholar] [CrossRef]
- Su, Q.; Du, J.; Xiong, X.; Xie, X.; Wang, L. B7-H7: A potential target for cancer immunotherapy. Int. Immunopharmacol. 2023, 121, 110403. [Google Scholar] [CrossRef]
- Bolandi, N.; Derakhshani, A.; Hemmat, N.; Baghbanzadeh, A.; Asadzadeh, Z.; Afrashteh Nour, M.; Brunetti, O.; Bernardini, R.; Silvestris, N.; Baradaran, B. The Positive and Negative Immunoregulatory Role of B7 Family: Promising Novel Targets in Gastric Cancer Treatment. Int. J. Mol. Sci. 2021, 22, 10719. [Google Scholar] [CrossRef]
- Luu, K.; Schwarz, H.; Lundqvist, A. B7-H7 Is Inducible on T Cells to Regulate Their Immune Response and Serves as a Marker for Exhaustion. Front. Immunol. 2021, 12, 682627. [Google Scholar] [CrossRef]
- Bhatt, R.S.; Berjis, A.; Konge, J.C.; Mahoney, K.M.; Klee, A.N.; Freeman, S.S.; Chen, C.H.; Jegede, O.A.; Catalano, P.J.; Pignon, J.C.; et al. KIR3DL3 Is an Inhibitory Receptor for HHLA2 that Mediates an Alternative Immunoinhibitory Pathway to PD1. Cancer Immunol. Res. 2021, 9, 156–169. [Google Scholar] [CrossRef] [PubMed]
- Rieder, S.A.; Wang, J.; White, N.; Qadri, A.; Menard, C.; Stephens, G.; Karnell, J.L.; Rudd, C.E.; Kolbeck, R. B7-H7 (HHLA2) inhibits T-cell activation and proliferation in the presence of TCR and CD28 signaling. Cell Mol. Immunol. 2021, 18, 1503–1511. [Google Scholar] [CrossRef] [PubMed]
- Jung, N.C.; Lee, J.H.; Chung, K.H.; Kwak, Y.S.; Lim, D.S. Dendritic Cell-Based Immunotherapy for Solid Tumors. Transl. Oncol. 2018, 11, 686–690. [Google Scholar] [CrossRef] [PubMed]
- Lim, D.S.; Kim, J.H.; Lee, D.S.; Yoon, C.H.; Bae, Y.S. DC immunotherapy is highly effective for the inhibition of tumor metastasis or recurrence, although it is not efficient for the eradication of established solid tumors. Cancer Immunol. Immunother. 2007, 56, 1817–1829. [Google Scholar] [CrossRef] [PubMed]
- Lee, W.C.; Wang, H.C.; Hung, C.F.; Huang, P.F.; Lia, C.R.; Chen, M.F. Vaccination of advanced hepatocellular carcinoma patients with tumor lysate-pulsed dendritic cells: A clinical trial. J. Immunother. 2005, 28, 496–504. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.S.; Liu, G.; Ying, H.; Yong, W.H.; Black, K.L.; Wheeler, C.J. Vaccination with tumor lysate-pulsed dendritic cells elicits antigen-specific, cytotoxic T-cells in patients with malignant glioma. Cancer Res. 2004, 64, 4973–4979. [Google Scholar] [CrossRef] [PubMed]
- Abakushina, E.V.; Popova, L.I.; Zamyatnin, A.A.; Werner, J.; Mikhailovsky, N.V.; Bazhin, A.V. The Advantages and Challenges of Anticancer Dendritic Cell Vaccines and NK Cells in Adoptive Cell Immunotherapy. Vaccines 2021, 9, 1363. [Google Scholar] [CrossRef]
- Zheng, X.; Koropatnick, J.; Chen, D.; Velenosi, T.; Ling, H.; Zhang, X.; Jiang, N.; Navarro, B.; Ichim, T.E.; Urquhart, B.; et al. Silencing IDO in dendritic cells: A novel approach to enhance cancer immunotherapy in a murine breast cancer model. Int. J. Cancer 2013, 132, 967–977. [Google Scholar] [CrossRef]
- Xiong, H.Y.; Ma, T.T.; Wu, B.T.; Lin, Y.; Tu, Z.G. IL-12 regulates B7-H1 expression in ovarian cancer-associated macrophages by effects on NF-κB signalling. Asian Pac. J. Cancer Prev. 2014, 15, 5767–5772. [Google Scholar] [CrossRef]
- Szabo, S.J.; Kim, S.T.; Costa, G.L.; Zhang, X.; Fathman, C.G.; Glimcher, L.H. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 2000, 100, 655–669. [Google Scholar] [CrossRef]
- Yang, R.; Mele, F.; Worley, L.; Langlais, D.; Rosain, J.; Benhsaien, I.; Elarabi, H.; Croft, C.A.; Doisne, J.M.; Zhang, P.; et al. Human T-bet Governs Innate and Innate-like Adaptive IFN-γ Immunity against Mycobacteria. Cell 2020, 183, 1826–1847.e31. [Google Scholar] [CrossRef] [PubMed]
- Hassannia, H.; Chaleshtari, M.G.; Atyabi, F.; Nosouhian, M.; Masjedi, A.; Hojjat-Farsangi, M.; Namdar, A.; Azizi, G.; Mohammadi, H.; Ghalamfarsa, G.; et al. Blockage of immune checkpoint molecules increases T-cell priming potential of dendritic cell vaccine. Immunology 2020, 159, 75–87. [Google Scholar] [CrossRef] [PubMed]
- van der Waart, A.B.; Fredrix, H.; van der Voort, R.; Schaap, N.; Hobo, W.; Dolstra, H. siRNA silencing of PD-1 ligands on dendritic cell vaccines boosts the expansion of minor histocompatibility antigen-specific CD8+ T cells in NOD/SCID/IL2Rg(null) mice. Cancer Immunol. Immunother. 2015, 64, 645–654. [Google Scholar] [CrossRef]
- Hobo, W.; Novobrantseva, T.I.; Fredrix, H.; Wong, J.; Milstein, S.; Epstein-Barash, H.; Liu, J.; Schaap, N.; van der Voort, R.; Dolstra, H. Improving dendritic cell vaccine immunogenicity by silencing PD-1 ligands using siRNA-lipid nanoparticles combined with antigen mRNA electroporation. Cancer Immunol. Immunother. 2013, 62, 285–297. [Google Scholar] [CrossRef] [PubMed]
- Oh, S.A.; Wu, D.C.; Cheung, J.; Navarro, A.; Xiong, H.; Cubas, R.; Totpal, K.; Chiu, H.; Wu, Y.; Comps-Agrar, L.; et al. PD-L1 expression by dendritic cells is a key regulator of T-cell immunity in cancer. Nat. Cancer 2020, 1, 681–691. [Google Scholar] [CrossRef] [PubMed]
- Hobo, W.; Maas, F.; Adisty, N.; de Witte, T.; Schaap, N.; van der Voort, R.; Dolstra, H. siRNA silencing of PD-L1 and PD-L2 on dendritic cells augments expansion and function of minor histocompatibility antigen-specific CD8+ T cells. Blood 2010, 116, 4501–4511. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Zhang, W.; Gui, L.; Yan, X.; Zhou, X.; Ma, Y.; Yang, Z.; Fang, Y.; Zhang, H.; Shi, J. Expression and prognosis of the B7 family in acute myeloid leukemia. Ann. Transl. Med. 2021, 9, 1530. [Google Scholar] [CrossRef]
- Hu, B.; Zhong, L.; Weng, Y.; Peng, L.; Huang, Y.; Zhao, Y.; Liang, X.J. Therapeutic siRNA: State of the art. Signal Transduct. Target. Ther. 2020, 5, 101. [Google Scholar] [CrossRef]
- Sioud, M. RNA and CRISPR interferences: Past, present, and future perspectives. In RNA Interference and CRISPR Technologies: Technical Advances and New Therapeutic Opportunities; Humana: New York, NY, USA, 2020; pp. 1–22. [Google Scholar]
- Bolhassani, A.; Khavari, A.; Orafa, Z. Electroporation-advantages and drawbacks for delivery of drug, gene and vaccine. In Application of Nanotechnology in Drug Delivery; Intech: Rijeka, Croatia, 2014; pp. 369–397. [Google Scholar]
- Zhao, L.; Niu, C.; Shi, X.; Xu, D.; Li, M.; Cui, J.; Li, W.; Xu, J.; Jin, H. Dendritic cells loaded with the lysate of tumor cells infected with Newcastle Disease Virus trigger potent anti-tumor immunity by promoting the secretion of IFN-γ and IL-2 from T cells. Oncol. Lett. 2018, 16, 1180–1188. [Google Scholar] [CrossRef]
- Liu, L.; Liu, Y.; Xia, Y.; Wang, G.; Zhang, X.; Zhang, H.; Xu, Y.; Yuan, Y.; Liu, S.; Wang, Y. Synergistic killing effects of PD-L1-CAR T cells and colorectal cancer stem cell-dendritic cell vaccine-sensitized T cells in ALDH1-positive colorectal cancer stem cells. J. Cancer 2021, 12, 6629–6639. [Google Scholar] [CrossRef]
- Bresser, K.; Kok, L.; Swain, A.C.; King, L.A.; Jacobs, L.; Weber, T.S.; Perié, L.; Duffy, K.R.; de Boer, R.J.; Scheeren, F.A.; et al. Replicative history marks transcriptional and functional disparity in the CD8+ T cell memory pool. Nat. Immunol. 2022, 23, 791–801. [Google Scholar] [CrossRef]
Gene | Sequence | |
---|---|---|
B7H7 siRNA | Sense Antisense | GCCAAGAAACAGCTTCCCATA |
TATGGGAAGCTGTTTCTTGGC | ||
B7H7 | F R | TCAGTCCTTGGATAGTGAGGTTC |
TCAGTCCTTGGATAGTGAGGTTC | ||
TNF-α | F R | TTCTCCTTCCTGATCGTGGCA |
TAGAGAGAGGTCCCTGGGGAA | ||
IL-10 | F R | AGGAAGAGAAACCAGGGAGC |
GAATCCCTCCGAGACACTGG | ||
T-bet | F R | TCTCCTCTCCTACCCAACCAG |
CATGCTGACTGCTCGAAACTCA | ||
FOXP | F R | CAGCCAGTCTATGCAAACC |
GTCTTGTGTCAGTTTGAGGGTC | ||
18S | F R | CTACGTCCCTGCCCTTTGTACA |
ACACTTCACCGGACCATTCAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Masoumi, J.; Ghorbaninezhad, F.; Saeedi, H.; Safaei, S.; Khaze Shahgoli, V.; Ghaffari Jolfayi, A.; Naseri, B.; Baghbanzadeh, A.; Baghbani, E.; Mokhtarzadeh, A.; et al. siRNA-Mediated B7H7 Knockdown in Gastric Cancer Lysate-Loaded Dendritic Cells Amplifies Expansion and Cytokine Secretion of Autologous T Cells. Biomedicines 2023, 11, 3212. https://doi.org/10.3390/biomedicines11123212
Masoumi J, Ghorbaninezhad F, Saeedi H, Safaei S, Khaze Shahgoli V, Ghaffari Jolfayi A, Naseri B, Baghbanzadeh A, Baghbani E, Mokhtarzadeh A, et al. siRNA-Mediated B7H7 Knockdown in Gastric Cancer Lysate-Loaded Dendritic Cells Amplifies Expansion and Cytokine Secretion of Autologous T Cells. Biomedicines. 2023; 11(12):3212. https://doi.org/10.3390/biomedicines11123212
Chicago/Turabian StyleMasoumi, Javad, Farid Ghorbaninezhad, Hossein Saeedi, Sahar Safaei, Vahid Khaze Shahgoli, Amir Ghaffari Jolfayi, Bahar Naseri, Amir Baghbanzadeh, Elham Baghbani, Ahad Mokhtarzadeh, and et al. 2023. "siRNA-Mediated B7H7 Knockdown in Gastric Cancer Lysate-Loaded Dendritic Cells Amplifies Expansion and Cytokine Secretion of Autologous T Cells" Biomedicines 11, no. 12: 3212. https://doi.org/10.3390/biomedicines11123212
APA StyleMasoumi, J., Ghorbaninezhad, F., Saeedi, H., Safaei, S., Khaze Shahgoli, V., Ghaffari Jolfayi, A., Naseri, B., Baghbanzadeh, A., Baghbani, E., Mokhtarzadeh, A., Bakhshivand, M., Javan, M. R., Silvestris, N., & Baradaran, B. (2023). siRNA-Mediated B7H7 Knockdown in Gastric Cancer Lysate-Loaded Dendritic Cells Amplifies Expansion and Cytokine Secretion of Autologous T Cells. Biomedicines, 11(12), 3212. https://doi.org/10.3390/biomedicines11123212