Assessment of the Relationship between Clinical Manifestation and Pathogenic Potential of Streptococcus pyogenes Strains-Distribution of Genes and Genotypes of Toxins
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Origin of the Strains and Their Selection Criteria
4.2. Bacterial Culture and Strain Identification
4.3. Bacterial Genomic DNA Isolation
4.4. Virulence Factor Genes Detection
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ijaz, M.; Ameen, F.; Alfoteih, Y.A.; Shamim, S.; Alshehri, W.A.; Murtaza, G. Dissecting Streptococcus pyogenes interaction with human. Arch. Microbiol. 2020, 202, 2023–2032. [Google Scholar] [CrossRef] [PubMed]
- Szczypa, K.; Wilemska, J.; Hryniewicz, W.; Sitkiewicz, I. Mechanizmy wirulencji Streptococcus pyogenes. Post. Mikrobiol. 2012, 51, 3–15. [Google Scholar]
- Walker, M.J.; Barnett, T.C.; McArthur, J.D.; Cole, J.N.; Gillen, C.M.; Henningham, A.; Sriprakash, K.S.; Sanderson-Smith, M.L.; Nizet, V. Disease manifestations and pathogenic mechanisms of Group A Streptococcus. Clin. Microbiol. Rev. 2014, 27, 264–301. [Google Scholar] [CrossRef] [PubMed]
- Llewelyn, M.; Cohen, J. Superantigens: Microbial agents that corrupt immunity. Lancet Infect. Dis. 2002, 2, 156–162. [Google Scholar] [CrossRef]
- Commons, R.J.; Smeesters, P.R.; Proft, T.; Fraser, J.D.; Robins-Browne, R.; Curtis, N. Streptococcal superantigens: Categorization and clinical associations. Trends Mol. Med. 2014, 20, 48–62. [Google Scholar] [CrossRef] [PubMed]
- Aslam, B.; Khurshid, M.; Nisar, M.A.; Muzammil, S.; Hayat, S. Superantigens: Procession of frets. Braz. J. Infect. Dis. 2017, 21, 357–358. [Google Scholar] [CrossRef]
- Murray, P.R.; Rosenthal, K.S.; Pfaller, M.A. Medical Microbiology; Elsevier: Amsterdam, The Netherlands, 2013; pp. 189–195. [Google Scholar]
- Paveenkittiporn, W.; Nozawa, T.; Dejsirilert, S.; Nakagawa, I.; Hamada, S. Prevalent emm types and superantigen gene patterns of group A Streptococcus in Thailand. Epidemiol. Infect. 2016, 144, 864–869. [Google Scholar] [CrossRef] [PubMed]
- Strus, M.; Heczko, P.B.; Golińska, E.; Tomusiak, A.; Chmielarczyk, A.; Dorycka, M.; van der Linden, M.; Samet, A.; Piórkowska, A. The virulence factors of group A Streptococcus strains isolated from invasive and non-invasive infections in Polish and German centres, 2009–2011. Eur. J. Clin. Microbiol. Infect. Dis. 2017, 36, 1643–1649. [Google Scholar] [CrossRef]
- Imöhl, M.; Fitzner, C.; Perniciaro, S.; van der Linden, M. Epidemiology and distribution of 10 superantigens among invasive Streptococcus pyogenes disease in Germany from 2009 to 2014. PLoS ONE 2017, 12, e0180757. [Google Scholar] [CrossRef]
- Yu, C.E.; Ferretti, J.J. Molecular epidemiologic analysis of the type A streptococcal exotoxin (erythrogenic toxin) gene (speA) in clinical Streptococcus pyogenes strains. Infect. Immun. 1989, 57, 3715–3719. [Google Scholar] [CrossRef]
- Szczypa, K.; Sadowy, E.; Izdebski, R.; Strakova, L.; Hryniewicz, W. Group A Streptococci from invasive-disease episodes in Poland are remarkably divergent at the molecular level. J. Clin. Microbiol. 2006, 44, 3975–3979. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Li, H.; Zhou, L.; Zhao, Y.; Ma, L.; Xu, J.; Liu, Y.; Qin, Q.; Hu, J.; Liu, X. Epidemiological analysis of Group A Streptococcus infections in a hospital in Beijing, China. Eur. J. Clin. Microbiol. Infect. Dis. 2020, 39, 2361–2371. [Google Scholar] [CrossRef] [PubMed]
- Tyler, S.D.; Johnson, W.M.; Huang, J.C.; Ashton, F.E.; Wang, G.; Low, D.E.; Rozee, K.R. Streptococcal erythrogenic toxin genes: Detection by polymerase chain reaction and association with disease in strains isolated in Canada from 1940 to 1991. J. Clin. Microbiol. 1992, 30, 3127–3131. [Google Scholar] [CrossRef] [PubMed]
- Wu, P.C.; Lo, W.T.; Chen, S.J.; Wang, C.C. Molecular characterization of Group A streptococcal isolates causing scarlet fever and pharyngitis among young children: A retrospective study from a northern Taiwan medical center. J. Microbiol. Immunol. Infect. 2014, 47, 304–310. [Google Scholar] [CrossRef]
- Hsu, J.F.; Chuang, W.J.; Shiesh, S.C.; Lin, Y.S.; Liu, C.C.; Wang, C.C.; Fu, T.F.; Tsai, J.H.; Tsai, W.L.; Huang, Y.J.; et al. Streptococcal pyrogenic exotoxin B cleaves human S-adenosylhomocysteine hydrolase and induces hypermethioninemia. J. Infect. Dis. 2008, 198, 367–374. [Google Scholar] [CrossRef]
- Yu, C.E.; Ferretti, J.J. Frequency of the erythrogenic toxin B and C genes (speB and speC) among clinical isolates of group A Streptococci. Infect. Immun. 1991, 59, 211–215. [Google Scholar] [CrossRef]
- Maripuu, L.; Eriksson, A.; Norgren, M. Superantigen gene profile diversity among clinical group A streptococcal isolates. FEMS Immunol. Med. Microbiol. 2008, 54, 236–244. [Google Scholar] [CrossRef]
- Friães, A.; Pinto, F.R.; Silva-Costa, C.; Ramirez, M.; Melo-Cristino, J. Superantigen gene complement of Streptococcus pyogenes—Relationship with other typing methods and short-term stability. Eur. J. Clin. Microbiol. Infect. Dis. 2013, 32, 115–125. [Google Scholar] [CrossRef]
- Li, H.; Zhou, L.; Zhao, Y.; Ma, L.; Liu, X.; Hu, J. Molecular epidemiology and antimicrobial resistance of group a Streptococcus recovered from patients in Beijing, China. BMC Infect. Dis. 2020, 20, 507. [Google Scholar] [CrossRef]
- Berman, H.F.; Tartof, S.Y.; Reis, J.N.; Reis, M.G.; Riley, L.W. Distribution of superantigens in group A streptococcal isolates from Salvador, Brazil. BMC Infect. Dis. 2014, 14, 294. [Google Scholar] [CrossRef]
- Choi, S.C.; Rasmussen, M.D.; Hubisz, M.J.; Gronau, I.; Stanhope, M.J.; Siepel, A. Replacing and Additive Horizontal Gene Transfer in Streptococcus. Mol. Biol. Evol. 2012, 29, 3309–3320. [Google Scholar] [CrossRef] [PubMed]
- Commons, R.; Rogers, S.; Gooding, T.; Danchin, M.; Carapetis, J.; Robins-Browne, R.; Curtis, N. Superantigen genes in group A streptococcal isolates and their relationship with emm types. J. Med. Microbiol. 2008, 57, 1238–1246. [Google Scholar] [CrossRef] [PubMed]
- Helal, Z.M.; Rizk, D.E.; Adel El-Sokkary, M.M.; Hassan, R. Prevalence and Characterization of Streptococcus pyogenes Clinical Isolates from Different Hospitals and Clinics in Mansoura. Int. J. Microbiol. 2020, 2020, 5814945. [Google Scholar] [CrossRef]
- Abraham, T.; Sistla, S. Decoding the molecular epidemiology of group A Streptococcus—An Indian perspective. J. Med. Microbiol. 2019, 68, 1059–1071. [Google Scholar] [CrossRef] [PubMed]
- Kasprzykowska, U.; Sobieszczańska, B.M. Plastyczność bakteryjnych genomów—Międzykomórkowy transfer informacji genetycznej. Post. Mikrobiol. 2014, 53, 165–171. [Google Scholar]
- Meisal, R.; Andreasson, I.K.; Høiby, E.A.; Aaberge, I.S.; Michaelsen, T.E.; Caugant, D.A. Streptococcus pyogenes isolates causing severe infections in Norway in 2006 to 2007: Emm types, multilocus sequence types, and superantigen profiles. J. Clin. Microbiol. 2010, 48, 842–851. [Google Scholar] [CrossRef]
- Ibrahim, J.; Eisen, J.A.; Jospin, G.; Coil, D.A.; Khazen, G.; Tokajian, S. Genome Analysis of Streptococcus pyogenes Associated with Pharyngitis and Skin Infections. PLoS ONE 2016, 11, e0168177. [Google Scholar] [CrossRef]
- Fox, J.W.; Marcon, M.J.; Bonsu, B.K. Diagnosis of streptococcal pharyngitis by detection of Streptococcus pyogenes in posterior pharyngeal versus oral cavity specimens. J. Clin. Microbiol. 2006, 44, 2593–2594. [Google Scholar] [CrossRef][Green Version]
- Altun, M.; Mericli Yapıcı, B. Detection of Group A Beta Hemolytic Streptococci Species, emm, and Exotoxin Genes Isolated from Patients with Tonsillopharyngitis. Curr. Microbiol. 2020, 77, 2064–2070. [Google Scholar] [CrossRef]
- Hamzah, S.N.A.; Mohd Desa, M.N.; Jasni, A.S.; Mohd Taib, N.; Masri, S.N.; Hamat, R.A. Distribution of virulence genes and the molecular epidemiology of Streptococcus pyogenes clinical isolates by emm and multilocus sequence typing methods. Med. J. Malaysia 2021, 76, 164–170. [Google Scholar]
- Kittang, B.R.; Bruun, T.; Langeland, N.; Mylvaganam, H.; Glambek, M.; Skrede, S. Invasive group A, C and G streptococcal disease in western Norway: Virulence gene profiles, clinical features and outcomes. Clin. Microbiol. Infect. 2011, 17, 358–364. [Google Scholar] [CrossRef] [PubMed]
- Giuliano, C.; Patel, C.R.; Kale-Pradhan, P.B. A Guide to Bacterial Culture Identification and Results Interpretation. Pharm. Ther. 2019, 44, 192–200. [Google Scholar]
- Nelson, A.; Wright-Hughes, A.; Backhouse, M.R.; Lipsky, B.A.; Nixon, J.; Bhogal, M.S.; Reynolds, C.; Brown, S. CODIFI (Concordance in Diabetic Foot Ulcer Infection): A cross-sectional study of wound swab versus tissue sampling in infected diabetic foot ulcers in England. BMJ Open 2018, 8, e019437. [Google Scholar] [CrossRef] [PubMed]
- Melikian, R.; O’Donnell, T.F., Jr.; Iafrati, M. The economic impact of infection requiring hospitalization on venous leg ulcers. J. Vasc. Surg. Venous Lymphat. Disord. 2022, 10, 96–101. [Google Scholar] [CrossRef]
- Guilherme, L.; Ferreira, F.M.; Köhler, K.F.; Postol, E.; Kalil, J. A vaccine against Streptococcus pyogenes: The potential to prevent rheumatic fever and rheumatic heart disease. Am. J. Cardiovasc. Drugs 2013, 13, 1–4. [Google Scholar] [CrossRef] [PubMed]
| Gene/Assigned Genotype Name | A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | n | % |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| speB | + | + | + | + | + | + | + | + | + | + | + | + | − | + | + | + | + | 145 | 98.6 |
| speC | − | + | + | − | − | + | − | + | + | − | − | − | − | + | − | − | + | 69 | 46.9 |
| speJ | − | − | − | + | + | + | − | − | − | − | − | − | − | + | + | − | − | 42 | 28.6 |
| speH | − | + | − | − | − | − | + | + | − | − | − | − | − | − | − | + | − | 38 | 25.9 |
| speA | − | − | − | − | + | − | − | − | − | + | − | + | − | + | − | − | + | 19 | 12.9 |
| speK | − | − | − | − | − | − | − | + | + | + | + | − | − | − | + | + | − | 12 | 8.2 |
| n = 147 | 32 | 25 | 23 | 14 | 13 | 13 | 9 | 3 | 3 | 2 | 2 | 2 | 2 | 1 | 1 | 1 | 1 | ||
| % | 21.8 | 17.0 | 15.6 | 9.5 | 8.8 | 8.8 | 6.1 | 2.0 | 2.0 | 1.4 | 1.4 | 1.4 | 1.4 | 0.7 | 0.7 | 0.7 | 0.7 | ||
| Clinical Specimen Type | Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| speA | speB | speC | speH | speJ | speK | |||||||
| n = 19 | % | n = 145 | % | n = 69 | % | n = 38 | % | n = 42 | % | n = 12 | % | |
| Wound swab | 3 | 15.8 | 60 | 41.4 | 31 | 44.9 | 20 | 52.6 | 12 | 28.6 | 5 | 41.7 |
| Throat swab | 6 | 31.6 | 31 | 21.4 | 14 | 20.3 | 8 | 21.1 | 14 | 33.3 | 3 | 25.0 |
| Purulent material | 2 | 10.5 | 18 | 12.4 | 12 | 17.4 | 9 | 23.7 | 2 | 4.8 | 0 | 0.0 |
| Ulcer swab | 2 | 10.5 | 10 | 6.9 | 0 | 0.0 | 0 | 0.0 | 3 | 7.1 | 0 | 0.0 |
| Blood samples | 1 | 5.3 | 9 | 6.2 | 3 | 4.3 | 1 | 2.6 | 2 | 4.8 | 2 | 16.7 |
| Nose swab | 1 | 5.3 | 7 | 4.8 | 5 | 7.2 | 0 | 0.0 | 3 | 7.1 | 1 | 8.3 |
| Clinical Specimen Type | Genotype | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | B | C | D | E | F | |||||||
| n = 32 | % | n = 25 | % | n = 23 | % | n = 14 | % | n = 13 | % | n = 13 | % | |
| Wound swab | 14 | 43.8 | 13 | 52.0 | 11 | 47.8 | 7 | 50.0 | 1 | 7.7 | 3 | 23.1 |
| Throat swab | 3 | 9.4 | 3 | 12.0 | 4 | 17.4 | 4 | 28.6 | 5 | 38.5 | 5 | 38.5 |
| Purulent material | 2 | 6.3 | 8 | 32.0 | 4 | 17.4 | 1 | 7.1 | 1 | 7.7 | 0 | 0.0 |
| Ulcer swab | 7 | 21.9 | 0 | 0.0 | 0 | 0.0 | 1 | 7.1 | 2 | 15.4 | 0 | 0.0 |
| Blood samples | 4 | 12.5 | 1 | 4.0 | 0 | 0.0 | 0 | 0.0 | 0 | 0.0 | 1 | 7.7 |
| Nose swab | 1 | 3.1 | 0 | 0.0 | 2 | 8.7 | 0 | 0.0 | 1 | 7.7 | 2 | 15.4 |
| PCR Primer Name | Gene Detected | Primer Sequence 5′ → 3′ | Tm (°C) | Annealing Temperature (°C) | Product Size (bp) |
|---|---|---|---|---|---|
| speA-F | speA | CTTAAGAACCAAGAGATGGC | 49.7 | 52 | 200 |
| speA-R | ATAGGCTTTGGATACCATC | 46.8 | |||
| speB-F | speB | TTCTAGGATACTCTACCAGC | 49.7 | 55 | 300 |
| speB-R | ATTTGAGCAGTTGCAGTAGC | 49.7 | |||
| speC-F | speC | CATCTATGGAGGAATTACGC | 49.7 | 55 | 246 |
| speC-R | TGTGCCAATTTCGATTCTGC | 49.7 | |||
| speH-F | speH | AAGCAAATTCTTATAATACAACC | 46.4 | 52 | 630 |
| speH-R | TTAGCTGATTGACACATCTACA | 49.2 | |||
| speJ-F | speJ | GATAGTGAAAATATTAAAGACG | 45.5 | 52 | 639 |
| speJ-R | GCTCCTATCTTATTTAGTCC | 47.7 | |||
| speK-F | speK | GTGTGTCTAATGCCACCGTCT | 54.4 | 56 | 564 |
| speK-R | GGAACATATATGCTCCTAGAT | 48.5 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bogiel, T.; Domian, A.; Dobrzyńska, Z.; Mikucka, A.; Gospodarek-Komkowska, E. Assessment of the Relationship between Clinical Manifestation and Pathogenic Potential of Streptococcus pyogenes Strains-Distribution of Genes and Genotypes of Toxins. Biomedicines 2022, 10, 799. https://doi.org/10.3390/biomedicines10040799
Bogiel T, Domian A, Dobrzyńska Z, Mikucka A, Gospodarek-Komkowska E. Assessment of the Relationship between Clinical Manifestation and Pathogenic Potential of Streptococcus pyogenes Strains-Distribution of Genes and Genotypes of Toxins. Biomedicines. 2022; 10(4):799. https://doi.org/10.3390/biomedicines10040799
Chicago/Turabian StyleBogiel, Tomasz, Alicja Domian, Zuzanna Dobrzyńska, Agnieszka Mikucka, and Eugenia Gospodarek-Komkowska. 2022. "Assessment of the Relationship between Clinical Manifestation and Pathogenic Potential of Streptococcus pyogenes Strains-Distribution of Genes and Genotypes of Toxins" Biomedicines 10, no. 4: 799. https://doi.org/10.3390/biomedicines10040799
APA StyleBogiel, T., Domian, A., Dobrzyńska, Z., Mikucka, A., & Gospodarek-Komkowska, E. (2022). Assessment of the Relationship between Clinical Manifestation and Pathogenic Potential of Streptococcus pyogenes Strains-Distribution of Genes and Genotypes of Toxins. Biomedicines, 10(4), 799. https://doi.org/10.3390/biomedicines10040799

