The JAK1/2 Inhibitor Baricitinib Mitigates the Spike-Induced Inflammatory Response of Immune and Endothelial Cells In Vitro
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Models
2.2. Experimental Treatments
2.3. RT-qPCR Analysis
2.4. Cytokine Analysis
2.5. Western Blot Analysis
2.6. Leukocytes Transendothelial Migration
2.7. Statistical Analysis
2.8. Materials
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Genovese, M.C.; Kremer, J.; Zamani, O.; Ludivico, C.; Krogulec, M.; Xie, L.; Beattie, S.D.; Koch, A.E.; Cardillo, T.E.; Rooney, T.P.; et al. Baricitinib in Patients with Refractory Rheumatoid Arthritis. N. Engl. J. Med. 2016, 374, 1243–1252. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Zhou, X.; Qiu, Y.; Song, Y.; Feng, F.; Feng, J.; Song, Q.; Jia, Q.; Wang, J. Clinical characteristics of 82 cases of death from COVID-19. PLoS ONE 2020, 15, e0235458. [Google Scholar] [CrossRef] [PubMed]
- Ye, Q.; Wang, B.; Mao, J. The pathogenesis and treatment of the ‘Cytokine Storm’ in COVID-19. J. Infect. 2020, 80, 607–613. [Google Scholar] [CrossRef] [PubMed]
- Anka, A.U.; Tahir, M.I.; Abubakar, S.D.; Alsabbagh, M.; Zian, Z.; Hamedifar, H.; Sabzevari, A.; Azizi, G. Coronavirus disease 2019 (COVID-19): An overview of the immunopathology, serological diagnosis and management. Scand. J. Immunol. 2021, 93, e12998. [Google Scholar] [CrossRef] [PubMed]
- Mehta, P.; McAuley, D.F.; Brown, M.; Sanchez, E.; Tattersall, R.S.; Manson, J.J.; Hlh Across Speciality Collaboration, U.K. COVID-19: Consider cytokine storm syndromes and immunosuppression. Lancet 2020, 395, 1033–1034. [Google Scholar] [CrossRef]
- Moore, J.B.; June, C.H. Cytokine release syndrome in severe COVID-19. Science 2020, 368, 473–474. [Google Scholar] [CrossRef]
- Ricci, D.; Etna, M.P.; Rizzo, F.; Sandini, S.; Severa, M.; Coccia, E.M. Innate Immune Response to SARS-CoV-2 Infection: From Cells to Soluble Mediators. Int. J. Mol. Sci. 2021, 22, 7017. [Google Scholar] [CrossRef]
- Kosyreva, A.; Dzhalilova, D.; Lokhonina, A.; Vishnyakova, P.; Fatkhudinov, T. The Role of Macrophages in the Pathogenesis of SARS-CoV-2-Associated Acute Respiratory Distress Syndrome. Front. Immunol. 2021, 12, 682871. [Google Scholar] [CrossRef]
- Wang, J.; Yang, X.; Li, Y.; Huang, J.A.; Jiang, J.; Su, N. Specific cytokines in the inflammatory cytokine storm of patients with COVID-19-associated acute respiratory distress syndrome and extrapulmonary multiple-organ dysfunction. Virol. J. 2021, 18, 117. [Google Scholar] [CrossRef]
- Bautista-Vargas, M.; Bonilla-Abadia, F.; Canas, C.A. Potential role for tissue factor in the pathogenesis of hypercoagulability associated with in COVID-19. J. Thromb. Thrombolysis 2020, 50, 479–483. [Google Scholar] [CrossRef]
- Del Valle, D.M.; Kim-Schulze, S.; Huang, H.H.; Beckmann, N.D.; Nirenberg, S.; Wang, B.; Lavin, Y.; Swartz, T.H.; Madduri, D.; Stock, A.; et al. An inflammatory cytokine signature predicts COVID-19 severity and survival. Nat. Med. 2020, 26, 1636–1643. [Google Scholar] [CrossRef] [PubMed]
- Ragab, D.; Salah Eldin, H.; Taeimah, M.; Khattab, R.; Salem, R. The COVID-19 Cytokine Storm; What We Know So Far. Front. Immunol. 2020, 11, 1446. [Google Scholar] [CrossRef] [PubMed]
- Moradian, N.; Gouravani, M.; Salehi, M.A.; Heidari, A.; Shafeghat, M.; Hamblin, M.R.; Rezaei, N. Cytokine release syndrome: Inhibition of pro-inflammatory cytokines as a solution for reducing COVID-19 mortality. Eur. Cytokine Netw. 2020, 31, 81–93. [Google Scholar] [CrossRef] [PubMed]
- Iturricastillo, G.; Perez-Urria, E.A.; Counago, F.; Landete, P. Scientific evidence in the COVID-19 treatment: A comprehensive review. World J. Virol. 2021, 10, 217–228. [Google Scholar] [CrossRef]
- Gordon, A.C.; Mouncey, P.R.; Al-Beidh, F.; Rowan, K.M.; Nichol, A.D.; Arabi, Y.M.; Annane, D.; Beane, A.; van Bentum-Puijk, W.; Berry, L.R.; et al. Interleukin-6 Receptor Antagonists in Critically Ill Patients with Covid-19. N. Engl. J. Med. 2021, 384, 1491–1502. [Google Scholar] [CrossRef]
- Rosas, I.O.; Diaz, G.; Gottlieb, R.L.; Lobo, S.M.; Robinson, P.; Hunter, B.D.; Cavalcante, A.W.; Overcash, J.S.; Hanania, N.A.; Skarbnik, A.; et al. Tocilizumab and remdesivir in hospitalized patients with severe COVID-19 pneumonia: A randomized clinical trial. Intensive Care Med. 2021, 47, 1258–1270. [Google Scholar] [CrossRef]
- Salama, C.; Han, J.; Yau, L.; Reiss, W.G.; Kramer, B.; Neidhart, J.D.; Criner, G.J.; Kaplan-Lewis, E.; Baden, R.; Pandit, L.; et al. Tocilizumab in Patients Hospitalized with Covid-19 Pneumonia. N. Engl. J. Med. 2021, 384, 20–30. [Google Scholar] [CrossRef]
- Salvarani, C.; Dolci, G.; Massari, M.; Merlo, D.F.; Cavuto, S.; Savoldi, L.; Bruzzi, P.; Boni, F.; Braglia, L.; Turra, C.; et al. Effect of Tocilizumab vs Standard Care on Clinical Worsening in Patients Hospitalized With COVID-19 Pneumonia: A Randomized Clinical Trial. JAMA Intern. Med. 2021, 181, 24–31. [Google Scholar] [CrossRef]
- Farahani, M.; Niknam, Z.; Amirabad, L.M.; Amiri-Dashatan, N.; Koushki, M.; Nemati, M.; Pouya, F.D.; Rezaei-Tavirani, M.; Rasmi, Y.; Tayebi, L. Molecular pathways involved in COVID-19 and potential pathway-based therapeutic targets. Biomed. Pharmacother. 2022, 145, 112420. [Google Scholar] [CrossRef]
- Chan, M.; Vijay, S.; McNevin, J.; McElrath, M.J.; Holland, E.C.; Gujral, T.S. Machine learning identifies molecular regulators and therapeutics for targeting SARS-CoV2-induced cytokine release. Mol. Syst. Biol. 2021, 17, e10426. [Google Scholar] [CrossRef]
- Kramer, A.; Prinz, C.; Fichtner, F.; Fischer, A.L.; Thieme, V.; Grundeis, F.; Spagl, M.; Seeber, C.; Piechotta, V.; Metzendorf, M.I.; et al. Janus kinase inhibitors for the treatment of COVID-19. Cochrane Database Syst. Rev. 2022, 6, CD015209. [Google Scholar] [CrossRef] [PubMed]
- Satarker, S.; Tom, A.A.; Shaji, R.A.; Alosious, A.; Luvis, M.; Nampoothiri, M. JAK-STAT Pathway Inhibition and their Implications in COVID-19 Therapy. Postgrad. Med. 2021, 133, 489–507. [Google Scholar] [CrossRef] [PubMed]
- Grant, A.H.; Estrada, A., 3rd; Ayala-Marin, Y.M.; Alvidrez-Camacho, A.Y.; Rodriguez, G.; Robles-Escajeda, E.; Cadena-Medina, D.A.; Rodriguez, A.C.; Kirken, R.A. The Many Faces of JAKs and STATs Within the COVID-19 Storm. Front. Immunol. 2021, 12, 690477. [Google Scholar] [CrossRef] [PubMed]
- Richardson, P.J.; Stebbing, J. Baricitinib as the treatment of choice for hospitalised individuals with COVID-19. EClinicalMedicine 2022, 49, 101493. [Google Scholar] [CrossRef] [PubMed]
- Jorgensen, S.C.J.; Tse, C.L.Y.; Burry, L.; Dresser, L.D. Baricitinib: A Review of Pharmacology, Safety, and Emerging Clinical Experience in COVID-19. Pharmacotherapy 2020, 40, 843–856. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Zhang, Y.; Qiao, W.; Zhang, J.; Qi, Z. Baricitinib, a drug with potential effect to prevent SARS-COV-2 from entering target cells and control cytokine storm induced by COVID-19. Int. Immunopharmacol. 2020, 86, 106749. [Google Scholar] [CrossRef]
- Stebbing, J.; Nievas, G.S.; Falcone, M.; Youhanna, S.; Richardson, P.; Ottaviani, S.; Shen, J.X.; Sommerauer, C.; Tiseo, G.; Ghiadoni, L.; et al. JAK inhibition reduces SARS-CoV-2 liver infectivity and modulates inflammatory responses to reduce morbidity and mortality. Sci. Adv. 2021, 7, 4724–4739. [Google Scholar] [CrossRef]
- Stebbing, J.; Krishnan, V.; de Bono, S.; Ottaviani, S.; Casalini, G.; Richardson, P.J.; Monteil, V.; Lauschke, V.M.; Mirazimi, A.; Youhanna, S.; et al. Mechanism of baricitinib supports artificial intelligence-predicted testing in COVID-19 patients. EMBO Mol. Med. 2020, 12, e12697. [Google Scholar] [CrossRef]
- Bronte, V.; Ugel, S.; Tinazzi, E.; Vella, A.; De Sanctis, F.; Cane, S.; Batani, V.; Trovato, R.; Fiore, A.; Petrova, V.; et al. Baricitinib restrains the immune dysregulation in patients with severe COVID-19. J. Clin. Investig. 2020, 130, 6409–6416. [Google Scholar] [CrossRef]
- Petrone, L.; Petruccioli, E.; Alonzi, T.; Vanini, V.; Cuzzi, G.; Fard, S.N.; Castilletti, C.; Palmieri, F.; Gualano, G.; Vittozzi, P.; et al. In-vitro evaluation of the immunomodulatory effects of Baricitinib: Implication for COVID-19 therapy. J. Infect. 2021, 82, 58–66. [Google Scholar] [CrossRef]
- Rotoli, B.M.; Barilli, A.; Visigalli, R.; Ferrari, F.; Dall’Asta, V. y+LAT1 and y+LAT2 contribution to arginine uptake in different human cell models: Implications in the pathophysiology of Lysinuric Protein Intolerance. J. Cell Mol. Med. 2020, 24, 921–929. [Google Scholar] [CrossRef] [PubMed]
- Barilli, A.; Gaiani, F.; Prandi, B.; Cirlini, M.; Ingoglia, F.; Visigalli, R.; Rotoli, B.M.; de’Angelis, N.; Sforza, S.; de’Angelis, G.L.; et al. Gluten peptides drive healthy and celiac monocytes toward an M2-like polarization. J. Nutr. Biochem. 2018, 54, 11–17. [Google Scholar] [CrossRef] [PubMed]
- Barilli, A.; Visigalli, R.; Ferrari, F.; Borsani, G.; Dall’Asta, V.; Rotoli, B.M. Flagellin From Pseudomonas Aeruginosa Stimulates ATB(0,+) Transporter for Arginine and Neutral Amino Acids in Human Airway Epithelial Cells. Front. Immunol. 2021, 12, 641563. [Google Scholar] [CrossRef] [PubMed]
- Rotoli, B.M.; Barilli, A.; Visigalli, R.; Ferrari, F.; Dall’Asta, V. Endothelial Cell Activation by SARS-CoV-2 Spike S1 Protein: A Crosstalk between Endothelium and Innate Immune Cells. Biomedicines 2021, 9, 1220. [Google Scholar] [CrossRef]
- Luo, W.; Li, Y.X.; Jiang, L.J.; Chen, Q.; Wang, T.; Ye, D.W. Targeting JAK-STAT Signaling to Control Cytokine Release Syndrome in COVID-19. Trends Pharmacol. Sci. 2020, 41, 531–543. [Google Scholar] [CrossRef]
- Marconi, V.C.; Ramanan, A.V.; de Bono, S.; Kartman, C.E.; Krishnan, V.; Liao, R.; Piruzeli, M.L.B.; Goldman, J.D.; Alatorre-Alexander, J.; de Cassia Pellegrini, R.; et al. Efficacy and safety of baricitinib for the treatment of hospitalised adults with COVID-19 (COV-BARRIER): A randomised, double-blind, parallel-group, placebo-controlled phase 3 trial. Lancet Respir. Med. 2021, 9, 1407–1418. [Google Scholar] [CrossRef]
- Titanji, B.K.; Farley, M.M.; Mehta, A.; Connor-Schuler, R.; Moanna, A.; Cribbs, S.K.; O’Shea, J.; DeSilva, K.; Chan, B.; Edwards, A.; et al. Use of Baricitinib in Patients With Moderate to Severe Coronavirus Disease 2019. Clin. Infect. Dis. 2021, 72, 1247–1250. [Google Scholar] [CrossRef]
- Kalil, A.C.; Stebbing, J. Baricitinib: The first immunomodulatory treatment to reduce COVID-19 mortality in a placebo-controlled trial. Lancet Respir. Med. 2021, 9, 1349–1351. [Google Scholar] [CrossRef]
- Favalli, E.G.; Biggioggero, M.; Maioli, G.; Caporali, R. Baricitinib for COVID-19: A suitable treatment? Lancet Infect. Dis. 2020, 20, 1012–1013. [Google Scholar] [CrossRef]
- Smolen, J.S.; Genovese, M.C.; Takeuchi, T.; Hyslop, D.L.; Macias, W.L.; Rooney, T.; Chen, L.; Dickson, C.L.; Camp, J.R.; Cardillo, T.E.; et al. Safety Profile of Baricitinib in Patients with Active Rheumatoid Arthritis with over 2 Years Median Time in Treatment. J. Rheumatol. 2019, 46, 7–18. [Google Scholar] [CrossRef]
- Mazzoni, A.; Salvati, L.; Maggi, L.; Annunziato, F.; Cosmi, L. Hallmarks of immune response in COVID-19: Exploring dysregulation and exhaustion. Semin. Immunol. 2021, 55, 101508. [Google Scholar] [CrossRef] [PubMed]
- Haroun, R.A.; Osman, W.H.; Eessa, A.M. Interferon-gamma-induced protein 10 (IP-10) and serum amyloid A (SAA) are excellent biomarkers for the prediction of COVID-19 progression and severity. Life Sci. 2021, 269, 119019. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Shen, C.; Li, J.; Yuan, J.; Wei, J.; Huang, F.; Wang, F.; Li, G.; Li, Y.; Xing, L.; et al. Plasma IP-10 and MCP-3 levels are highly associated with disease severity and predict the progression of COVID-19. J. Allergy Clin. Immunol. 2020, 146, 119–127.e114. [Google Scholar] [CrossRef] [PubMed]
- Lore, N.I.; De Lorenzo, R.; Rancoita, P.M.V.; Cugnata, F.; Agresti, A.; Benedetti, F.; Bianchi, M.E.; Bonini, C.; Capobianco, A.; Conte, C.; et al. CXCL10 levels at hospital admission predict COVID-19 outcome: Hierarchical assessment of 53 putative inflammatory biomarkers in an observational study. Mol. Med. 2021, 27, 129. [Google Scholar] [CrossRef] [PubMed]
- Tegethoff, S.A.; Danziger, G.; Kuhn, D.; Kimmer, C.; Adams, T.; Heintz, L.; Metz, C.; Reifenrath, K.; Angresius, R.; Mang, S.; et al. TNF-related apoptosis-inducing ligand, interferon gamma-induced protein 10, and C-reactive protein in predicting the progression of SARS-CoV-2 infection: A prospective cohort study. Int. J. Infect. Dis. 2022, 122, 178–187. [Google Scholar] [CrossRef] [PubMed]
- Weston, S.; Macdonald, J.L.; Williams, L.M.; Roussou, E.; Kang, N.V.; Kiriakidis, S.; Taylor, P.C. The JAK inhibitor baricitinib inhibits oncostatin M induction of proinflammatory mediators in ex-vivo synovial derived cells. Clin. Exp. Rheumatol. 2021, 13. [Google Scholar] [CrossRef]
- Zhu, Q.C.; Li, S.; Yuan, L.X.; Chen, R.A.; Liu, D.X.; Fung, T.S. Induction of the Proinflammatory Chemokine Interleukin-8 is Regulated by Integrated Stress Response and AP-1 Family Proteins Activated during Coronavirus Infection. Int. J. Mol. Sci. 2021, 22, 5646. [Google Scholar] [CrossRef]
- Barilli, A.; Visigalli, R.; Ferrari, F.; Bianchi, M.G.; Dall’Asta, V.; Rotoli, B.M. Immune-Mediated Inflammatory Responses of Alveolar Epithelial Cells: Implications for COVID-19 Lung Pathology. Biomedicines 2022, 10, 618. [Google Scholar] [CrossRef]
- Aggarwal, A.; Baker, C.S.; Evans, T.W.; Haslam, P.L. G-CSF and IL-8 but not GM-CSF correlate with severity of pulmonary neutrophilia in acute respiratory distress syndrome. Eur. Respir. J. 2000, 15, 895–901. [Google Scholar] [CrossRef]
- Harada, A.; Sekido, N.; Akahoshi, T.; Wada, T.; Mukaida, N.; Matsushima, K. Essential involvement of interleukin-8 (IL-8) in acute inflammation. J. Leukoc. Biol. 1994, 56, 559–564. [Google Scholar] [CrossRef]
- Gschwandtner, M.; Derler, R.; Midwood, K.S. More Than Just Attractive: How CCL2 Influences Myeloid Cell Behavior Beyond Chemotaxis. Front. Immunol. 2019, 10, 2759. [Google Scholar] [CrossRef] [PubMed]
- Klein, R.S. Regulation of neuroinflammation: The role of CXCL10 in lymphocyte infiltration during autoimmune encephalomyelitis. J. Cell Biochem. 2004, 92, 213–222. [Google Scholar] [CrossRef] [PubMed]
- Elahi, R.; Karami, P.; Heidary, A.H.; Esmaeilzadeh, A. An updated overview of recent advances, challenges, and clinical considerations of IL-6 signaling blockade in severe coronavirus disease 2019 (COVID-19). Int. Immunopharmacol. 2022, 105, 108536. [Google Scholar] [CrossRef] [PubMed]
- Ferrari, F.; Barilli, A.; (University of Parma, Parma, Italy). Personal comunication, 2022.
- Nagashima, S.; Mendes, M.C.; Martins, A.P.C.; Borges, N.H.; Godoy, T.M.; Miggiolaro, A.; da Silva Deziderio, F.; Machado-Souza, C.; de Noronha, L. Endothelial Dysfunction and Thrombosis in Patients With COVID-19-Brief Report. Arterioscler. Thromb. Vasc. Biol. 2020, 40, 2404–2407. [Google Scholar] [CrossRef]
- Nicosia, R.F.; Ligresti, G.; Caporarello, N.; Akilesh, S.; Ribatti, D. COVID-19 Vasculopathy: Mounting Evidence for an Indirect Mechanism of Endothelial Injury. Am. J. Pathol. 2021, 191, 1374–1384. [Google Scholar] [CrossRef]
- Shi, H.; Zuo, Y.; Navaz, S.; Harbaugh, A.; Hoy, C.K.; Gandhi, A.A.; Sule, G.; Yalavarthi, S.; Gockman, K.; Madison, J.A.; et al. Endothelial Cell-Activating Antibodies in COVID-19. Arthritis. Rheumatol. 2022, 74, 1132–1138. [Google Scholar] [CrossRef]
- Rajan, S.; Ye, J.; Bai, S.; Huang, F.; Guo, Y.L. NF-kappaB, but not p38 MAP kinase, is required for TNF-alpha-induced expression of cell adhesion molecules in endothelial cells. J. Cell Biochem. 2008, 105, 477–486. [Google Scholar] [CrossRef]
- Wei, Z.; Jiang, W.; Wang, H.; Li, H.; Tang, B.; Liu, B.; Jiang, H.; Sun, X. The IL-6/STAT3 pathway regulates adhesion molecules and cytoskeleton of endothelial cells in thromboangiitis obliterans. Cell Signal. 2018, 44, 118–126. [Google Scholar] [CrossRef]
- Wung, B.S.; Ni, C.W.; Wang, D.L. ICAM-1 induction by TNFalpha and IL-6 is mediated by distinct pathways via Rac in endothelial cells. J. Biomed. Sci. 2005, 12, 91–101. [Google Scholar] [CrossRef]
- Meyer, K.; Patra, T.; Vijayamahantesh; Ray, R. SARS-CoV-2 Spike Protein Induces Paracrine Senescence and Leukocyte Adhesion in Endothelial Cells. J. Virol. 2021, 95, e0079421. [Google Scholar] [CrossRef]






| Gene/Protein | Forward Primer | Reverse Primer |
|---|---|---|
| RPL15/RPL15 | Hs03855120_g1 (TaqMan® Assay, Thermo Fisher Scientific) | |
| IL1B/IL-1β | Hs99999029_m1 (TaqMan® Assay, ThermoFisher Scientific) | |
| IL6/IL-6 | AACCTGAACCTTCCAAAGATGG | TCTGGCTTGTTCCTCACTACT |
| TNFA/TNFα | ATGAGCACTGAAAGCATGATCC | GAGGGCTGATTAGAGAGAGGTC |
| CXCL8/IL-8 | ACTGAGAGTGATTGAGAGTGGAC | AACCCTCTGCACCCAGTTTTC |
| CXCL10/IP-10 | GTGGCATTCAAGGAGTACCTC | TGATGGCCTTCGATTCTGGATT |
| CCL2/MCP-1 | CAGCCAGATGCAATCAATGCC | TGGAATCCTGAACCCACTTCT |
| CCL3/MIP-1α | AGTTCTCTGCATCACTTGCTG | CGGCTTCGCTTGGTTAGGAA |
| CCL4/MIP-1β | CTGTGCTGATCCCAGTGAATC | TCAGTTCAGTTCCAGGTCATACA |
| CCL5/RANTES | CTCCCCATATTCCTCGGACA | GTTGATGTACTCCCGAACCC |
| ICAM1/ICAM-1 | TGAACCCCACAGTCACCTATG | CTCGTCCTCTGCGGTCAC |
| VCAM1/VCAM-1 | GGGAAGATGGTCGTGATCCTT | TCTGGGGTGGTCTCGATTTTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barilli, A.; Visigalli, R.; Ferrari, F.; Recchia Luciani, G.; Soli, M.; Dall’Asta, V.; Rotoli, B.M. The JAK1/2 Inhibitor Baricitinib Mitigates the Spike-Induced Inflammatory Response of Immune and Endothelial Cells In Vitro. Biomedicines 2022, 10, 2324. https://doi.org/10.3390/biomedicines10092324
Barilli A, Visigalli R, Ferrari F, Recchia Luciani G, Soli M, Dall’Asta V, Rotoli BM. The JAK1/2 Inhibitor Baricitinib Mitigates the Spike-Induced Inflammatory Response of Immune and Endothelial Cells In Vitro. Biomedicines. 2022; 10(9):2324. https://doi.org/10.3390/biomedicines10092324
Chicago/Turabian StyleBarilli, Amelia, Rossana Visigalli, Francesca Ferrari, Giulia Recchia Luciani, Maurizio Soli, Valeria Dall’Asta, and Bianca Maria Rotoli. 2022. "The JAK1/2 Inhibitor Baricitinib Mitigates the Spike-Induced Inflammatory Response of Immune and Endothelial Cells In Vitro" Biomedicines 10, no. 9: 2324. https://doi.org/10.3390/biomedicines10092324
APA StyleBarilli, A., Visigalli, R., Ferrari, F., Recchia Luciani, G., Soli, M., Dall’Asta, V., & Rotoli, B. M. (2022). The JAK1/2 Inhibitor Baricitinib Mitigates the Spike-Induced Inflammatory Response of Immune and Endothelial Cells In Vitro. Biomedicines, 10(9), 2324. https://doi.org/10.3390/biomedicines10092324

