Silicon Nutrition Improves Lodging Resistance of Rice Under Dry Cultivation
Abstract
1. Introduction
2. Results
2.1. Grain Yield and Lodging Index
2.2. Internode Length and Center of Gravity Height
2.3. Material Accumulation and Distribution
2.4. Cross-Sectional Structure of Stem and Plant Hormone Content

2.5. Carbohydrate and Silicon Content and Gene Expression Levels in the Second Internode
2.6. Root Architecture and Hormone Content
3. Discussion
3.1. The Effect of Silicon on the Yield and Lodging Index of Rice Under Dry Cultivation
3.2. The Effect of Silicon Nutrition on Stem and Leaf Growth and Weight Distribution of Rice Under Dry Cultivation
3.3. The Effect of Silicon on Root Architecture and Plant Hormones of Rice Under Dry Cultivation
4. Materials and Methods
4.1. Site Description
4.2. Experimental Design and Crop Management
4.3. Sampling and Measurements
4.3.1. Yield
4.3.2. Mechanical and Morphological Characteristics of Stem
Mechanical Characteristics of Stem
Stem Morphological Characteristics
4.3.3. Stem Carbohydrates and Silicon Content
Carbohydrate Content
Silicon Content
4.3.4. Root Architecture
4.3.5. Hormone Content
4.3.6. Gene Expression Level
4.3.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Appendix A
| Gene Names | Primer | Product Size |
|---|---|---|
| CAD7 | F: CAAGCACATCCATGCACTCT | 168 bp |
| R: TCATCTCCTGCGTTTCACTG | ||
| PAL | F: AGCTTGGACTACGGCTTCAA | 201 bp |
| R: GAGGAAGGTGGAGGACATGA | ||
| COMT | F: GCCATCCTGATGAAGTGGAT | 233 bp |
| R: AGCTCCCTGAACTCCCTCTC | ||
| CesA4 | F: AGGCAAGCGCTCTATGGTTA | 208 bp |
| R: GCATCGAGCGTTCATACTCA |
Appendix B

References
- Aditi, G.; Andrés, R.; Caño-Delgado, A.I. The physiology of plant responses to drought. Science 2020, 368, 266–269. [Google Scholar]
- Maryam, S. Global water shortage and potable water safety; Today’s concern and tomorrow’s crisis. Environ. Int. 2021, 158, 106936. [Google Scholar]
- Jiang, H.; Xing, X.; Meng, X.; Chen, J.L.; Yu, K.; Xu, X.T.; Zhang, R.; Wei, Z.H.; Wang, D.C.; Cang, B.F.; et al. Research progress in water-saving cultivation of rice in China. Crop Sci. 2023, 63, 2623–2635. [Google Scholar] [CrossRef] [Scilit]
- Jiang, H.; Xu, X.T.; Sun, A.R.; Bai, C.Y.; Li, Y.Z.; Nuo, M.; Shen, X.R.; Li, W.C.; Wang, D.C.; Tian, P.; et al. Silicon nutrition improves the quality and yield of rice under dry cultivation. J. Sci. Food Agric. 2023, 104, 1897–1908. [Google Scholar] [CrossRef] [Scilit]
- Jiang, H.; Song, Z.; Su, Q.W.; Wei, Z.H.; Li, W.C.; Jiang, Z.X.; Tian, P.; Wang, Z.H.; Yang, X.; Yang, M.Y.; et al. Transcriptomic and metabolomic reveals silicon enhances adaptation of rice under dry cultivation by improving flavonoid biosynthesis, osmoregulation, and photosynthesis. Front. Plant Sci. 2022, 13, 967537. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Shen, X.R.; Bai, C.Y.; Zhuang, Z.X.; Jiang, H.; Yang, M.Y.; Wei, X.S.; Wu, Z.H. Metabolomic study on the quality differences and physiological characteristics between rice cultivated in drought and flood conditions. Food Chem. 2023, 425, 135946. [Google Scholar] [CrossRef] [Scilit]
- Wei, X.S.; Cang, B.F.; Yu, K.; Li, W.C.; Tian, P.; Han, X.; Wang, G.; Di, Y.T.; Wu, Z.H.; Yang, M.Y. Physiological Characterization of Drought Responses and Screening of Rice Varieties under Dry Cultivation. Agronomy 2022, 12, 2849. [Google Scholar] [CrossRef] [Scilit]
- Jiang, H.; Thobakgale, T.; Li, Y.Z.; Liu, L.W.; Su, Q.W.; Cang, B.F.; Bai, C.Y.; Li, J.Y.; Song, Z.; Wu, M.K.; et al. Construction of dominant rice population under dry cultivation by seeding rate and nitrogen rate interaction. Sci. Rep. 2021, 11, 7189. [Google Scholar] [CrossRef] [Scilit]
- Zhang, M.W.; Wang, H.; Yi, Y.; Ding, J.F.; Zhu, M.; Li, C.Y.; Guo, W.S.; Feng, C.N.; Zhu, X.K. Effect of nitrogen levels and nitrogen ratios on lodging resistance and yield potential of winter wheat (Triticum aestivum L.). PLoS ONE 2017, 12, e0187543. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.J.; Wu, L.M.; Wu, X.R.; Ding, Y.F.; Li, G.H.; Li, J.Y.; Weng, F.; Liu, Z.H.; Tang, S.; Ding, C.Q.; et al. Lodging Resistance of Japonica Rice (Oryza sativa L.): Morphological and Anatomical Traits due to top-Dressing Nitrogen Application Rates. Rice 2016, 9, 31. [Google Scholar] [CrossRef] [Scilit]
- Muhammad, A.; Hao, H.; Xue, Y.; Alam, A.; Bai, S.M.; Hu, W.C.; Sajid, M.; Hu, Z.; Samad, R.A.; Li, Z.H.; et al. Survey of wheat straw stem characteristics for enhanced resistance to lodging. Cellulose 2020, 27, 2469–2484. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.X.; Yu, C.S.; Lin, J.Z.; Liu, J.; Liu, B.; Wang, J.; Huang, A.B.; Li, H.Y.; Zhao, T. OsMPH1 regulates plant height and improves grain yield in rice. PLoS ONE 2017, 12, e0180825. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, M.; Tao, Z.; Lei, T.; Cao, F.B.; Chen, J.N.; Yin, X.H.; Zou, Y.B.; Liang, T.F. Improving lodging resistance while maintaining high grain yield by promoting pre-heading growth in rice. Field Crops Res. 2021, 270, 108212. [Google Scholar] [CrossRef] [Scilit]
- Li, W.Q.; Han, M.M.; Pang, D.W.; Chen, J.; Wang, Y.Y.; Dong, H.H.; Chang, Y.L.; Jin, M.; Luo, Y.L.; Li, Y.; et al. Characteristics of lodging resistance of high-yield winter wheat as affected by nitrogen rate and irrigation managements. J. Integr. Agric. 2022, 21, 1290–1309. [Google Scholar] [CrossRef] [Scilit]
- Wu, M.K.; Jiang, H.; Wei, Z.H.; Li, W.C.; Gao, K.Y.; Wang, D.C.; Wei, X.S.; Tian, P.; Cui, J.J.; Di, Y.T.; et al. Influence of Nitrogen Application Rate on Stem Lodging Resistance Rice under Dry Cultivation. Agronomy 2023, 13, 426. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Li, G.H.; Song, Y.P.; Liu, Z.H.; Yang, C.D.; Tang, S.; Zheng, C.Y.; Wang, S.H.; Ding, Y.F. Lodging resistance characteristics of high-yielding rice populations. Field Crops Res. 2014, 161, 64–74. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.J.; Dai, L.; Cheng, S.R.; Ren, Y.; Deng, H.Z.; Wang, X.Y.; Li, Y.Z.; Tang, X.R.; Wang, Z.M.; Mo, Z.W. Regulation of 2-acetyl-1-pyrroline and grain quality in early-season indica fragrant rice by nitrogen and silicon fertilization under different plantation methods. J. Integr. Agric. 2024, 23, 511–535. [Google Scholar] [CrossRef] [Scilit]
- de Tombeur, F.; Turner, B.L.; Laliberté, E.; Lambers, H.; Mahy, G.; Faucon, M.P.; Zemunik, G.; Cornelis, J.T. Plants sustain the terrestrial silicon cycle during ecosystem retrogression. Science 2020, 369, 1245–1248. [Google Scholar] [CrossRef] [Scilit]
- Liang, Y.C. Beneficial roles silicon plays in agriculture. J. Integr. Agric. 2018, 17, 2137. [Google Scholar] [CrossRef] [Scilit]
- Ma, J.F.; Tamai, K.; Yamaji, N.; Mitani, N.; Konishi, S.; Katsuhara, M.; Ishiguro, M.; Murata, Y.; Yano, M. A silicon transporter in rice. Nature 2006, 440, 688–691. [Google Scholar] [CrossRef] [Scilit]
- Bhat, J.A.; Shivaraj, S.M.; Singh, P.; Navadagi, D.B.; Tripathi, D.K.; Dash, P.K.; Solanke, A.U.; Sonah, H.; Deshmukh, R. Role of Silicon in Mitigation of Heavy Metal Stresses in Crop Plants. Plants 2019, 8, 71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuai, J.; Sun, Y.Y.; Guo, C.; Zhao, L.; Zuo, Q.S.; Wu, J.S.; Zhou, G.S. Root-applied silicon in the early bud stage increases the rapeseed yield and optimizes the mechanical harvesting characteristics. Field Crops Res. 2017, 200, 88–97. [Google Scholar] [CrossRef] [Scilit]
- Zhao, D.Q.; Xu, C.; Luan, Y.T.; Shi, W.B.; Tang, Y.H.; Tao, J. Silicon enhances stem strength by promoting lignin accumulation in herbaceous peony (Paeonia lactiflora Pall.). Int. J. Biol. Macromol. 2021, 190, 769–779. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, T.Y.; Cui, R.L.; Shu, C.C.; Zhu, K.Y.; Zhang, W.Y.; Zhang, H.; Liu, L.J.; Wang, Z.Q.; Gu, J.F.; Yang, J.C. Combining urea and controlled release nitrogen fertilizer to enhance lodging resistance of rice (Oryza sativa L.) by altering accumulation of silicon and cell wall polymers at high yielding levels. Field Crops Res. 2024, 315, 109459. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Wei, H.B.; Ma, M.D.; Li, Q.Q.; Kong, D.X.; Sun, J.; Ma, X.J.; Wang, B.B.; Chen, C.X.; Xie, Y.R.; et al. Arabidopsis FHY3 and FAR1 Regulate the Balance between Growth and Defense Responses under Shade Conditions. Plant Cell 2019, 31, 2089–2106. [Google Scholar] [CrossRef] [Scilit]
- Wu, W.; Ma, B.L.; Fan, J.J.; Sun, M.; Yi, Y.; Guo, W.S.; Harvey, D.V. Management of nitrogen fertilization to balance reducing lodging risk and increasing yield and protein content in spring wheat. Field Crops Res. 2019, 241, 107584. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Hu, D.; Liu, X.B.; She, H.Z.; Ruan, R.W.; Yang, H.; Yi, Z.L.; Wu, D.Q. Effects of uniconazole on the lignin metabolism and lodging resistance of culm in common buckwheat (Fagopyrum esculentum M.). Field Crops Res. 2015, 180, 46–53. [Google Scholar] [CrossRef] [Scilit]
- Kashiwagi, T.; Hirotsu, N.; Ujiie, K.; Ishimaru, K. Lodging resistance locus prl5 improves physical strength of the lower plant part under different conditions of fertilization in rice (Oryza sativa L.). Field Crops Res. 2010, 115, 107–115. [Google Scholar] [CrossRef] [Scilit]
- Qin, R.J.; Christos, N.; Don, W.; Liang, X.; Wang, G.J.; Scott, L. Application of Plant Growth Regulators on Soft White Winter Wheat under Different Nitrogen Fertilizer Scenarios in Irrigated Fields. Agriculture 2020, 10, 305. [Google Scholar] [CrossRef] [Scilit]
- Li, F.C.; Xie, G.S.; Huang, J.F.; Zhang, R.; Li, Y.; Zhang, M.M.; Wang, Y.T.; Li, A.; Li, X.K.; Xia, T.; et al. OsCESA9 conserved-site mutation leads to largely enhanced plant lodging resistance and biomass enzymatic saccharification by reducing cellulose DP and crystallinity in rice. Plant Biotechnol. J. 2017, 15, 1093–1104. [Google Scholar] [CrossRef] [Scilit]
- Liu, W.G.; Deng, Y.C.; Sajad, H.; Zou, J.L.; Yuan, J.; Luo, L.; Yang, C.Y.; Yuan, X.Q.; Yang, W.Y. Relationship between cellulose accumulation and lodging resistance in the stem of relay intercropped soybean [Glycine max (L.) Merr.]. Field Crops Res. 2016, 196, 261–267. [Google Scholar] [CrossRef] [Scilit]
- Manga, R.A.; Santiago, R.; Malvar, R.A.; Moreno, G.V.; Fornalé, S.; López, I.; Centeno, M.L.; Acebes, J.L.; Álvarez, J.M.; Caparros, R.D.; et al. Elucidating compositional factors of maize cell walls contributing to stalk strength and lodging resistance. Plant Sci. 2021, 307, 110882. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, W.G.; Ren, M.L.; Liu, T.; Du, Y.L.; Zhou, T.; Liu, X.M.; Liu, J.; Sajad, H.; Yang, W.Y. Effect of shade stress on lignin biosynthesis in soybean stems. J. Integr. Agric. 2018, 17, 1594–1604. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.Z.; Li, C.M.; Huang, R.; Zhang, K.; Wang, Q.; Fu, C.Y.; Liu, W.G.; Sun, C.H.; Wang, P.R.; Wang, F.; et al. Rice Brittle Culm19 Encoding Cellulose Synthase Subunit CESA4 Causes Dominant Brittle Phenotype But has No Distinct Influence on Growth and Grain Yield. Rice 2021, 14, 95. [Google Scholar] [CrossRef] [Scilit]
- Zhang, P.; Yan, Y.; Gu, S.C.; Wang, Y.Y.; Xu, C.L.; Sheng, D.C.; Li, Y.B.; Wang, P.; Huang, S.B. Lodging resistance in maize: A function of root–shoot interactions. Eur. J. Agron. 2022, 132, 126393. [Google Scholar] [CrossRef] [Scilit]
- Jamin, A.; Mohammad, M.; James, O.; Nancy, D.; Riyazuddin, R.; Hamed, A.G.; Khalid, A.K.; Chen, R.Z.; Daniel, K.; Ahmet, B. Harnessing Phytohormones: Advancing Plant Growth and Defence Strategies for Sustainable Agriculture. Physiol. Plantarum. 2024, 176, e14307. [Google Scholar]
- Zhao, J.Z.; Wang, J.Q.; Liu, J.; Zhang, P.H.; Guzel, K.; Liu, C.J.; Zhang, K.W. Spatially Distributed Cytokinins: Metabolism, Signaling, and Transport. Plant Commun. 2024, 5, 100936. [Google Scholar] [CrossRef] [Scilit]
- Zhai, N.; Xu, L. Pluripotency acquisition in the middle cell layer of callus is required for organ regeneration. Nat. Plants 2021, 7, 1453–1460. [Google Scholar] [CrossRef] [Scilit]
- DuBois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 2002, 28, 350–356. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.J.; Li, G.H.; Yang, Y.M.; Li, Q.; Zhang, J.; Liu, J.Y.; Wang, S.H.; Tang, S.; Ding, Y.F. Effects of Nitrogen Application Rate and Ratio on Lodging Resistance of Super Rice with Different Genotypes. J. Integr. Agric. 2013, 13, 63–72. [Google Scholar] [CrossRef] [Scilit]
- Ishimaru, K.; Togawa, E.; Ookawa, T.; Kashiwagi, T.; Madoka, Y.; Hirotsu, N. New target for rice lodging resistance and its effect in a typhoon. Planta 2008, 227, 601–609. [Google Scholar] [CrossRef] [Scilit]






Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiang, H.; Jiang, Z.; Zhang, H.; Li, Y.; Li, W.; Gao, K.; Ma, X.; Wang, G.; Wei, X.; Wu, Z. Silicon Nutrition Improves Lodging Resistance of Rice Under Dry Cultivation. Plants 2025, 14, 361. https://doi.org/10.3390/plants14030361
Jiang H, Jiang Z, Zhang H, Li Y, Li W, Gao K, Ma X, Wang G, Wei X, Wu Z. Silicon Nutrition Improves Lodging Resistance of Rice Under Dry Cultivation. Plants. 2025; 14(3):361. https://doi.org/10.3390/plants14030361
Chicago/Turabian StyleJiang, Hao, Zixian Jiang, Hongcheng Zhang, Yunzhe Li, Wanchun Li, Kaiyu Gao, Xintong Ma, Guan Wang, Xiaoshuang Wei, and Zhihai Wu. 2025. "Silicon Nutrition Improves Lodging Resistance of Rice Under Dry Cultivation" Plants 14, no. 3: 361. https://doi.org/10.3390/plants14030361
APA StyleJiang, H., Jiang, Z., Zhang, H., Li, Y., Li, W., Gao, K., Ma, X., Wang, G., Wei, X., & Wu, Z. (2025). Silicon Nutrition Improves Lodging Resistance of Rice Under Dry Cultivation. Plants, 14(3), 361. https://doi.org/10.3390/plants14030361

