Highly Efficient Homozygous CRISPR/Cas9 Gene Editing Based on Single-Cell-Originated Somatic Embryogenesis in Liriodendron tulipifera
Abstract
1. Introduction
2. Results
2.1. L. tulipifera LtPDS Gene Cloning and Target Site Selection
2.2. Comparative Analysis of Phenotypes in Different CRISPR Systems for Transient Transformation
2.3. Phenotype of CRISPR/Cas9 LtPDS-Targeted Liriodendron for Stable Transformation
2.4. Characterization of LtPDS Gene-Targeted Edits
3. Materials and Methods
3.1. Plant Materials and Culture Conditions
3.2. Cloning of the LtPDS Gene and Selection of Target Sites
3.3. Vector Construction
3.4. Transient Transformation of Liriodendron Seedlings
3.5. Stable Transformation of Embryogenic Callus
3.6. Identification of Positive Lines and Detection of Mutations
4. Discussion
4.1. The Application of Different Genetic Transformation Systems in the Genetic Editing of Woody Plants
4.2. Utilizing the Somatic Embryogenesis System Based on a Single-Cell Origin for Gene Editing Can Result in Homozygous Mutants
4.3. Gene-Editing Vector Optimization
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gaj, T.; Gersbach, C.A.; Barbas, C.F., 3rd. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 2013, 31, 397–405. [Google Scholar] [CrossRef] [PubMed]
- Mussolino, C.; Cathomen, T. RNA guides genome engineering. Nat. Biotechnol. 2013, 31, 208–209. [Google Scholar] [CrossRef] [PubMed]
- Cong, L.; Ran, F.A.; Cox, D.; Lin, S.; Barretto, R.; Habib, N.; Hsu, P.D.; Wu, X.; Jiang, W.; Marraffini, L.A.; et al. Multiplex Genome Engineering Using CRISPR/Cas Systems. Science 2013, 339, 819–823. [Google Scholar] [CrossRef] [PubMed]
- Xie, K.; Minkenberg, B.; Yang, Y. Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc. Natl. Acad. Sci. USA 2015, 112, 3570–3575. [Google Scholar] [CrossRef]
- Chen, J.; Hao, Z.; Guang, X.; Zhao, C.; Wang, P.; Xue, L.; Zhu, Q.; Yang, L.; Sheng, Y.; Zhou, Y.; et al. Liriodendron genome sheds light on angiosperm phylogeny and species-pair differentiation. Nat. Plants 2019, 5, 18–25. [Google Scholar] [CrossRef]
- Chen, J.; Shi, J.; Zhuge, Q.; Huang, M. Studies on the somatic embryogenesis of Liriodendron hybrids (L. chinense × L. tulipifera). Sci. Silvae Sin. 2003, 39, 282–285. [Google Scholar]
- Yang, L.; Li, Y.; Shen, H. Somatic embryogenesis and plant regeneration from immature zygotic embryo cultures of mountain ash (Sorbus pohuashanensis). Plant Cell Tissue Organ Cult. (PCTOC) 2012, 109, 547–556. [Google Scholar] [CrossRef]
- Chen, J.; Zhang, Y.; Li, T.; Wang, P.; Wang, G.; Shi, J. Study on origin and development of somatic embryos of Liriodendron hybrids. J. Nanjing For. Univ. (Nat. Sci. Ed.) 2012, 36, 16–20. [Google Scholar]
- Li, M.; Wang, D.; Long, X.; Hao, Z.; Lu, Y.; Zhou, Y.; Peng, Y.; Cheng, T.; Shi, J.; Chen, J. Agrobacterium-Mediated Genetic Transformation of Embryogenic Callus in a Liriodendron Hybrid (L. chinense × L. tulipifera). Front. Plant Sci. 2022, 13, 802128. [Google Scholar] [CrossRef]
- Long, X.; Zhang, J.; Wang, D.; Weng, Y.; Liu, S.; Li, M.; Hao, Z.; Cheng, T.; Shi, J.; Chen, J. Expression dynamics of WOX homeodomain transcription factors during somatic embryogenesis in Liriodendron hybrids. For. Res. 2023, 3, 15. [Google Scholar] [CrossRef]
- Hao, Z.; Ma, X.; Wang, D.; Lu, Y.; Shi, J.; Chen, J. Cloning of the Liriodendron chinense LcPIN1a genes and its effect on plant growth and development. J. Nanjing For. Univ. (Nat. Sci. Ed.) 2024, 48, 10. [Google Scholar] [CrossRef]
- Chen, X.; Liu, Y.; Lu, L.; Liu, S.; Weng, Y.; Shi, J.; Hao, Z.; Chen, J. Establishment of a glucocorticoid inducible system for regulating somatic embryogenesis in Liriodendron hybrids. For. Res. 2024, 4, e006. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Ma, X.; Xie, X.; Liu, Y.G. CRISPR/Cas9-Based Genome Editing in Plants. Prog. Mol. Biol. Transl. Sci. 2017, 149, 133–150. [Google Scholar] [CrossRef] [PubMed]
- Qin, G.; Gu, H.; Ma, L.; Peng, Y.; Deng, X.W.; Chen, Z.; Qu, L.-J. Disruption of phytoene desaturase gene results in albino and dwarf phenotypes in Arabidopsis by impairing chlorophyll, carotenoid, and gibberellin biosynthesis. Cell Res. 2007, 17, 471–482. [Google Scholar] [CrossRef]
- Chen, T.; Zhang, Y.; Zhao, L.; Zhu, Z.; Lin, J.; Zhang, S.; Wang, C. Physiological character and gene mapping in a new green- revertible albino mutant in rice. J. Genet. Genom. 2007, 34, 331–338. [Google Scholar] [CrossRef]
- Shan, Q.; Wang, Y.; Li, J.; Zhang, Y.; Chen, K.; Liang, Z.; Zhang, K.; Liu, J.; Xi, J.J.; Qiu, J.-L.; et al. Targeted genome modification of crop plants using a CRISPR-Cas system. Nat. Biotechnol. 2013, 31, 686–688. [Google Scholar] [CrossRef]
- Pennisi, E. The CRISPR Craze. Science 2013, 341, 833–836. [Google Scholar] [CrossRef]
- Li, J.F.; Norville, J.E.; Aach, J.; McCormack, M.; Zhang, D.; Bush, J.; Church, G.M.; Sheen, J. Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat. Biotechnol. 2013, 31, 688–691. [Google Scholar] [CrossRef]
- Nekrasov, V.; Staskawicz, B.; Weigel, D.; Jones, J.D.G.; Kamoun, S. Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat. Biotechnol. 2013, 31, 691–693. [Google Scholar] [CrossRef]
- Feng, Z.; Zhang, B.; Ding, W.; Liu, X.; Yang, D.-L.; Wei, P.; Cao, F.; Zhu, S.; Zhang, F.; Mao, Y.; et al. Efficient genome editing in plants using a CRISPR/Cas system. Cell Res. 2013, 23, 1229–1232. [Google Scholar] [CrossRef]
- Fan, D.; Liu, T.; Li, C.; Jiao, B.; Li, S.; Hou, Y.; Luo, K. Efficient CRISPR/Cas9-mediated Targeted Mutagenesis in Populus in the First Generation. Sci. Rep. 2015, 5, 12217. [Google Scholar] [CrossRef] [PubMed]
- Ding, L.; Chen, Y.; Ma, Y.; Wang, H.; Wei, J. Effective reduction in chimeric mutants of poplar trees produced by CRISPR/Cas9 through a second round of shoot regeneration. Plant Biotechnol. Rep. 2020, 14, 549–558. [Google Scholar] [CrossRef]
- Wang, J.; Wu, H.; Chen, Y.; Yin, T. Efficient CRISPR/Cas9-Mediated Gene Editing in an Interspecific Hybrid Poplar With a Highly Heterozygous Genome. Front. Plant Sci. 2020, 11, 996. [Google Scholar] [CrossRef] [PubMed]
- Poovaiah, C.; Phillips, L.; Geddes, B.; Reeves, C.; Sorieul, M.; Thorlby, G. Genome editing with CRISPR/Cas9 in Pinus radiata (D. Don). BMC Plant Biol. 2021, 21, 363. [Google Scholar] [CrossRef]
- Nishitani, C.; Hirai, N.; Komori, S.; Wada, M.; Okada, K.; Osakabe, K.; Yamamoto, T.; Osakabe, Y. Efficient Genome Editing in Apple Using a CRISPR/Cas9 system. Sci. Rep. 2016, 6, 31481. [Google Scholar] [CrossRef]
- Bewg, W.P.; Ci, D.; Tsai, C.J. Genome Editing in Trees: From Multiple Repair Pathways to Long-Term Stability. Front. Plant Sci. 2018, 9, 1732. [Google Scholar] [CrossRef]
- Naim, F.; Dugdale, B.; Kleidon, J.; Brinin, A.; Shand, K.; Waterhouse, P.; Dale, J. Gene editing the phytoene desaturase alleles of Cavendish banana using CRISPR/Cas9. Transgenic Res. 2018, 27, 451–460. [Google Scholar] [CrossRef]
- Wang, X.; Tu, M.; Wang, D.; Liu, J.; Li, Y.; Li, Z.; Wang, Y.; Wang, X. CRISPR/Cas9-mediated efficient targeted mutagenesis in grape in the first generation. Plant Biotechnol. J. 2018, 16, 844–855. [Google Scholar] [CrossRef]
- Ma, X.; Liu, Y.G. CRISPR/Cas9-Based Multiplex Genome Editing in Monocot and Dicot Plants. Curr. Protoc. Mol. Biol. 2016, 115, 31601–31621. [Google Scholar] [CrossRef]
- Zang, D.; Wang, L.; Zhang, Y.; Zhao, H.; Wang, Y. ThDof1.4 and ThZFP1 constitute a transcriptional regulatory cascade involved in salt or osmotic stress in Tamarix hispida. Plant Mol. Biol. 2017, 94, 495–507. [Google Scholar] [CrossRef]
- Jia, H.; Wang, N. Targeted genome editing of sweet orange using Cas9/sgRNA. PLoS ONE 2014, 9, e93806. [Google Scholar] [CrossRef] [PubMed]
- Fan, Y.; Xin, S.; Dai, X.; Yang, X.; Huang, H.; Hua, Y. Efficient genome editing of rubber tree (hevea brasiliensis) protoplasts using CRISPR/Cas9 ribonucleoproteins. Ind. Crops Prod. 2020, 146, 112146. [Google Scholar] [CrossRef]
- Odipio, J.; Alicai, T.; Ingelbrecht, I.; Nusinow, D.A.; Bart, R.; Taylor, N.J. Efficient CRISPR/Cas9 Genome Editing of Phytoene desaturase in Cassava. Front. Plant Sci. 2017, 8, 1780. [Google Scholar] [CrossRef] [PubMed]
- Ren, C.; Liu, X.; Zhang, Z.; Wang, Y.; Duan, W.; Li, S.; Liang, Z. CRISPR/Cas9-mediated efficient targeted mutagenesis in Chardonnay (Vitis vinifera L.). Sci. Rep. 2016, 6, 32289. [Google Scholar] [CrossRef]
- Wang, Z.; Wang, S.; Li, D.; Zhang, Q.; Li, L.; Zhong, C.; Liu, Y.; Huang, H. Optimized paired-sgRNA/Cas9 cloning and expression cassette triggers high-efficiency multiplex genome editing in kiwifruit. Plant Biotechnol. J. 2018, 16, 1424–1433. [Google Scholar] [CrossRef]
- Ye, S.; Chen, G.; Kohnen, M.V.; Wang, W.; Cai, C.; Ding, W.; Wu, C.; Gu, L.; Zheng, Y.; Ma, X.; et al. Robust CRISPR/Cas9 mediated genome editing and its application in manipulating plant height in the first generation of hexaploid Ma bamboo (Dendrocalamus latiflorus munro). Plant Biotechnol. J. 2020, 18, 1501–1503. [Google Scholar] [CrossRef]
- Ming, M.; Long, H.; Ye, Z.; Pan, C.; Chen, J.; Tian, R.; Sun, C.; Xue, Y.; Zhang, Y.; Li, J.; et al. Highly efficient CRISPR systems for loss-of-function and gain-of-function research in pear calli. Hortic. Res. 2022, 9, uhac148. [Google Scholar] [CrossRef]




| Transgenic Lines | Mutation Efficiency | ||
|---|---|---|---|
| T1 | T2 | T3 | |
| 1 | 100% | 30% | 0% |
| 2 | 100% | 40% | 0% |
| 3 | 30% | 0% | 0% |
| 4 | 100% | 60% | 0% |
| 5 | 20% | 0% | 0% |
| 6 | 40% | 0% | 0% |
| 7 | 60% | 0% | 0% |
| Target Site | Sequence | Mutation Type | Number of Reads | Mutation Proportion | Genome-Editing Type | |
|---|---|---|---|---|---|---|
| pds-1 | T1 | ACAGGACGCCAGCCCTTTGAAGG | - | 311 | 1.73% | homozygous |
| ACAGGACGCCAGCCCTT------ | Deletion | 17,554 | 97.43% | |||
| T2 | AGGTTTGGCTGGACTGTCAACGG | - | 2079 | 15.03% | chimeric | |
| AGGTTTGGCTGGACT-------- | Deletion | 8590 | 62.09% | |||
| AGGTTTGGCTGGAC--------- | Deletion | 2955 | 21.36% | |||
| T3 | GCCAAACAAGTTCTGCACGTTGG | - | 5732 | 100% | no mutation | |
| pds-2 | T1 | ACAGGACGCCAGCCCTTTGAAGG | - | 1595 | 9.88% | homozygous |
| ACAGGACGCCAGCCCTT------ | Deletion | 14,374 | 89.05% | |||
| T2 | AGGTTTGGCTGGACTGTCAACGG | - | 5432 | 49.64% | heterozygous | |
| AGGTTTGGCTGGACT-------- | Deletion | 4576 | 41.82% | |||
| AGGTTTGGCTGGACTGT------ | Deletion | 311 | 2.84% | |||
| AGGTTTGGCTGGACTG------- | Deletion | 276 | 2.52% | |||
| AGGTTTGGCTGGACTGGCAACGG | Mismatch | 140 | 1.28% | |||
| T3 | GCCAAACAAGTTCTGCACGTTGG | - | 7764 | 100% | no mutation | |
| pds-3 | T1 | ACAGGACGCCAGCCCTTTGAAGG | - | 895 | 5.01% | homozygous |
| ACAGGACGCCAGCCCTT------ | Deletion | 16,786 | 93.98% | |||
| T2 | AGGTTTGGCTGGACTGTCAACGG | - | 5277 | 40.36% | chimeric | |
| AGGTTTGGCTGGACT-------- | Deletion | 4666 | 35.69% | |||
| AGGTTTGGCTGGACTG------- | Deletion | 2669 | 20.41% | |||
| AGGTTTGGCTGGACTGT------ | Deletion | 279 | 2.13% | |||
| T3 | GCCAAACAAGTTCTGCACGTTGG | - | 7356 | 100% | no mutation | |
| pds-4 | T1 | ACAGGACGCCAGCCCTTTGAAGG | - | 929 | 7.08% | homozygous |
| ACAGGACGCCAGCCCTT------ | Deletion | 12,076 | 91.97% | |||
| T2 | AGGTTTGGCTGGACTGTCAACGG | - | 5406 | 37.76% | chimeric | |
| AGGTTTGGCTGGACT-------- | Deletion | 5058 | 35.33% | |||
| AGGTTTGGCTGGACTG------- | Deletion | 3429 | 23.95% | |||
| AGGTTTGGCTGGACTGT------ | Deletion | 231 | 1.61% | |||
| T3 | GCCAAACAAGTTCTGCACGTTGG | - | 7274 | 100% | no mutation | |
| callus | T1 | ACAGGACGCCAGCCCTTTGAAGG | - | 163 | 0.92% | homozygous |
| ACAGGACGCCAGCCCTT------ | Deletion | 17,371 | 98.44% | |||
| T2 | AGGTTTGGCTGGACTGTCAACGG | - | 11,759 | 74.94% | heterozygous | |
| AGGTTTGGCTGGACTG------- | Deletion | 3785 | 24.12% | |||
| T3 | GCCAAACAAGTTCTGCACGTTGG | - | 8048 | 100% | no mutation |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, C.; Jiang, P.; Zhang, J.; Yang, D.; Lu, L.; Hao, Z.; Ma, Y.; Shi, J.; Chen, J. Highly Efficient Homozygous CRISPR/Cas9 Gene Editing Based on Single-Cell-Originated Somatic Embryogenesis in Liriodendron tulipifera. Plants 2025, 14, 472. https://doi.org/10.3390/plants14030472
Li C, Jiang P, Zhang J, Yang D, Lu L, Hao Z, Ma Y, Shi J, Chen J. Highly Efficient Homozygous CRISPR/Cas9 Gene Editing Based on Single-Cell-Originated Somatic Embryogenesis in Liriodendron tulipifera. Plants. 2025; 14(3):472. https://doi.org/10.3390/plants14030472
Chicago/Turabian StyleLi, Cairong, Pengshuo Jiang, Jiaji Zhang, Dingjie Yang, Lu Lu, Zhaodong Hao, Yingxuan Ma, Jisen Shi, and Jinhui Chen. 2025. "Highly Efficient Homozygous CRISPR/Cas9 Gene Editing Based on Single-Cell-Originated Somatic Embryogenesis in Liriodendron tulipifera" Plants 14, no. 3: 472. https://doi.org/10.3390/plants14030472
APA StyleLi, C., Jiang, P., Zhang, J., Yang, D., Lu, L., Hao, Z., Ma, Y., Shi, J., & Chen, J. (2025). Highly Efficient Homozygous CRISPR/Cas9 Gene Editing Based on Single-Cell-Originated Somatic Embryogenesis in Liriodendron tulipifera. Plants, 14(3), 472. https://doi.org/10.3390/plants14030472

