Silicon and Gibberellins: Synergistic Function in Harnessing ABA Signaling and Heat Stress Tolerance in Date Palm (Phoenix dactylifera L.)
Abstract
:1. Introduction
2. Methodology
2.1. Plant Growth and Treatment Conditions
2.2. Chlorophyll a and Chlorophyll b Quantification
2.3. Leaf Relative Water Content (LRWC)
2.4. Quantification of Malondialdehyde (MDA)
2.5. Determination of Superoxide (O2•−)
2.6. Protein Quantification and Antioxidant Enzyme Assay
2.7. RNA Extraction and cDNA Synthesis
2.8. Gene Expression Analysis
2.9. Abscisic Acid Extraction and Quantification
2.10. Salicylic Acid Extraction and Quantification
2.11. Statistical Analysis
3. Results
3.1. Interactive Effects of GA and Si Promote Plant Growth Attributes under Heat Stress
3.2. Interactive Effects of GA3 and Si Stimulate Plant Antioxidant System
3.3. Interactive Effects of Si and GA3 Modulate Endogenous Hormonal Regulation
3.4. Modulation of Different Stress-Responsive Genes by Interactive Effects of Si and GA3 Application
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Hasanuzzaman, M.; Nahar, K.; Alam, M.; Roychowdhury, R.; Fujita, M. Physiological, biochemical, and molecular mechanisms of heat stress tolerance in plants. Int. J. Mol. Sci. 2013, 14, 9643–9684. [Google Scholar] [CrossRef]
- Fahad, S.; Bajwa, A.A.; Nazir, U.; Anjum, S.A.; Farooq, A.; Zohaib, A.; Sadia, S.; Nasim, W.; Adkins, S.; Saud, S. Crop production under drought and heat stress: Plant responses and management options. Front. Plant Sci. 2017, 8, 1147. [Google Scholar] [CrossRef] [Green Version]
- Akter, N.; Islam, M.R. Heat stress effects and management in wheat. A review. Agron. Sustain. Dev. 2017, 37, 37. [Google Scholar] [CrossRef]
- Vu, L.D.; Zhu, T.; Verstraeten, I.; Van De Cotte, B.; Consortium, I.W.G.S.; Gevaert, K.; De Smet, I. Temperature-Induced changes in the wheat phosphoproteome reveal temperature-Regulated interconversion of phosphoforms. J. Exp. Bot. 2018, 69, 4609–4624. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elbasyoni, I. Performance and stability of commercial wheat cultivars under terminal heat stress. Agronomy 2018, 8, 37. [Google Scholar] [CrossRef] [Green Version]
- Jha, U.C.; Bohra, A.; Singh, N.P. Heat stress in crop plants: Its nature, impacts and integrated breeding strategies to improve heat tolerance. Plant Breed. 2014, 133, 679–701. [Google Scholar] [CrossRef] [Green Version]
- Katano, K.; Honda, K.; Suzuki, N. Integration between ROS Regulatory Systems and Other Signals in the Regulation of Various Types of Heat Responses in Plants. Int. J. Mol. Sci. 2018, 19, 3370. [Google Scholar] [CrossRef] [Green Version]
- Khan, A.; Khan, A.L.; Muneer, S.; Kim, Y.-H.; Al-Rawahi, A.; Al-Harrasi, A. Silicon and salinity: Cross-talk in crop mediated stress tolerance mechanisms. Front. Plant Sci. 2019, 10, 1429. [Google Scholar] [CrossRef] [Green Version]
- Alonso-Ramírez, A.; Rodríguez, D.; Reyes, D.; Jiménez, J.A.; Nicolás, G.; López-Climent, M.; Gómez-Cadenas, A.; Nicolás, C. Evidence for a role of gibberellins in salicylic acid-Modulated early plant responses to abiotic stress in Arabidopsis seeds. Plant Physiol. 2009, 150, 1335–1344. [Google Scholar] [CrossRef] [Green Version]
- Soundararajan, P.; Sivanesan, I.; Jana, S.; Jeong, B.R. Influence of silicon supplementation on the growth and tolerance to high temperature in Salvia splendens. Hortic. Environ. Biotechnol. 2014, 55, 271–279. [Google Scholar] [CrossRef]
- Al-Yahyai, R.; Khan, M.M. Date palm status and perspective in Oman. In Date Palm Genetic Resources and Utilization; Springer: Berlin/Heidelberg, Germany, 2015; pp. 207–240. [Google Scholar]
- Yaish, M.W.; Kumar, P.P. Salt tolerance research in date palm tree (Phoenix dactylifera L.), past, present, and future perspectives. Front. Plant Sci. 2015, 6, 348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- El-Juhany, L.I. Degradation of date palm trees and date production in Arab countries: Causes and potential rehabilitation. Aust. J. Basic Appl. Sci. 2010, 4, 3998–4010. [Google Scholar]
- Patankar, H.V.; Al-Harrasi, I.; Al Kharusi, L.; Jana, G.A.; Al-Yahyai, R.; Sunkar, R.; Yaish, M.W. Overexpression of a Metallothionein 2A Gene from Date Palm Confers Abiotic Stress Tolerance to Yeast and Arabidopsis thaliana. Int. J. Mol. Sci. 2019, 20, 2871. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, Y.-H.; Khan, A.L.; Kim, D.-H.; Lee, S.-Y.; Kim, K.-M.; Waqas, M.; Jung, H.-Y.; Shin, J.-H.; Kim, J.-G.; Lee, I.-J. Silicon mitigates heavy metal stress by regulating P-Type heavy metal ATPases, Oryza sativa low silicon genes, and endogenous phytohormones. BMC Plant Biol. 2014, 14, 13. [Google Scholar] [CrossRef] [Green Version]
- Kim, Y.-H.; Khan, A.L.; Waqas, M.; Jeong, H.-J.; Kim, D.-H.; Shin, J.S.; Kim, J.-G.; Yeon, M.-H.; Lee, I.-J. Regulation of jasmonic acid biosynthesis by silicon application during physical injury to Oryza sativa L. J. Plant Res. 2014, 127, 525–532. [Google Scholar] [CrossRef]
- Khan, A.L.; Waqas, M.; Hussain, J.; Al-Harrasi, A.; Hamayun, M.; Lee, I.-J. Phytohormones enabled endophytic fungal symbiosis improve aluminum phytoextraction in tolerant Solanum lycopersicum: An examples of Penicillium janthinellum LK5 and comparison with exogenous GA3. J. Hazard. Mater. 2015, 295, 70–78. [Google Scholar] [CrossRef]
- Khan, A.; Bilal, S.; Khan, A.L.; Imran, M.; Al-Harrasi, A.; Al-Rawahi, A.; Lee, I.-J. Silicon-Mediated alleviation of combined salinity and cadmium stress in date palm (Phoenix dactylifera L.) by regulating physio-hormonal alteration. Ecotoxicol. Environ. Saf. 2020, 188, 109885. [Google Scholar] [CrossRef]
- Khan, A.; Kamran, M.; Imran, M.; Al-Harrasi, A.; Al-Rawahi, A.; Al-Amri, I.; Lee, I.-J.; Khan, A.L. Silicon and salicylic acid confer high-pH stress tolerance in tomato seedlings. Sci. Rep. 2019, 9, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Sumanta, N.; Haque, C.I.; Nishika, J.; Suprakash, R. Spectrophotometric analysis of chlorophylls and carotenoids from commonly grown fern species by using various extracting solvents. Res. J. Chem. Sci. ISSN 2014, 2231, 606X. [Google Scholar]
- Cao, Y.-Y.; Yang, M.-T.; Chen, S.-Y.; Zhou, Z.-Q.; Li, X.; Wang, X.-J.; Bai, J.-G. Exogenous sucrose influences antioxidant enzyme activities and reduces lipid peroxidation in water-Stressed cucumber leaves. Biol. Plant. 2015, 59, 147–153. [Google Scholar] [CrossRef]
- Okaichi, Y.; Ishikura, Y.; Akimoto, K.; Kawashima, H.; Toyoda-Ono, Y.; Kiso, Y.; Okaichi, H. Arachidonic acid improves aged rats’ spatial cognition. Physiol. Behav. 2005, 84, 617–623. [Google Scholar] [CrossRef] [PubMed]
- Gajewska, E.; Skłodowska, M. Differential biochemical responses of wheat shoots and roots to nickel stress: Antioxidative reactions and proline accumulation. Plant Growth Regul. 2008, 54, 179–188. [Google Scholar] [CrossRef]
- Bradford, N. A rapid and sensitive method for the quantitation microgram quantities of a protein isolated from red cell membranes. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Manoranjan, K.; KAR, M.; MISHRA, D. Catalase, peroxidase, and polyphenoloxidase activities during rice leaf senescence. Plant Physiol 1976, 57, 315–319. [Google Scholar] [CrossRef] [Green Version]
- Aebi, H. [13] Catalase in vitro. In Methods in Enzymology; Elsevier: Amsterdam, The Netherlands, 1984; Volume 105, pp. 121–126. [Google Scholar]
- Liu, L.; Han, R.; Yu, N.; Zhang, W.; Xing, L.; Xie, D.; Peng, D. A method for extracting high-quality total RNA from plant rich in polysaccharides and polyphenols using Dendrobium huoshanense. PloS ONE 2018, 13, e0196592. [Google Scholar] [CrossRef]
- Qi, Q.; Rose, P.A.; Abrams, G.D.; Taylor, D.C.; Abrams, S.R.; Cutler, A.J. (+)-Abscisic Acid Metabolism, 3-Ketoacyl-Coenzyme A Synthase Gene Expression, and Very-Long-Chain Monounsaturated Fatty Acid Biosynthesis inBrassica napus Embryos. Plant Physiol. 1998, 117, 979–987. [Google Scholar] [CrossRef] [Green Version]
- Bilal, S.; Khan, A.L.; Shahzad, R.; Kim, Y.-H.; Imran, M.; Khan, M.J.; Al-Harrasi, A.; Kim, T.H.; Lee, I.-J. Mechanisms of Cr (VI) resistance by endophytic Sphingomonas sp. LK11 and its Cr (VI) phytotoxic mitigating effects in soybean (Glycine max L.). Ecotoxicol. Environ. Saf. 2018, 164, 648–658. [Google Scholar] [CrossRef]
- Seskar, M.; Shulaev, V.; Raskin, I. Endogenous methyl salicylate in pathogen-Inoculated tobacco plants. Plant Physiol. 1998, 116, 387–392. [Google Scholar] [CrossRef] [Green Version]
- Bilal, S.; Shahzad, R.; Khan, A.L.; Kang, S.-M.; Imran, Q.M.; Al-Harrasi, A.; Yun, B.-W.; Lee, I.-J. Endophytic microbial consortia of phytohormones-producing fungus Paecilomyces formosus LHL10 and bacteria Sphingomonas sp. LK11 to Glycine max L. regulates physio-hormonal changes to attenuate aluminum and zinc stresses. Front. Plant Sci. 2018, 9, 1273. [Google Scholar] [CrossRef]
- Lamaoui, M.; Jemo, M.; Datla, R.; Bekkaoui, F. Heat and drought stresses in crops and approaches for their mitigation. Front. Chem. 2018, 6, 26. [Google Scholar] [CrossRef]
- Luyckx, M.; Hausman, J.-F.; Lutts, S.; Guerriero, G. Silicon and plants: Current knowledge and technological perspectives. Front. Plant Sci. 2017, 8, 411. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maggio, A.; Barbieri, G.; Raimondi, G.; De Pascale, S. Contrasting effects of GA 3 treatments on tomato plants exposed to increasing salinity. J. Plant Growth Regul. 2010, 29, 63–72. [Google Scholar] [CrossRef]
- Wang, Q.-L.; Chen, J.-H.; He, N.-Y.; Guo, F.-Q. Metabolic reprogramming in chloroplasts under heat stress in plants. Int. J. Mol. Sci. 2018, 19, 849. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Siddiqui, M.H.; Al-Whaibi, M.H.; Basalah, M.O. Interactive effect of calcium and gibberellin on nickel tolerance in relation to antioxidant systems in Triticum aestivum L. Protoplasma 2011, 248, 503–511. [Google Scholar] [CrossRef] [PubMed]
- Rios, J.J.; Martínez-Ballesta, M.C.; Ruiz, J.M.; Blasco, B.; Carvajal, M. Silicon-Mediated improvement in plant salinity tolerance: The role of aquaporins. Front. Plant Sci. 2017, 8, 948. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sofo, A.; Scopa, A.; Nuzzaci, M.; Vitti, A. Ascorbate peroxidase and catalase activities and their genetic regulation in plants subjected to drought and salinity stresses. Int. J. Mol. Sci. 2015, 16, 13561–13578. [Google Scholar] [CrossRef] [Green Version]
- Chang, L.; Guo, A.; Jin, X.; Yang, Q.; Wang, D.; Sun, Y.; Huang, Q.; Wang, L.; Peng, C.; Wang, X. The beta subunit of glyceraldehyde 3-phosphate dehydrogenase is an important factor for maintaining photosynthesis and plant development under salt stress—Based on an integrative analysis of the structural, physiological and proteomic changes in chloroplasts in Thellungiella halophila. Plant Sci. 2015, 236, 223–238. [Google Scholar]
- Wang, X.; Xu, C.; Cai, X.; Wang, Q.; Dai, S. Heat-Responsive photosynthetic and signaling pathways in plants: Insight from proteomics. Int. J. Mol. Sci. 2017, 18, 2191. [Google Scholar] [CrossRef]
- Kappachery, S.; Baniekal-Hiremath, G.; Yu, J.W.; Park, S.W. Effect of over-and under-Expression of glyceraldehyde 3-Phosphate dehydrogenase on tolerance of plants to water-Deficit stress. Plant Cell Tissue Organ Cult. (PCTOC) 2015, 121, 97–107. [Google Scholar] [CrossRef]
- Snyman, M.; Cronjé, M. Modulation of heat shock factors accompanies salicylic acid-mediated potentiation of Hsp70 in tomato seedlings. J. Exp. Bot. 2008, 59, 2125–2132. [Google Scholar] [CrossRef] [Green Version]
- Sharma, L.; Priya, M.; Kaushal, N.; Bhandhari, K.; Chaudhary, S.; Dhankher, O.P.; Prasad, P.V.; Siddique, K.H.; Nayyar, H. Plant growth-Regulating molecules as thermoprotectants: Functional relevance and prospects for improving heat tolerance in food crops. J. Exp. Bot. 2019, 71, 569–594. [Google Scholar] [CrossRef] [PubMed]
- Lee, B.-R.; Islam, M.T.; Park, S.-H.; Lee, H.; Bae, D.-W.; Kim, T.-H. Antagonistic shifting from abscisic acid-to salicylic acid-mediated sucrose accumulation contributes to drought tolerance in Brassica napus. Environ. Exp. Bot. 2019, 162, 38–47. [Google Scholar]
- Wei, Y.; Liu, G.; Chang, Y.; He, C.; Shi, H. Heat shock transcription factor 3 regulates plant immune response through modulation of salicylic acid accumulation and signalling in cassava. Mol. Plant Pathol. 2018, 19, 2209–2220. [Google Scholar] [CrossRef] [PubMed]
- von Koskull-Döring, P.; Scharf, K.-D.; Nover, L. The diversity of plant heat stress transcription factors. Trends Plant Sci. 2007, 12, 452–457. [Google Scholar] [CrossRef]
- Driedonks, N.; Xu, J.; Peters, J.L.; Park, S.; Rieu, I. Multi-Level interactions between heat shock factors, heat shock proteins, and the redox system regulate acclimation to heat. Front. Plant Sci. 2015, 6, 999. [Google Scholar] [CrossRef] [Green Version]
Gene Name | Description | Primer Sequence (5′–3′) | Size (bp) | Accession |
---|---|---|---|---|
GAPDH | NADP-dependentglyceraldehyde-3-phosphatedehydrogenase | F: TTTGGACCAGTCTTGCCAGTAA R: TGCAGTGATGGATACCTTCTTCA | 61 | XM_008801419.1 |
Cyt-Cu/Zn SOD | superoxide dismutase [Cu-Zn]-like | F: AAGCCTCTCTGGCCTCGAA R: CACCGAGGGCATGAACATG | 56 | XM_008813474.1 |
GPX2 | glutathione peroxidase | F: GGAAGAACGCTGCACCCCTAT R: GCTCCATGACCTTGCCATCTTT | 120 | XP_008790151.1 |
CAT | Catalase | F:TTCTTCTCACACCACCCAGAG R: GTTCACGCCAAAACCATCCA | 102 | XP_026656046.1 |
PYL8 | abscisic acid receptor PYL8-like | F: CAGCACCGAAAGGTTGGAGTTT R: GATGGAGGGTAATGATGGAGGA | 110 | XM_008791563.3 |
PYL4 | abscisic acid receptor PYL4-like | F: CGTCGAGTCCTACGTTGTCG R: GCCAGGTTCTCGGAGGTATG | 120 | XM_008801643.3 |
PYR1 | abscisic acid receptor PYR1 | F: ACGGTGGTGCTGGAATCGTA R: GAGGCGAGCTTCTGGAGGTT | 110 | NW_008246541.1 |
HSTF-A5 | heat stress transcription factor A-5-like | F: CTCCTCCCCGCCTACTTCAA R: GCGAACTCCCATCTCTCTGGA | 101 | XP_017700691.1 |
HSF30 | heat shock factor protein HSF30-like | F: CGACGAAACATCTCCCAGAGC R: GCAGTCCCTCCTCAATCTATCAAC | 108 | XP_008775152.1 |
HSTF-A3 | heat stress transcription factor A-3 | F: GCCGTCAAGGTGGAGCTTCTA R: CATCCGAAAACATCCTCTCTGG | 112 | XP_008807524.1 |
Act | Actin | F: TCAATGTGCCTGCCATGTATGT R: GCGGCCGCTAGCATAGAG | 62 | XM_008778129 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khan, A.; Bilal, S.; Khan, A.L.; Imran, M.; Shahzad, R.; Al-Harrasi, A.; Al-Rawahi, A.; Al-Azhri, M.; Mohanta, T.K.; Lee, I.-J. Silicon and Gibberellins: Synergistic Function in Harnessing ABA Signaling and Heat Stress Tolerance in Date Palm (Phoenix dactylifera L.). Plants 2020, 9, 620. https://doi.org/10.3390/plants9050620
Khan A, Bilal S, Khan AL, Imran M, Shahzad R, Al-Harrasi A, Al-Rawahi A, Al-Azhri M, Mohanta TK, Lee I-J. Silicon and Gibberellins: Synergistic Function in Harnessing ABA Signaling and Heat Stress Tolerance in Date Palm (Phoenix dactylifera L.). Plants. 2020; 9(5):620. https://doi.org/10.3390/plants9050620
Chicago/Turabian StyleKhan, Adil, Saqib Bilal, Abdul Latif Khan, Muhammad Imran, Raheem Shahzad, Ahmed Al-Harrasi, Ahmed Al-Rawahi, Masood Al-Azhri, Tapan Kumar Mohanta, and In-Jung Lee. 2020. "Silicon and Gibberellins: Synergistic Function in Harnessing ABA Signaling and Heat Stress Tolerance in Date Palm (Phoenix dactylifera L.)" Plants 9, no. 5: 620. https://doi.org/10.3390/plants9050620