Differentially Aquaporin 5 Expression in Submandibular Glands and Cerebral Cortex in Alzheimer’s Disease
Abstract
1. Introduction
2. Material and Methods
2.1. Mice Samples
2.2. Human Samples
2.3. Western Blot
2.4. Immunohistochemistry
2.5. RNA Extraction and Quantification
2.6. Data and Statistical Analysis
3. Results
3.1. Expression of AQP5 in Submandibular Glands from APP/PS1 Mice and AD Patients
3.2. Expression of AQP5 in Cerebral Cortex from APP/PS1 Mice and AD Patients
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Masters, C.L.; Bateman, R.; Blennow, K.; Rowe, C.C.; Sperling, R.A.; Cummings, J.L. Alzheimer’s disease. Nat. Rev. Dis. Primers 2015, 1, 15056. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scheltens, P.; Blennow, K.; Breteler, M.M.; de Strooper, B.; Frisoni, G.B.; Salloway, S.; Van der Flier, W.M. Alzheimer’s disease. Lancet 2016, 388, 505–517. [Google Scholar] [CrossRef] [Scilit]
- Kinney, J.W.; Bemiller, S.M.; Murtishaw, A.S.; Leisgang, A.M.; Salazar, A.M.; Lamb, B.T. Inflammation as a central mechanism in Alzheimer’s disease. Alzheimers Dement 2018, 4, 575–590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holtzman, D.M.; Morris, J.C.; Goate, A.M. Alzheimer’s disease: The challenge of the second century. Sci. Transl. Med. 2011, 3, 77sr71. [Google Scholar] [CrossRef] [Scilit]
- Selkoe, D.J.; Hardy, J. The amyloid hypothesis of Alzheimer’s disease at 25 years. EMBO Mol. Med. 2016, 8, 595–608. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Strooper, B.; Karran, E. The Cellular Phase of Alzheimer’s Disease. Cell 2016, 164, 603–615. [Google Scholar] [CrossRef] [Scilit]
- Proctor, G.B.; Shaalan, A.M. Disease-Induced Changes in Salivary Gland Function and the Composition of Saliva. J. Dent. Res. 2021, 11, 1201–1209. [Google Scholar] [CrossRef] [Scilit]
- Antequera, D.; Moneo, D.; Carrero, L.; Bartolome, F.; Ferrer, I.; Proctor, G.; Carro, E. Salivary Lactoferrin Expression in a Mouse Model of Alzheimer’s Disease. Front. Immunol. 2021, 12, 749468. [Google Scholar] [CrossRef] [Scilit]
- Floden, A.M.; Sohrabi, M.; Nookala, S.; Cao, J.J.; Combs, C.K. Salivary Aβ Secretion and Altered Oral Microbiome in Mouse Models of AD. Curr. Alzheimer Res. 2020, 17, 1133–1144. [Google Scholar] [CrossRef] [Scilit]
- Zalewska, A.; Klimiuk, A.; Zięba, S.; Wnorowska, O.; Rusak, M.; Waszkiewicz, N.; Szarmach, I.; Dzierżanowski, K.; Maciejczyk, M. Salivary gland dysfunction and salivary redox imbalance in patients with Alzheimer’s disease. Sci. Rep. 2021, 11, 23904. [Google Scholar] [CrossRef] [Scilit]
- Proctor, G.B. The physiology of salivary secretion. Periodontol. 2000 2016, 70, 11–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fábián, T.K.; Fejérdy, P.; Csermely, P. Salivary Genomics, Transcriptomics and Proteomics: The Emerging Concept of the Oral Ecosystem and their Use in the Early Diagnosis of Cancer and other Diseases. Curr. Genomics 2008, 9, 11–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakamura, T.; Matsui, M.; Uchida, K.; Futatsugi, A.; Kusakawa, S.; Matsumoto, N.; Nakamura, K.; Manabe, T.; Taketo, M.M.; Mikoshiba, K. M(3) muscarinic acetylcholine receptor plays a critical role in parasympathetic control of salivation in mice. J. Physiol. 2004, 558, 561–575. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gautam, D.; Heard, T.S.; Cui, Y.; Miller, G.; Bloodworth, L.; Wess, J. Cholinergic stimulation of salivary secretion studied with M1 and M3 muscarinic receptor single- and double-knockout mice. Mol. Pharmacol. 2004, 66, 260–267. [Google Scholar] [CrossRef] [Scilit]
- Proctor, G.B.; Carpenter, G.H. Salivary secretion: Mechanism and neural regulation. Monogr. Oral. Sci. 2014, 24, 14–29. [Google Scholar] [CrossRef] [Scilit]
- Verkman, A.S. More than just water channels: Unexpected cellular roles of aquaporins. J. Cell Sci. 2005, 118, 3225–3232. [Google Scholar] [CrossRef] [Scilit]
- Verkman, A.S. Aquaporins at a glance. J. Cell Sci. 2011, 124, 2107–2112. [Google Scholar] [CrossRef] [Scilit]
- D’Agostino, C.; Elkashty, O.A.; Chivasso, C.; Perret, J.; Tran, S.D.; Delporte, C. Insight into Salivary Gland Aquaporins. Cells 2020, 9, 1547. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.; Iwata, F.; Muraguchi, M.; Ooga, K.; Ohmoto, Y.; Takai, M.; Mori, T.; Ishikawa, Y. Correlation between salivary secretion and salivary AQP5 levels in health and disease. J. Med. Investig. 2009, 56, 350–353. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Zhao, D.; Gong, B.; Xu, Y.; Sun, H.; Yang, B.; Zhao, X. Decreased saliva secretion and down-regulation of AQP5 in submandibular gland in irradiated rats. Radiat. Res. 2006, 165, 678–687. [Google Scholar] [CrossRef] [Scilit]
- Badaut, J.; Lasbennes, F.; Magistretti, P.J.; Regli, L. Aquaporins in brain: Distribution, physiology, and pathophysiology. J. Cereb. Blood Flow Metab. 2002, 22, 367–378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamamoto, N.; Yoneda, K.; Asai, K.; Sobue, K.; Tada, T.; Fujita, Y.; Katsuya, H.; Fujita, M.; Aihara, N.; Mase, M.; et al. Alterations in the expression of the AQP family in cultured rat astrocytes during hypoxia and reoxygenation. Brain Res. Mol. Brain Res. 2001, 90, 26–38. [Google Scholar] [CrossRef] [Scilit]
- Papadopoulos, M.C.; Verkman, A.S. Aquaporin water channels in the nervous system. Nat. Rev. Neurosci. 2013, 14, 265–277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manley, G.T.; Fujimura, M.; Ma, T.; Noshita, N.; Filiz, F.; Bollen, A.W.; Chan, P.; Verkman, A.S. Aquaporin-4 deletion in mice reduces brain edema after acute water intoxication and ischemic stroke. Nat. Med. 2000, 6, 159–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rash, J.E.; Yasumura, T.; Hudson, C.S.; Agre, P.; Nielsen, S. Direct immunogold labeling of aquaporin-4 in square arrays of astrocyte and ependymocyte plasma membranes in rat brain and spinal cord. Proc. Natl. Acad. Sci. USA 1998, 95, 11981–11986. [Google Scholar] [CrossRef] [Scilit]
- Yool, A.J. Aquaporins: Multiple roles in the central nervous system. Neuroscientist 2007, 13, 470–485. [Google Scholar] [CrossRef] [Scilit]
- Chu, H.; Xiang, J.; Wu, P.; Su, J.; Ding, H.; Tang, Y.; Dong, Q. The role of aquaporin 4 in apoptosis after intracerebral hemorrhage. J Neuroinflammation 2014, 11, 184. [Google Scholar] [CrossRef] [Scilit]
- Chai, R.C.; Jiang, J.H.; Wong, A.Y.; Jiang, F.; Gao, K.; Vatcher, G.; Hoi Yu, A.C. AQP5 is differentially regulated in astrocytes during metabolic and traumatic injuries. Glia 2013, 61, 1748–1765. [Google Scholar] [CrossRef] [Scilit]
- Jung, H.J.; Park, J.Y.; Jeon, H.S.; Kwon, T.H. Aquaporin-5: A marker protein for proliferation and migration of human breast cancer cells. PLoS ONE 2011, 6, e28492. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.J.; Chae, Y.S.; Kim, J.G.; Kim, W.W.; Jung, J.H.; Park, H.Y.; Jeong, J.Y.; Park, J.Y.; Jung, H.J.; Kwon, T.H. AQP5 expression predicts survival in patients with early breast cancer. Ann. Surg. Oncol. 2014, 21, 375–383. [Google Scholar] [CrossRef] [Scilit]
- Jensen, H.H.; Login, F.H.; Koffman, J.S.; Kwon, T.H.; Nejsum, L.N. The role of aquaporin-5 in cancer cell migration: A potential active participant. Int. J.Biochem. Cell Biol. 2016, 79, 271–276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, E.J.; Jung, H.J.; Choi, H.J.; Jang, H.J.; Park, H.J.; Nejsum, L.N.; Kwon, T.H. Exosomes co-expressing AQP5-targeting miRNAs and IL-4 receptor-binding peptide inhibit the migration of human breast cancer cells. FASEB J. 2020, 34, 3379–3398. [Google Scholar] [CrossRef] [Scilit]
- Hyman, B.T.; Phelps, C.H.; Beach, T.G.; Bigio, E.H.; Cairns, N.J.; Carrillo, M.C.; Dickson, D.W.; Duyckaerts, C.; Frosch, M.P.; Masliah, E.; et al. National Institute on Aging-Alzheimer’s Association guidelines for the neuropathologic assessment of Alzheimer’s disease. Alzheimers Dement 2012, 8, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, T.; Song, Y.; Gillespie, A.; Carlson, E.J.; Epstein, C.J.; Verkman, A.S. Defective secretion of saliva in transgenic mice lacking aquaporin-5 water channels. J. Biol. Chem. 1999, 274, 20071–20074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gresz, V.; Kwon, T.H.; Hurley, P.T.; Varga, G.; Zelles, T.; Nielsen, S.; Case, R.M.; Steward, M.C. Identification and localization of aquaporin water channels in human salivary glands. Am. J. Physiol. -Gastrointest. Liver Physiol. 2001, 281, G247–G254. [Google Scholar] [CrossRef] [Scilit]
- Cui, F.; Hu, M.; Li, R.; Li, B.; Huang, D.; Ma, W.; Jia, X.; Lv, Z. Insulin on changes in expressions of aquaporin-1, aquaporin-5, and aquaporin-8 in submandibular salivary glands of rats with Streptozotocin-induced diabetes. Int. J. Clin. Exp. Pathol. 2021, 14, 221–229. [Google Scholar]
- Yao, C.; Purwanti, N.; Karabasil, M.R.; Azlina, A.; Javkhlan, P.; Hasegawa, T.; Akamatsu, T.; Hosoi, T.; Ozawa, K.; Hosoi, K. Potential down-regulation of salivary gland AQP5 by LPS via cross-coupling of NF-kappaB and p-c-Jun/c-Fos. Am. J. Pathol. 2010, 177, 724–734. [Google Scholar] [CrossRef] [Scilit]
- Soyfoo, M.S.; De Vriese, C.; Debaix, H.; Martin-Martinez, M.D.; Mathieu, C.; Devuyst, O.; Steinfeld, S.D.; Delporte, C. Modified aquaporin 5 expression and distribution in submandibular glands from NOD mice displaying autoimmune exocrinopathy. Arthritis Rheum. 2007, 56, 2566–2574. [Google Scholar] [CrossRef] [Scilit]
- Bermejo-Pareja, F.; Del Ser, T.; Valentí, M.; de la Fuente, M.; Bartolome, F.; Carro, E. Salivary lactoferrin as biomarker for Alzheimer’s disease: Brain-immunity interactions. Alzheimer’s Dement. 2020, 16, 1196–1204. [Google Scholar] [CrossRef] [Scilit]
- Hosoi, K.; Yao, C.; Hasegawa, T.; Yoshimura, H.; Akamatsu, T. Dynamics of Salivary Gland AQP5 under Normal and Pathologic Conditions. Int. J. Mol. Sci. 2020, 21, 1182. [Google Scholar] [CrossRef] [Scilit]
- Xie, J.; Van Hoecke, L.; Vandenbroucke, R.E. The Impact of Systemic Inflammation on Alzheimer’s Disease Pathology. Front. Immunol. 2021, 12, 796867. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tavares, E.; Antequera, D.; López-González, I.; Ferrer, I.; Miñano, F.J.; Carro, E. Potential Role of Aminoprocalcitonin in the Pathogenesis of Alzheimer Disease. Am. J. Pathol. 2016, 186, 2723–2735. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holmes, C.; Cunningham, C.; Zotova, E.; Woolford, J.; Dean, C.; Kerr, S.; Culliford, D.; Perry, V.H. Systemic inflammation and disease progression in Alzheimer disease. Neurology 2009, 73, 768–774. [Google Scholar] [CrossRef] [Scilit]
- Leung, R.; Proitsi, P.; Simmons, A.; Lunnon, K.; Güntert, A.; Kronenberg, D.; Pritchard, M.; Tsolaki, M.; Mecocci, P.; Kloszewska, I.; et al. Inflammatory proteins in plasma are associated with severity of Alzheimer’s disease. PLoS ONE 2013, 8, e64971. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Proctor, G.B.; Carpenter, G.H. Regulation of salivary gland function by autonomic nerves. Auton. Neurosci. 2007, 133, 3–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Azlina, A.; Karabasil, M.R.; Purwanti, N.; Hasegawa, T.; Yao, C.; Akamatsu, T.; Hosoi, K. Degradation of submandibular gland AQP5 by parasympathetic denervation of chorda tympani and its recovery by cevimeline, an M3 muscarinic receptor agonist. Am. J. Physiol. Gastrointest. Liver Physiol. 2008, 295, G112–G123. [Google Scholar] [CrossRef] [Scilit]
- Azlina, A.; Li, X.; Javkhlan, P.; Hasegawa, T.; Yao, C.; Akamatsu, T.; Hosoi, K. Down-regulation of submandibular gland AQP5 following parasympathetic denervation in rats. J. Med. Investig. 2009, 56, 273–276. [Google Scholar] [CrossRef] [Scilit]
- Muroi, S.I.; Isohama, Y. C-Terminal Domain of Aquaporin-5 Is Required to Pass Its Protein Quality Control and Ensure Its Trafficking to Plasma Membrane. Int. J. Mol. Sci. 2021, 22, 13461. [Google Scholar] [CrossRef] [Scilit]
- Nixon, R.A.; Yang, D.S. Autophagy failure in Alzheimer’s disease--locating the primary defect. Neurobiol. Dis. 2011, 43, 38–45. [Google Scholar] [CrossRef] [Scilit]
- Di Meco, A.; Curtis, M.E.; Lauretti, E.; Praticò, D. Autophagy Dysfunction in Alzheimer’s Disease: Mechanistic Insights and New Therapeutic Opportunities. Biol. Psychiatry 2020, 87, 797–807. [Google Scholar] [CrossRef] [Scilit]
- Bordi, M.; Berg, M.J.; Mohan, P.S.; Peterhoff, C.M.; Alldred, M.J.; Che, S.; Ginsberg, S.D.; Nixon, R.A. Autophagy flux in CA1 neurons of Alzheimer hippocampus: Increased induction overburdens failing lysosomes to propel neuritic dystrophy. Autophagy 2016, 12, 2467–2483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chung, K.M.; Hernández, N.; Sproul, A.A.; Yu, W.H. Alzheimer’s disease and the autophagic-lysosomal system. Neurosci. Lett. 2019, 697, 49–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vogel, C.; Marcotte, E.M. Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat. Rev. Genet. 2012, 13, 227–232. [Google Scholar] [CrossRef] [Scilit]
- Kosti, I.; Jain, N.; Aran, D.; Butte, A.J.; Sirota, M. Cross-tissue Analysis of Gene and Protein Expression in Normal and Cancer Tissues. Sci. Rep. 2016, 6, 24799. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeppenfeld, D.M.; Simon, M.; Haswell, J.D.; D’Abreo, D.; Murchison, C.; Quinn, J.F.; Grafe, M.R.; Woltjer, R.L.; Kaye, J.; Iliff, J.J. Association of Perivascular Localization of Aquaporin-4 With Cognition and Alzheimer Disease in Aging Brains. JAMA Neurol. 2017, 74, 91–99. [Google Scholar] [CrossRef] [Scilit]
- Lan, Y.L.; Zhao, J.; Ma, T.; Li, S. The Potential Roles of Aquaporin 4 in Alzheimer’s Disease. Mol. Neurobiol. 2016, 53, 5300–5309. [Google Scholar] [CrossRef] [Scilit]
- Hoshi, A.; Yamamoto, T.; Shimizu, K.; Ugawa, Y.; Nishizawa, M.; Takahashi, H.; Kakita, A. Characteristics of aquaporin expression surrounding senile plaques and cerebral amyloid angiopathy in Alzheimer disease. J. Neuropathol. Exp. Neurol. 2012, 71, 750–759. [Google Scholar] [CrossRef] [Scilit]
- He, X.F.; Liu, D.X.; Zhang, Q.; Liang, F.Y.; Dai, G.Y.; Zeng, J.S.; Pei, Z.; Xu, G.Q.; Lan, Y. Voluntary Exercise Promotes Glymphatic Clearance of Amyloid Beta and Reduces the Activation of Astrocytes and Microglia in Aged Mice. Front. Mol. Neurosci. 2017, 10, 144. [Google Scholar] [CrossRef] [Scilit]
- Pérez, E.; Barrachina, M.; Rodríguez, A.; Torrejón-Escribano, B.; Boada, M.; Hernández, I.; Sánchez, M.; Ferrer, I. Aquaporin expression in the cerebral cortex is increased at early stages of Alzheimer disease. Brain Res. 2007, 1128, 164–174. [Google Scholar] [CrossRef] [Scilit]
- Misawa, T.; Arima, K.; Mizusawa, H.; Satoh, J. Close association of water channel AQP1 with amyloid-beta deposition in Alzheimer disease brains. Acta Neuropathol. 2008, 116, 247–260. [Google Scholar] [CrossRef] [Scilit]
- Yamamoto, N.; Sobue, K.; Miyachi, T.; Inagaki, M.; Miura, Y.; Katsuya, H.; Asai, K. Differential regulation of aquaporin expression in astrocytes by protein kinase C. Brain Res. Mol. Brain Res. 2001, 95, 110–116. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Huang, X.; Zhang, Y.W.; Rockenstein, E.; Bu, G.; Golde, T.E.; Masliah, E.; Xu, H. Alzheimer’s β-secretase (BACE1) regulates the cAMP/PKA/CREB pathway independently of β-amyloid. J. Neurosci. 2012, 32, 11390–11395. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Control | AD | |
|---|---|---|
| n | 11 | 15 |
| Sex (M/F) | 6/5 | 9/6 |
| Age Mean (SD) | 62.27 (8.25) | 79.07 (8.01) |
| Braak Stage | - | II–III: 5 |
| VI: 10 |
| Control | AD | |
|---|---|---|
| n | 26 | 47 |
| Sex (M/F) | 14/12 | 25/22 |
| Age Mean (SD) | 69.48 (15.84) | 74.52 (9.10) |
| Braak Stage | - | I–II: 21 |
| III–IV:14 V–VI: 12 |
| Gene | Sequence (5´>3´) | |
|---|---|---|
| Forward | Reverse | |
| mHPRT | gttgggcttacctcactgct | taatcacgacgctgggactg |
| mAQP1 | tcccctaactttcccctttg | agcacagggacaattccaag |
| mAQP3 | cttgtgatgtttggctgtgg | aagccaagttgatggtgagg |
| mAQP4 | ttccgttcgatcttcagagg | tatcagcccatttcccagag |
| mAQP5 | Ttcaggaccatcccagaaag | taagatggcactcgacgaac |
| mAQP8 | ttgctaccttggggaacatc | caatcagccctccaaatagc |
| mAQP9 | tgcgacttttggtgtctctg | ttgaaccactccatccttcc |
| hHPRT | gaccagtcaacaggggacat | cctgaccaaggaaagcaaag |
| hAQP1 | tttctgtttcctggcctcag | tccacaacttcaagggagtg |
| hAQP3 | atgtgtgtgcatgtgtgtgc | tcccttgccctgaatatctg |
| hAQP4 | gcatgtgattgacgttgacc | tgggtggaaggaaatctgag |
| hAQP5 | tggctgccatcctttacttc | gctcatacgtgcctttgatg |
| hAQP8 | aggttctggaatgcatctgg | ggccctttgtcttctcattg |
| hAQP9 | tttatgtgggagcccagttc | gttttccaccagcaaaggac |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Antequera, D.; Carrero, L.; Cunha Alves, V.; Ferrer, I.; Hernández-Gallego, J.; Municio, C.; Carro, E. Differentially Aquaporin 5 Expression in Submandibular Glands and Cerebral Cortex in Alzheimer’s Disease. Biomedicines 2022, 10, 1645. https://doi.org/10.3390/biomedicines10071645
Antequera D, Carrero L, Cunha Alves V, Ferrer I, Hernández-Gallego J, Municio C, Carro E. Differentially Aquaporin 5 Expression in Submandibular Glands and Cerebral Cortex in Alzheimer’s Disease. Biomedicines. 2022; 10(7):1645. https://doi.org/10.3390/biomedicines10071645
Chicago/Turabian StyleAntequera, Desiree, Laura Carrero, Victoria Cunha Alves, Isidro Ferrer, Jesús Hernández-Gallego, Cristina Municio, and Eva Carro. 2022. "Differentially Aquaporin 5 Expression in Submandibular Glands and Cerebral Cortex in Alzheimer’s Disease" Biomedicines 10, no. 7: 1645. https://doi.org/10.3390/biomedicines10071645
APA StyleAntequera, D., Carrero, L., Cunha Alves, V., Ferrer, I., Hernández-Gallego, J., Municio, C., & Carro, E. (2022). Differentially Aquaporin 5 Expression in Submandibular Glands and Cerebral Cortex in Alzheimer’s Disease. Biomedicines, 10(7), 1645. https://doi.org/10.3390/biomedicines10071645

