Next Article in Journal
Evaluation of Blast Resistance in Zinc-Biofortified Rice
Previous Article in Journal
Assessment of Surface Water Quality in the Krynka River Basin Using Fluorescence Spectroscopy Methods
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Under Blue Light Treatment, OsCSN2 Regulates the Phenotype of Rice Seedlings Through the GA Signaling Pathway

1
College of Life Sciences, Jilin Agricultural University, Changchun 130118, China
2
Jilin Institute of Biology, Changchun 130012, China
3
College of Food and Biotechnology, Changchun Polytechnic, Changchun 130033, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Plants 2025, 14(13), 2015; https://doi.org/10.3390/plants14132015
Submission received: 22 May 2025 / Revised: 20 June 2025 / Accepted: 30 June 2025 / Published: 1 July 2025
(This article belongs to the Section Plant Physiology and Metabolism)

Abstract

Blue light is a significant environmental cue influencing plant photomorphogenesis and regulating plant growth and development. The COP9 signaling complex (CSN), a multi-subunit protein complex, plays a pivotal role in regulating photomorphogenesis, with CSN2 being identified as a key subunit essential for the assembly and function of the CSN. This study investigated the role of OsCSN2 in rice under blue-light conditions. Utilizing OsCSN2 knockout (KO) mutant plants and transgenic overexpression (OE) lines for wild-type (WT) and mutated versions of OsCSN2, we observed significant suppression of the overall seedling phenotype under blue light, indicating that OsCSN2 acts as a negative regulator of blue light-mediated morphogenesis. Further analysis revealed that exogenous application of gibberellin (GA3) and the GA synthesis inhibitor paclobutrazol (PAC) modulated seedling elongation in response to blue light, particularly affecting plant height, coleoptile, and first incomplete leaf length without altering root growth. This suggests that OsCSN2 mediates the inhibitory effects of blue light on aboveground development through the gibberellin signaling pathway. On day 9, the analyses of endogenous GA3 levels combined with Western blotting (WB) and quantitative real-time PCR (qRT-PCR) revealed that OsCSN2 senses blue light signals through cryptochrome 2 (CRY2), influences the expression of COP1 and BBX14, and highlights its role in the photoreceptive signaling pathway. This regulation ultimately influences the degradation of SLR1 within the GA signaling pathway, affecting rice seedling growth and development. Our findings also highlight the differential roles of OsCSN1 and OsCSN2 within the CSN in modulating rice seedling photomorphogenesis, thereby providing new insights into the intricate regulatory mechanisms governing plant responses to blue light.

1. Introduction

The COP9 signaling complex (CSN) is a highly conserved protein complex. It was first found in Arabidopsis thaliana (Arabidopsis thaliana (L.) Heynh.) to be an essential regulator that negatively regulates photomorphogenesis [1]. It also participates in plant floral development, defense, and hormone responses [2,3]. Later, it was also found to be involved in the developmental functions of various eukaryotic cells. In plants, it usually comprises eight subunits, which are named CSN1 to CSN8 [1]. CSN2 is the second subunit of the CSN, and it has different names in different species. It is known as Sgn2, TRIP15, and hAlien in humans, COPS2 in mice, and FUS12 in Arabidopsis [3]. In the COP9 signaling complex, CSN2 is considered to be a linker and plays an essential role in the assembly of the complex and substrate recognition [4]. Previous studies revealed that CSN2 in mammals and plants contains a proteasome, COP9, initiation Factor 3 (PCI) domain. The PCI domain contains a pure β-helical domain and is usually located at the C-terminus; it is also present in 26S proteasomes. The lid subunit and eukaryotic translation initiation Factor 3 (eIF3) have catalytic activity [5,6].
In plant physiological processes, protein ubiquitination is a critical post-translational modification of proteins in the signaling regulation process [1]. Ubiquitination and proteasome-mediated protein degradation play essential roles in the growth and development of organisms [1,7]. The 26S proteasome is a giant complex that recognizes ubiquitinated substrates. Each subunit in the CSN is homologous to one of the subunits of the bona fide lid subcomplex of the 26S proteasome. Some researchers have speculated that CSN may replace the bona fide lid subcomplex to affect the proteolytic activities of the 26S proteasome and ubiquitin ligases [1,8]. CSN also acts as a regulator of the Cullin-RING E3s ligases (CRLs), which regulate protein degradation through deoxygenation, thereby affecting various developmental processes in plants. In the SCF subfamily, which includes E3 ligases, the CSN functions as a regulator of Skp-Cullin-F box (SCF) ubiquitin ligases [3,9]. CSN can regulate the activity of many ubiquitin ligases, such as constitutive photomorphogenesis protein 1 (COP1), and both are negative regulators of photomorphogenesis; however, the specific interaction between them remains to be studied further [10]. It is also crucial in the research of the food crop rice (Oryza sativa L.).
Rice is an essential food crop in China, and ensuring the yield of rice is an essential task of economic development in China. Rice is a photoautotrophic organism that uses the absorption of light energy to manufacture organic matter. Light factors are very essential in the whole growth cycle of rice [11]. Rice organic matter accumulation mainly originates from photosynthesis, but the light energy utilization efficiency is very low. Improving the light energy utilization efficiency is also one of the hotspots at present. Studies of light-regulated chlorophyll synthesis have focused on the transition process of seedlings from heterotrophic growth to autotrophic growth under light. Blue light is an essential light source. Blue light can increase the photosynthetic capacity, which is beneficial for controlling plant height. Blue light can affect the photomorphogenesis process of plants and can also increase the chlorophyll a/b ratio [12]. Blue light also has relevant effects on the physiology of rice seedlings. Blue light also affects elongation in tomatoes. Moreover, blue light can stimulate the photosynthetic potential in cucumbers. Increasing the proportion of blue light can increase the photosynthetic capacity of leaves and can improve the accumulation of chlorophyll in hemp in industrial applications; it increased stem diameter, shoot fresh weight, dry weight, and so on [13].
Blue light receptors that sense blue light include cryptochrome (CRY) and phototropin (PHOT), both of which absorb blue light at wavelengths ranging from 315 to 500 nm [14]. CRY exists in the form of a dimer and plays an essential role in biological functions, including the inhibition of hypocotyl elongation by blue light, mainly through the regulation of gene expression [15,16]. Rice contains three CRY family members: OsCRY1a, OsCRY1b, and OsCRY2. CRY participates in various biological responses to blue light. Overexpression of OsCRY1 can lead to significant inhibition of leaves and coleoptiles under blue light [17], inhibition of hypocotyl elongation, and anthocyanin accumulation in Arabidopsis [18]. Plants exhibit phototropism in response to blue light, and PHOT1 is the main photoreceptor involved in the phototropic response [19]. In rice, PHOT has three members, OsPHOT1a, OsPHOT1b, and OsPHOT2, in addition to the presence of blue light receptors such as ZEITLUPE (ZTL) under blue light [15,20]. COP1, which was first screened and characterized in plants for regulation by photoreceptors, is known as a “star protein”, a negative regulator of photomorphogenesis, and a single-protein finger-like E3 ubiquitin ligase [21]. COP1 promotes the degradation of positive regulators of photomorphogenesis such as ELONGATED HYPOCOTYL 5 (HY5), which is driven by the 26S proteasome, and also assembles with CUL4 ubiquitin ligase to form a complex-type CUL4 E3 ubiquitin ligase [21]. Previously reported in the literature, yeast two-hybrid experiments revealed that OsCRY1b and OsCOP1 interact and that both OsCRY1b and OsCOP1 are localized in the nucleus [18]. In rice and Arabidopsis, CRYs inhibit E3 ubiquitin ligases by forming complexes with SPA1 and COP1 in a blue light-dependent manner [16]. The PIFs protein family is an essential member of light signal transduction, and its activity is affected not only by light but also by hormones, such as gibberellic acid and brassinosteroids [22]. PIF4 and PIF5 regulate the blue light response in Arabidopsis through direct interactions with cryptochrome and target genes [16]. The transcription of AtHY5 plays an essential hub role in the regulation of photomorphogenesis. Its homologs in rice are OsbZIP18 and OsbZIP48 [23,24]. The phenotype of the Arabidopsis athy5 mutants was restored after OsbZIP48 gene transfer. However, the height of AtHY5-overexpressing Arabidopsis plants was the same as that of wild-type plants. Sometimes, the plant height of the mutants was even slightly lower than that of the wild type [23]. Under light treatment, the photoreceptor first inhibits COP1 and then HY5, and many proteins are involved in this process of photoreceptor signaling, such as the BBX protein, which is involved in the regulation of photomorphogenesis in seedlings. OsBBX14 is involved in blue light regulation, and OsBBX14 physically interacts with the OsCRY2 protein [25]. Blue light is involved in various signaling pathways and physiological changes, and the light signal transduction pathway is a key research target.
Phytohormones play essential physiological and biochemical roles in the growth of plants, such as gibberellin (GA) and abscisic acid (ABA). GA can promote seed germination and stem elongation [26]. ABA has antagonistic effects on these processes. Previous studies have preliminarily explored the regulatory effect of OsCSN1 mutants on the addition of exogenous hormone GA under blue light, and found that OsCSN1 may mediate the degradation of SLR1 through CUL4 under blue light, affecting the GA signaling pathway to regulate the growth and development of rice seedlings. Both OsCSN1 and OsCSN2 are important constituent subunits of the COP9 signaling complex. This study aims to investigate whether the effects of OsCSN2 mutants on blue light and exogenous hormone GA differ from those of OsCSN1. All knockout and overexpression mutant seeds used in this experiment were obtained from our laboratory. Point mutants were predicted for the OsCSN2 protein sequence and found that the probability of lysine ubiquitination at sites 64, 67, and 104 of OsCSN2 was as high as 90%, and the lysine (K) located at these three different sites was changed to glutamic acid (E) to make it deubiquitinated, a secondary structure comparison between the point mutants and OsCSN2 revealed that each point mutant had an extra β-sheet [27]. This may change its original ubiquitination and affect the degradation of proteins by the ubiquitin–proteasome system. The OsCSN2-related signaling pathways were studied via blue light as well as the addition of the exogenous hormone gibberellin (GA3) and the gibberellin synthesis inhibitor paclobutrazol (PAC). Previously, the gibberellin signaling pathway was reported to sense gibberellin through the GA receptor GID1 to inhibit the degradation of the DELLA protein in the GA signaling pathway [27]. DELLA proteins play a repressive role in GA signaling, and DELLA proteins interact with transcription factors to inhibit the DNA-binding activity of transcription factors and thus repress the expression of target genes; there is only one DELLA protein in rice, namely SLR1 [17]. In rice, OsCSN1 can regulate the nuclear localization of COP1 through the COP9 signaling complex and then degrade SLR1 through the E3 ligase of CUL4 [17], thereby regulating the growth and development of rice seedlings.
In recent years, more studies on CSN2 in animals and Arabidopsis have been reported, but fewer studies have been reported in rice. Studies on the involvement of CSN2 in the regulation of seedling growth and development and relevant studies on blue light signaling pathways are rare. It remains to be explored whether the OsCSN1 subunit has the same function in the blue light and rice GA signaling pathways, which is highly essential for elucidating the regulatory mechanisms of rice growth and development.

2. Results

Wild-type rice Nipponbare (WT), oscsn2-1, oscsn2-2, OsCSN2-OE, OsCSN2K64E-OE, OsCSN2K67E-OE, and OsCSN2K104E-OE plants were grown in media for 9 days, and the rice seedling phenotype was determined. Analysis of the rice seedling phenotypic data revealed that the aboveground parts of rice seedlings were more sensitive to the GA signaling pathway, which was not apparent in the roots. The endogenous hormone contents were determined in different parts of the aboveground 9-day-old rice seedlings. Analysis of the changes in the phenotype of the rice seedlings led to the identification of a preliminary signaling pathway based on the relative expression levels of proteins and genes.

2.1. OsCSN2 Can Negatively Regulate the Inhibitory Effect of Blue Light on the Height of Rice Plants Through the GA Signaling Pathway

Under natural light conditions, oscsn2-1 and oscsn2-2 were significantly higher than the WT. Among the OsCSN2 point mutants, the plant heights of OsCSN2K64E-OE, OsCSN2K67E-OE, and OsCSN2K104E-OE were greater than that of OsCSN2-OE, but those of OsCSN2-OE were shorter than those of the WT (Figure 1A,B). These results suggest that OsCSN2 has an inhibitory effect on plant height elongation in rice. Under blue light irradiation conditions, the plant heights of the WT and OsCSN2 mutants decreased overall and the plant heights of the mutants were all shorter than the WT plant height, but the plant heights of oscsn2-1 and oscsn2-2 were significantly greater than that of OsCSN2-OE (Figure 1A,B); blue light significantly inhibited the increase in plant height. In addition, the endogenous hormone GA3 was measured in the stems of the rice plants. The results revealed that the overall hormone levels decreased significantly, and those of OsCSN2-OE were the lowest (Figure 2A). OsCSN2 may be inhibited by affecting the expression of the endogenous hormone GA3 through blue light. OsCSN2 is a negative regulator of blue light morphogenesis. Under co-treatment with blue light and the exogenous hormone GA3, oscsn2-1, oscsn2-2, and OsCSN2-OE restored plant height under natural light conditions (Figure 1A,B), and the expression of the endogenous hormone GA3 also increased significantly (Figure 2A). In particular, the heights of the plants in the OsCSN2K67E-OE and OsCSN2K104E-OE groups were significantly greater than those in the natural light group (Figure 1A,B). This demonstrated that the application of the exogenous hormone GA3 also promoted endogenous hormone levels in rice seedlings. OsCSN2 may rescue the inhibitory effect of blue light on the height of mutant plants, possibly through the GA signaling pathway. The changes in the OsCSN2 point mutants may be related to the ubiquitylation of the point mutants, and the responses to GA3 are different, thus regulating the growth trend. After the addition of the exogenous hormone PAC, the plant height of all the rice seedlings was inhibited, and OsCSN2-OE was the most sensitive (Figure 1A,B). The endogenous hormone GA3 was also significantly inhibited (Figure 2A).

2.2. Exogenous GA3 Can Regulate the Inhibitory Effect of Blue Light on the Coleoptile and the First Incomplete Leaf of OsCSN2 Rice Seedlings

Under natural light, the coleoptile length of all the mutants was longer than that of the WT, especially the coleoptile lengths of oscsn2-1 and OsCSN2K64E-OE (Figure 1A,C). These results suggest that OsCSN2 can promote the elongation of coleoptiles in rice seedlings. The coleoptile shortening of all the mutants was inhibited under blue light (Figure 1A,C), and the content of the endogenous hormone GA3 was also significantly suppressed and decreased (Figure 2B). Under the combined action of blue light and the exogenous hormone PAC, the WT and all the mutants were more significantly inhibited, the coleoptiles of OsCSN2-OE and OsCSN2K64E-OE were significantly shortened (Figure 1A,C), and OsCSN2-OE endogenous hormone content also showed lower levels (Figure 2B). Under the combined action of blue light and the exogenous hormone GA3, the overall trend of the coleoptiles was promoted (Figure 1A,C). In particular, the coleoptiles of the OsCSN2K64E-OE plants were longer than those of the WT plants. The endogenous hormone GA3 also showed the highest levels (Figure 2B); the addition of the exogenous hormone GA3 reversed the inhibitory effect of blue light on OsCSN2 coleoptile elongation, with OsCSN2K64E-OE showing the greatest sensitivity. The ubiquitination sites may affect the different performances of the mutants in the GA signaling pathway.
Under natural light, there was no significant difference in the number of incomplete first leaves between the WT and mutant plants (Figure 1A,D). Blue light treatment inhibited the elongation of the first incomplete leaf. OsCSN2 point mutants were shorter than the WT, oscsn2-1 and oscsn2-2 were greater than the WT, and the first incomplete leaves of both the OsCSN2-OE and the WT were similar (Figure 1A,D). Similarly, the difference in the levels of the endogenous hormone GA3 was not significant (Figure 2C). Under the combined action of blue light and the exogenous hormone PAC, the incomplete first leaves of the WT and mutant plants were more significantly suppressed (Figure 1A,D), and the endogenous hormone contents were also significantly suppressed (Figure 2C). However, under the joint action of blue light and the exogenous hormone GA3, the overall length of the first incomplete leaf was significantly increased to the extent that it was approximately two times longer than that under blue light and one time longer than that under natural light, especially oscsn2-1, so the absence of OsCSN2 could promote the incomplete first leaf of rice seedlings (Figure 1A,D) and significantly increase the content of the endogenous hormone GA3 (Figure 2C). These results demonstrated that GA3 could regulate the inhibition of the incomplete first leaf of OsCSN2 seedlings under blue light.

2.3. OsCSN2 Negatively Regulates Root Length Elongation in Rice Seedlings Under Blue Light

Under natural light, the roots of oscsn2-1 and oscsn2-2 were significantly longer than those of the WT, and the root length of OsCSN2-OE was significantly shorter than that of the WT (Figure 3A,B). Therefore, OsCSN2 inhibits root length elongation in rice. Blue light negatively regulated the elongation of the roots of the WT and OsCSN2 seedlings, especially the OsCSN2-OE roots (Figure 3A,B). After the addition of the exogenous hormone PAC under blue light, all the mutants were inhibited, particularly the complete inhibition of OsCSN2-OE root length (Figure 3A,B). After the addition of the exogenous hormone GA3 under blue light, the roots of both the OsCSN2-OE and the OsCSN2K67E-OE plants significantly grew, whereas the lengths of the roots of the oscsn2-1, oscsn2-2, and OsCSN2K64E-OE plants did not significantly change (Figure 3A,B). In summary, OsCSN2 may negatively regulate the elongation of the rice seedling root system under blue light, and OsCSN2 may rescue the inhibition of root length through the GA signaling pathway. However, it does not play a main regulatory role and may regulate OsCSN2 root development through other signaling pathways.

2.4. Under Blue Light, OsCSN2 May Regulate Shoot Development in Rice Seedlings via SLR1 Degradation in the GA Pathway

Real-time fluorescence quantitative PCR and WB experiments were performed on rice seedlings grown for 9 days. Under natural light, the expression level of the OsSLR1 protein in oscsn2-1 and oscsn2-2 was lower than that in OsCSN2-OE (Figure 4A). Under blue light, the expression level of the OsSLR1 protein was significantly inhibited in all the OsCSN2-OE mutants, especially OsCSN2-OE (Figure 4B), as was the mRNA level (Figure 5B). The level of the endogenous hormone GA3 also decreased significantly. (Figure 2A–C). Therefore, blue light inhibits the synthesis of the endogenous hormone GA3 and affects the elongation of the aboveground part of rice seedlings, which was most obviously inhibited in the CSN2 overexpression mutant lines. After synergistic treatment with blue light and the exogenous hormone GA3, OsCSN2-OE presented significantly greater levels of OsSLR1 protein than the WT did, while the levels of oscsn2-1 and oscsn2-2 were significantly lower than those of the WT (Figure 4C). This suggests that OsCSN2 can regulate the aboveground growth of rice seedlings by regulating the content of the endogenous hormone GA3 and thereby affecting the degradation of SLR1. On the other hand, the expression level of the OsSLR1 protein in all the point mutants was significantly lower than that in OsCSN2-OE. In particular, the expression of OsCSN2K67E-OE was the lowest, and its aboveground parts were also significantly promoted (Figure 4C), and the alteration of the 67th ubiquitination site may be more positive for OsCSN2 in response to the GA signaling pathway. After synergistic treatment with blue light and the exogenous hormone PAC, the protein and gene expression levels of OsSLR1 significantly increased in the OsCSN2-OE, OsCSN2K67E-OE, and OsCSN2K104E-OE groups compared with those in the WT group (Figure 4D), whereas the expression levels of oscsn2-1 and oscsn2-2 also tended to increase (Figure 5D), and all the phenotypes of the rice seedlings were indeed significantly suppressed. OsABI5 protein expression levels and gene expression levels after synergic treatment with blue light and the exogenous hormone GA3 were affected; the expression level of the OsABI5 in OsCSN2-OE was significantly greater than that in WT, and the expression levels of oscsn2-1 and oscsn2-2 were significantly lower than those in WT (Figure 4C). The changes under the different treatments were not significant (Figure 4A,B,D). OsABI5 plays an insignificant role in this signaling pathway. Therefore, OsCSN2 affects the growth and development of rice seedlings through the regulation of OsSLR1 in the GA signaling pathway. In this process, OsSLR1 acts as a negative regulator. The downregulation of OsSLR1 expression can promote the growth and development of rice seedlings, which is reflected in their growth and development. It is reflected in the elongation of the stems, the coleoptile, and the first incomplete leaf of the seedlings, with less effect on the roots.
Under blue light, the mRNA levels of OsCOP1, OsCRY2, OsCUL4, and OsBBX14 in OsCSN2-OE were relatively high and tended to increase (Figure 5B). Previous studies have demonstrated that these genes play a regulatory role in blue light morphogenesis in rice [17,25]. The relative expression levels of oscsn2-1 and oscsn2-2 both tended to be low (Figure 5B). After synergic treatment with blue light and the exogenous hormone GA3, the relative expression levels of OsCOP1 and OsBBX14 in OsCSN2-OE plants tended to decrease, whereas those of OsCUL4 tended to increase, and the addition of the exogenous hormone OsCSN2K67E-OE resulted in significant changes (Figure 5C). The overall OsCOP1, OsCRY2, and OsBBX14 genes showed different upward trends after the addition of PAC (Figure 5D). Some studies have demonstrated that OsBBX14 is involved mainly in blue light-regulated photomorphogenesis; OsBBX14 is involved in the OsCRY-mediated light pathway and interacts with OsCRY2, resulting in the specific dwarf phenotype of OsBBX14-overexpressing mutants under blue light [25]. The COP9 signaling complex regulates COP1. The required recombinant vectors were constructed, and the plasmid were cotransformed into yeast strain AH109 for yeast two-hybrid assay to verify the interactions between OsCSN2 and OsCUL4, which were cultured in SD-Trp-Leu media versus SD-Trp-Leu-His-Ade media. All positive controls and negative controls could grow normally on SD-Trp-Leu media, indicating that there was no problem with the experimental materials. On SD-Trp-Leu-His-Ade media, the cotransformed strains of the positive control pGADT7 + pGBKT7-53 and the experimental group pGADT7-OsCSN2 + pGBKT7-OsCUL4 grew normally, whereas the negative pGADT7 + pGBKT7-Lam, pGBKT7 + pGADT7-OsCSN2, and pGADT7 + pGBKT7-OsCUL4 cotransformed strains were unable to grow (Figure 5E). These results indicated that OsCSN2 and OsCUL4 could interact. OsCSN2 may regulate the growth and development of rice seedlings through OsCUL4 in Cullin-RING E3. The results of the BIFC experiment revealed yellow fluorescence when pSAT4A-nEYFP-OsCSN2 and pSAT4A-cEYFP-OsCUL4 coinfected the inner epidermis of the onion (Figure 5F), which also supported the finding that OsCSN2 and OsCUL4 could interact.
In summary, the expression level of OsBBX14 in OsCSN2-OE was significantly greater than that in the WT and knockout mutant lines, suggesting the inhibitory role of OsBBX14 in blue light morphogenesis [25]. The changes in phenotype characteristics and gene expression levels confirmed that OsCSN2 may be a negative regulator under blue light conditions and acts synergistically with OsBBX14. OsCSN2 may coordinate the degradation of SLR1 in the GA signaling pathway through the blue light receptors CRY2 and COP1 to regulate rice seedlings. OsCSN2 also regulates this process through the CUL4-based E3 ubiquitin ligase (Figure 6). Ultimately, endogenous hormone changes and phenotypic growth and developmental changes were most significant in rice seedlings aboveground.

3. Discussion

3.1. OsCSN2 as a Potential Negative Regulator Under Blue Light

The COP9 signaling complex is a large multi-subunit protein complex composed of eight subunits, and this structural composition is highly conserved in higher eukaryotes and has been identified as an essential factor of photomorphogenesis in Arabidopsis, a negative regulator of the blue light receptor, which acts downstream of the blue light receptor [28,29]. A change in any subunit in the COP9 signaling complex triggers the integrity and function of the complex, resulting in developmental problems in the organism [30]. However, few studies have investigated the COP9 signaling complex in rice. We treated the WT and the OsCSN2 mutants with blue light, and after the addition of the exogenous hormones GA3 and PAC, we observed different behaviors in the rice seedlings.
Under natural light treatment, the OsCSN2 knockout mutants and weak expression mutants presented greater growth trends, whereas the OsCSN2 overexpression mutants presented a shorter phenotype (Figure 1A). Therefore, it was speculated that CSN2 plays a role in the response of rice to light as a negative regulator of morphogenesis. The growth inhibition was present in all parts of the WT and mutant under blue light, especially in the aboveground part of rice seedlings, where the WT was higher than the mutant lines, and the OsCSN2 knockout mutant grew better than the overexpression mutant (Figure 1A). Therefore, OsCSN2 may be a negative regulator of blue light-regulated growth in rice seedlings. Blue light inhibits the synthesis of endogenous gibberellin. OsCSN2 mutants showed particularly sensitive aboveground expression with phenotypic restoration or promotion following the addition of the exogenous hormone GA3 under blue light, but the changes in the roots were not very significant (Figure 3A). After different ubiquitination loci changed, the OsCSN2K67E-OE mutants presented the most obvious regulation of hormones under blue light and hormone co-treatment, which may be related to the ubiquitination locus. OsCSN2 may rescue the inhibitory effect of blue light on endogenous hormones by exogenous hormone addition and promote the aboveground growth and development of rice. However, OsCSN2 in rice seedling roots is not regulated through the GA signaling pathway under blue light. In summary, OsCSN2 may play a negative regulatory role under blue light.

3.2. In Rice, the Subunits of the COP9 Signaling Complex in the GA Signaling Pathway Exhibit Different Functions Under Blue Light

In the COP9 signaling complex, CSN1 and CSN2 are two essential subunits. Previous experiments have shown that the effect of OsCSN1-OE under natural light is significantly lower than that of the WT, and the levels of the knockout mutants and weak expression mutants are significantly greater than those of the WT [17]. Specifically, OsCSN1 negatively regulates the growth and development of rice seedlings, and OsCSN1 also negatively regulates the growth of rice seedlings under blue light [17]. This result was consistent with that of OsCSN2. Therefore, it was speculated that OsCSN1 and OsCSN2 subunits are also negative regulators of the light signaling pathway, but there are large differences in the expression levels of related genes in rice. Rice plant height also has an essential effect on rice yield. Maintaining rice plant height at a stable optimal height is the key to maximizing rice yield. Gibberellin has a certain regulatory effect on rice stem elongation and can promote stem elongation [31]. In the GA signaling pathway, the DELLA protein is a key protein that regulates this pathway, and there are five members in Arabidopsis [26]. The DELLA protein in rice is SLR1, which negatively regulates the GA signaling pathway [27]. Under natural light, the OsSLR1 gene and protein expression levels were greater in the OsCSN2-OE mutants (Figure 4A and Figure 5A), and all the rice seedlings tended to be shorter (Figure 1A). After the addition of exogenous GA3 under blue light, the height of the OsCSN2 mutants was restored compared with that under natural light (Figure 1A). More notably, the growth of the first incomplete leaf and coleoptile of the OsCSN2 mutant was significantly promoted by the addition of the exogenous hormone GA3 under blue light compared with natural light (Figure 1A), whereas the aboveground part of the OsCSN1 mutant was not restored to the natural state and remained in a suppressed state [17]. Therefore, OsCSN2 can restore and promote aboveground growth in response to the GA signaling pathway under blue light, rescuing the aboveground growth and development of the OsCSN2 mutant. However, the changes in the roots were not obvious. OsCSN2 may be involved in the GA signaling pathway to affect the growth and development of the root system. Like that of OsCSN1, the hormone signaling pathway by which OsCSN2 effectively regulates root growth remains to be studied. These results suggest that OsCSN1 and OsCSN2 have different functions in rice. CSN1 and CSN2 likely play different functions in the GA signaling pathway under blue light by regulating the COP9 signaling complex.
The loss of the CSN2 gene function does not result in the complete loss of the functions of the other subunits of the COP9 signaling complex, but it affects the relative expression levels of its genes. The CSN complex shows two symmetric modules, with CSN1/2/3/8 as one of the blocks. In this module, CSN2 is connected only to CSN1, and the two modules are connected to CSN6 through CSN1 [32]. The deletion or overexpression of the CSN2 gene in rice may significantly change the overall structure of the COP9 signaling complex, resulting in functional changes and unknown changes in other subunits. Under blue light, the expression level of OsCSN1 in OsCSN2-OE increased (Figure 4B and Figure 5B). After the addition of the exogenous hormone GA3, the overall relative expression level of OsCSN1 was more significantly inhibited, but the expression level of OsCSN2-OE was still relatively high (Figure 4C and Figure 5C). Coincidentally, under blue light, the expression level of the OsCSN2 protein and the relative expression level of the gene in OsCSN1-OE significantly increased [17]. It is possible that both CSN1 and CSN2 play negative regulatory roles and that the two genes are directly connected and interact. Under blue light, CSN2 may affect the assembly of the COP9 signaling complex through the GA signaling pathway, thereby affecting the formation of CSN1 monomeric subunits. CSN1 inhibits the growth of rice seedlings under blue light [17], and CSN2 is likely to play a synergistic role with CSN1. Therefore, the COP9 signaling complex may play a negative regulatory role in the growth of rice seedlings, and the decrease in the CSN1 protein expression through the exogenous addition of the GA3 hormone is likely to inhibit the formation of the COP9 signaling complex, thereby promoting the growth and development of rice seedlings. Under natural light and blue light, the expression level of OsCSN5 in the OsCSN2 mutants relatively decreased in the overexpression mutants, whereas the knockout and weak expression mutants presented relatively high expression levels (Figure 4A,B). There was a decreasing trend compared with the WT level. We speculate that this is related to the structure of the CSN. CSN5 has a metal domain and can also exist and function independently [33]; this affects the synthesis of the CSN. However, after the ubiquitination site changed, the expression level of OsCSN5 in OsCSN2K67E-OE tended to increase under blue light (Figure 4B). The deubiquitination of ubiquitination site 67 strongly affected the formation of OsCSN5; it has a promoting effect. However, after the addition of the exogenous hormone GA3, the gene expression of OsCSN2K67E-OE decreased (Figure 4C). Therefore, the specific molecular mechanism remains to be further studied.

3.3. OsCSN2 Regulates the GA Signaling Pathway Through a CUL4-Based E3 Ubiquitin Ligase

The COP9 signaling complex controls cellular function through multiple regulatory roles with Cullin-RING E3 ubiquitin ligases and the degradation of key signaling proteins, and binds to and functions with protein kinases and deubiquitylating enzymes (DUBs) to regulate CSN, CRLs, and CRLs substrates [34]. CSN regulates the phosphorylation of ubiquitin–proteasome pathway substrates through related kinases, and CRLs perform deubiquitination to regulate the activity of Cullin-RING E3 ligases and affect intracellular protein degradation pathways [35]. The gibberellin signaling pathway is a key regulator of plant growth. An essential component of this pathway is the DELLA protein, which binds to gibberellin to regulate plant growth and development and promotes stem elongation.
Under blue light, the content of the endogenous hormone GA3 was significantly inhibited, and the content of OsCSN2-OE was relatively high (Figure 2A–C). After the addition of the exogenous hormone GA3, the content of the endogenous hormone GA3 in OsCSN2-OE was most inhibited, while the content of OsCSN2K67E-OE was significantly increased, which may be related to the ubiquitination sites (Figure 2A–C). The results of yeast two-hybrid and BIFC experiments revealed that there was an interaction between OsCSN2 and OsCUL4 (Figure 5E,F). Under blue light, the relative expression level of the OsCUL4 gene in OsCSN2-OE was upregulated (Figure 5B). After the addition of the exogenous hormone GA3, the relative expression level of the OsCUL4 gene in OsCSN2-OE and OsCSN2K67E-OE was significantly increased, whereas the difference between the OsCSN2 knockout and weak expression mutants was not significant (Figure 5C). It was speculated that OsCSN2 regulated CUL4 in the Cullin-RING protein family through the assembly of the COP9 signaling complex, thereby mediating the expression of the related gene SLR1 in the GA signaling pathway. Therefore, the synthesis of endogenous hormones in rice seedlings and the growth and development of the aboveground parts of rice seedlings are affected. Owing to the change in amino acid 67 of OsCSN2, it is sensitive to blue light and the expression of GA signaling pathways in related genes and proteins, and the effect of deubiquitination on OsCSN2 is greater. Therefore, OsCSN2 synergizes with the exogenous hormone GA3 in blue light to promote the growth and development of aboveground parts of rice seedlings, especially in the coleoptile and the first incomplete leaf. In contrast, OsCSN1 does not have this effect under the synergistic effect of OsCSN1 [17].
In the presence of blue light and the addition of the exogenous hormone GA3, the OsCOP1, OsCRY2, and OsBBX14 genes of OsCSN2-OE all presented relatively high expression levels at the mRNA level, whereas the relative expression levels of the knockout mutants were low (Figure 5C). OsBBX14 has been confirmed to be involved mainly in blue light-regulated photomorphogenesis [25]. During the growth process of rice seedlings, they sense blue light signals through blue light receptors. The overexpression of OsCRY2 under blue light can significantly shorten the total length of seedlings and the lengths of the main leaves and coleoptiles [36]. OsCSN2 regulates the growth and development of rice plants under blue light through the GA signaling pathway. There are many related genes and complex and complicated regulatory mechanisms involved in this process, and it is speculated that OsBBX14 negatively regulates the growth and development of CSN2 rice seedlings under blue light. OsCRY2, as a receptor of the sensing blue light signaling pathway, functioned in interaction with OsCOP1, resulting in the suppression of rice seedling plant height and the elongation of the first incomplete leaf, and also verified that the COP9 signaling complex may regulate COP1 to affect blue light morphogenesis. However, the specific molecular mechanism is still not clear and will continue to be studied in the future.

4. Materials and Methods

4.1. Plant Material

Wild-type rice Nipponbare (WT), OsCSN2 deletion mutant (oscsn2-1), OsCSN2 weak expression mutant (oscsn2-2), OsCSN2 overexpression mutant (OsCSN2-OE), and OsCSN2 point mutants (OsCSN2K64E-OE, OsCSN2K67E-OE, and OsCSN2K104E-OE) were obtained from our laboratory [27].

4.2. Experimental Methods

4.2.1. Rice Seedling Culture Conditions and Environment

The husks of the wild-type Nipponbare and rice mutant plants were removed in advance, soaked in 75% ethanol, disinfected for 10 min, washed once with sterile water, disinfected with 70% NaClO for 30 min, and finally rinsed with sterile water for approximately 6 min. The seeds of the wild-type Nipponbare variety and rice mutants were evenly divided into 4 groups. Agarose media at a concentration of 0.8% (w/v) were added (the 2 groups were separately supplemented with gibberellin (GA3) at a concentration of 10mM and paclobutrazol (PAC) at a concentration of 100 mM). The control group was placed in a light incubator (203 µmol/m2/s light, a temperature of 28 ± 1 °C, and a culture cycle of 12 h of light and 12 h of darkness), and the other three groups were placed in a blue light incubator (30 µmol/m2/s light, the temperature was 28 ± 1 °C, and the blue light source was LED-B, which was continuously illuminated with blue light).

4.2.2. Analysis of Rice Seedling Phenotypes and Endogenous Hormones

After 9 days of culture, the plant height, root length, coleoptile, and first incomplete leaf height of the rice seedlings were measured and analyzed. First, 1g of the aboveground parts of 9-day-old rice seedlings were weighed for liquid nitrogen milling, and the extraction method was referred to Ye’s method [37]. The aboveground rice samples, which had been fully ground by liquid nitrogen, were immediately added with 80% cold methanol, mixed thoroughly, and then centrifuged at 4 °C for 15 min at 5000× g. The supernatant was aspirated and filtered through a Sep-PaK PlusC18 column. The filtrate was dried in a vacuum oven and then dissolved in methanol for use in subsequent experiments. Enzyme-linked immunosorbent assay (ELISA) was used to determine the OD value at 450 nm for the determination and calculation of endogenous hormone GA3 content in rice seedlings. The ELISA kit used was purchased from Jiangsu Jingmei Biotechnology Co. (Yancheng, China). The experiment was repeated 3 times for each group of samples (N = 3). For the experiments, Excel 2019 and IBM SPSS Statistics 26 (SPSS, https://www.ibm.com/cn-zh/products/spss statistics, accessed on 14 February 2024) were used to analyze the data, and GraphPad Prism 8 (https://www.graphpad-prism.cn/) was used to draw the chart. The data are expressed as the means ± standard errors of the control group and the experimental group. Statistical significance was set at p ≤ 0.05.

4.2.3. Protein Extraction, Western Blot Experiments/Antibodies, and Western Blot Analysis of Rice Seedlings

Protein was extracted after 0.5 g of seedlings were ground in liquid nitrogen. The formula used for protein extraction was RIPA lysis buffer (Genstar, Beijing, China), 1 mM DTT, 1 mM PMSF, and 1 × protease inhibitor cocktail (Roche, China). The mixture was centrifuged at 15,000 rpm at 4 °C for 10 min, the supernatant was transferred to a new centrifuge tube, 5 × SDS (Genstar, China) was added, the mixture was mixed thoroughly, and the mixture was boiled for 10 min to denature the tube [17]. The protein samples were added to 10% SDS–PAGE gels for subsequent Western blot (WB) experiments. All the antibodies used in this study were from Wuhan ABclonal Biotechnology Co. (ABclonal, Wuhan, China). The primary antibodies used were anti-OsCSN1, anti-OsCSN5, anti-OsSLR1, and anti-OsABI5. To visualize the signals, the Universal Hood III system (731BR03292, BIO-RAD) was used.

4.2.4. Total RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction

Total RNA was extracted from seedling material using the Spectrum Plant Total RNA Kit (Sigma-Aldrich, Steinheim, Germany), and RNA was reverse-transcribed into cDNA using StarScript II versus starting material for cDNA synthesis using a gDNA remover (Genstar, China). Quantitative real-time PCR (qRT–PCR) experiments were subsequently performed. The experiment was completed on a StepOne RT–PCR Plus™ Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Beijing, China) using ROX in 2× RealStar Green Fast Mix (GenStar, China). The blank control gene GAPDH (JN848809) was used to calculate the relative mRNA levels of the three averages of the experiment. Table 1 lists the detailed information of the gene-specific primers used for qPCR and RT–PCR (Table 1).

4.2.5. Yeast Two-Hybrid Experiment

The yeast two-hybrid experiment was performed according to Zhang’s method [38]. The pGADT7 and pGBKT7 plasmids were purchased from Miaoling Plasmid Platform (Wuhan, China). The experimental groups pGADT7-OsCSN2 + pGBKT7-OsCUL4, the positive control pGADT7 + pGBKT7-53, and the negative controls pGADT7 + pGBKT7-Lam, pGBKT7 + pGADT7-OsCSN2, and pGADT7 + pGBKT7-OsCUL4 were co-transformed into the yeast strain AH109 for yeast two-hybrid analysis.

4.2.6. Bimolecular Fluorescence Complementation Experiment

Bimolecular fluorescence complementation experiments are abbreviated as BIFC. The pSAT4A-cEYFP-N1 and pSAT4A-nEYFP-N1 plasmids were purchased from Huizao Biotechnology Co. (Wuhan, China). The negative controls pSAT4A-cEYFP and pSAT4A-nEYFP, pSAT4A-cEYFP and pSAT4A-nEYFP-OsCSN2, pSAT4A-nEYFP and pSAT4A-cEYFP-OsCUL4, and the experimental groups pSAT4A-nEYFP-OsCSN2 and pSAT4A-cEYFP-OsCUL4 were constructed and co-transformed into agricultural products. The Bacillus strain GV3101 was used to infect the inner epidermis of onion and was subsequently subjected to bimolecular fluorescence complementation experiments. The observation instrument used was a confocal laser microscope (TCS SP8) from Leica AG (Wetzlar, Germany).

5. Conclusions

Our study revealed that OsCSN2 may be a crucial negative regulator of blue-light-mediated photomorphogenesis in rice seedlings. By modulating the GA signaling pathway, OsCSN2 influences the growth and development of aboveground plant parts in response to blue light. Specifically, OsCSN2 perceives blue light signals through CRY2, regulating the expression of COP1 and BBX14, which in turn affects the degradation of SLR1 and the subsequent elongation of plant height, coleoptiles, and the first incomplete leaf. This study not only underscores the significant role of OsCSN2 in blue light signaling but also highlights the distinct functions of OsCSN1 and OsCSN2 within the COP9 signaling complex in rice photomorphogenesis. These findings provide valuable insights into the molecular mechanisms underlying plant responses to light, potentially informing strategies for optimizing growth conditions in agricultural settings.

Author Contributions

Data curation, X.Y., T.J., C.L., H.Z. and Y.L.; formal analysis, X.Y., T.J., C.L., H.Z., Y.L. and C.Z.; funding acquisition, M.W. and L.G.; investigation, X.Y., T.J., C.L., H.Z. and Y.L.; methodology, X.Y., M.W. and L.G.; resources, M.W. and L.G.; supervision, M.W. and L.G.; writing—original draft, X.Y., T.J. and C.L.; writing—review and editing, M.W. and L.G. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Department of Jilin Province Science & Technology [grant number 20230402020GH].

Data Availability Statement

The data presented in this study are available in the article.

Acknowledgments

We thank the staff members who provided comments and assistance with the paper. We thank the reviewers and editors for their valuable comments, which helped to improve this manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Qin, N.; Xu, D.; Li, J.; Deng, X.W. COP9 signalosome: Discovery, conservation, activity, and function. J. Integr. Plant Biol. 2020, 62, 90–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Schwechheimer, C.; Serino, G.; Callis, J.; Crosby, W.L.; Lyapina, S.; Deshaies, R.J.; Gray, W.M.; Estelle, M.; Deng, W.X. Interactions of the COP9 signalosome with the E3 ubiquitin li se SCFTIRI in mediating auxin response. Science 2001, 292, 1379–1382. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Tenbaum, S.P.; Juenemann, S.; Schlitt, T.; Bernal, J.; Renkawitz, R.; Muñoz, A.; Baniahmad, A. Alien/CSN2 gene expression is regulated by thyroid hormone in rat brain. Dev. Biol. 2003, 254, 149–160. [Google Scholar] [CrossRef] [Scilit]
  4. Enchev, R.I.; Schreiber, A.; Beuron, F.; Morris, E.P. Structural insights into the COP9 signalosome and its common architecture with the 26S proteasome lid and eIF3. Structure 2010, 18, 518–527. [Google Scholar] [CrossRef] [Scilit]
  5. Hofmann, K.; Bucher, P. The PCI domain: A common theme in three multiprotein complexes. Trends Biochem. Sci. 1998, 23, 204–205. [Google Scholar] [CrossRef] [Scilit]
  6. Singh, A.K.; Chamovitz, D.A. Role of Cop9 Signalosome Subunits in the Environmental and Hormonal Balance of Plant. Biomolecules 2019, 9, 224. [Google Scholar] [CrossRef] [Scilit]
  7. Deng, X.W.; Caspar, T.; Quail, P.H. cop1: A regulatory locus involved in light-controlled development and gene expression in Arabidopsis. Genes Dev. 1991, 5, 1172–1182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Li, L.; Deng, X.W. The COP9 signalosome: An alternative lid for the 26S proteasome? Trends Cell Biol. 2003, 13, 507–509. [Google Scholar] [CrossRef] [Scilit]
  9. Jin, D.; Wu, M.; Li, B.; Bücker, B.; Keil, P.; Zhang, S.; Li, J.; Kang, D.; Liu, J.; Dong, J.; et al. The COP9 Signalosome regulates seed germination by facilitating protein degradation of RGL2 and ABI5. PLoS Genet. 2018, 14, e1007237. [Google Scholar] [CrossRef] [Scilit]
  10. Wei, N.; Chamovitz, D.A.; Deng, X.W. Arabidopsis COP9 is a component of a novel signaling complex mediating light control of development. Cell 1994, 78, 117–124. [Google Scholar] [CrossRef] [Scilit]
  11. Fankhauser, C.; Chory, J. Light control of plant development. Annu. Rev. Cell Dev. Biol. 1997, 13, 203–229. [Google Scholar] [CrossRef] [Scilit]
  12. Ren, M.; Liu, S.; Tang, C.; Mao, G.; Gai, P.; Guo, X.; Zheng, H.; Tang, Q. Photomorphogenesis and Photosynthetic Traits Changes in Rice Seedlings Responding to Red and Blue Light. Int. J. Mol. Sci. 2023, 24, 11333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Rehman, M.; Pan, J.; Mubeen, S.; Ma, W.; Luo, D.; Cao, S.; Saeed, W.; Jin, G.; Li, R.; Chen, T. Morpho-physio-biochemical, molecular, and phytoremedial responses of plants to red, blue, and green light: A review. Environ. Sci. Pollut. Res. Int. 2024, 31, 20772–20791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Cashmore, A.R.; Jarillo, J.A.; Wu, Y.-J.; Liu, D. Cryptochromes: Blue light receptors for plants and animals. Science 1999, 284, 760–765. [Google Scholar] [CrossRef] [Scilit]
  15. Yang, Z.; Liu, B.; Su, J.; Liao, J.; Lin, C.; Oka, Y. Cryptochromes Orchestrate Transcription Regulation of Diverse Blue Light Responses in Plants. Photochem. Photobiol. 2017, 93, 112–127. [Google Scholar] [CrossRef] [Scilit]
  16. Ma, D.; Li, X.; Guo, Y.; Chu, J.; Fang, S.; Yan, C.; Noel, J.P.; Liu, H. Cryptochrome 1 interacts with PIF4 to regulate high temperature-mediated hypocotyl elongation in response to blue light. Proc. Natl. Acad. Sci. USA 2016, 113, 224–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Han, S.; Liu, Y.; Bao, A.; Zeng, H.; Huang, G.; Geng, M.; Zhang, C.; Zhang, Q.; Lu, J.; Wu, M.; et al. OsCSN1 regulates the growth of rice seedlings through the GA signaling pathway in blue light. J. Plant Physiol. 2023, 280, 153904. [Google Scholar] [CrossRef] [Scilit]
  18. Zhang, Y.C.; Gong, S.F.; Li, Q.H.; Sang, Y.; Yang, H.Q. Functional and signaling mechanism analysis of rice CRYPTOCHROME 1. Plant J. Cell Mol. Biol. 2006, 46, 971–983. [Google Scholar] [CrossRef] [Scilit]
  19. Briggs, W.R.; Christie, J.M. Phototropins 1 and 2: Versatile plant blue-light receptors. Trends Plant Sci. 2002, 7, 204–210. [Google Scholar] [CrossRef] [Scilit]
  20. Kanegae, H.; Tahir, M.; Savazzini, F.; Yamamoto, K.; Yano, M.; Sasaki, T.; Kanegae, T.; Wada, M.; Takano, M. Rice NPH1 homologues, OsNPH1a and OsNPH1b, are differently photoregulated. Plant Cell Physiol. 2000, 41, 415–423. [Google Scholar] [CrossRef] [Scilit]
  21. Han, X.; Huang, X.; Deng, X.W. The Photomorphogenic Central Repressor COP1: Conservation and Functional Diversification during Evolution. Plant Commun. 2020, 1, 100044. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Balcerowicz, M. PHYTOCHROME-INTERACTING FACTORS at the interface of light and temperature signaling. Physiol. Plant. 2020, 169, 347–356. [Google Scholar] [CrossRef] [Scilit]
  23. Burman, N.; Bhatnagar, A.; Khurana, J.P. OsbZIP48, a HY5 Transcription Factor Ortholog, Exerts Pleiotropic Effects in Light-Regulated Development. Plant Physiol. 2018, 176, 1262–1285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Nijhawan, A.; Jain, M.; Tyagi, A.K.; Khurana, J.P. Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice. Plant Physiol. 2008, 146, 333–350. [Google Scholar] [CrossRef] [Scilit]
  25. Bai, B.; Lu, N.; Li, Y.; Guo, S.; Yin, H.; He, Y.; Sun, W.; Li, W.; Xie, X. OsBBX14 promotes photomorphogenesis in rice by activating OsHY5L1 expression under blue light conditions. Plant Sci. Int. J. Exp. Plant Biol. 2019, 284, 192–202. [Google Scholar]
  26. Andres, J.; Schmunk, L.J.; Grau-Enguix, F.; Braguy, J.; Samodelov, S.L.; Blomeier, T.; Ochoa-Fernandez, R.; Weber, W.; Al-Babili, S.; Alabadí, D.; et al. Ratiometric gibberellin biosensors for the analysis of signaling dynamics and metabolism in plant protoplasts. Plant J. Cell Mol. Biol. 2024, 118, 927–939. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Han, S.; Yue, W.; Bao, A.; Jiao, T.; Liu, Y.; Zeng, H.; Song, K.; Wu, M.; Guo, L. OsCSN2 orchestrates Oryza sativa L. growth and development through modulation of the GA and BR pathways. Funct. Integr. Genom. 2024, 24, 39. [Google Scholar] [CrossRef] [Scilit]
  28. Wei, N.; Deng, X.W. COP9: A new genetic locus involved in light-regulated development and gene expression in Arabidopsis. Plant Cell 1992, 4, 1507–1518. [Google Scholar]
  29. Wei, N.; Kwok, S.F.; Von Arnim, A.G.; Lee, A.; McNellis, T.W.; Piekos, B.; Deng, X.W. Arabidopsis COP8, COP10, and COP11 genes are involved in repression of photomorphogenic development in darkness. Plant Cell 1994, 6, 629–643. [Google Scholar]
  30. Dong, J.; Li, Y.; Cheng, S.; Li, X.; Wei, N. COP9 signalosome-mediated deneddylation of CULLIN1 is necessary for SCF(EBF1) assembly in Arabidopsis thaliana. Cell Rep. 2024, 43, 113638. [Google Scholar] [CrossRef] [Scilit]
  31. Wang, Q.; Gao, H.; Liu, K.; Wang, H.; Zhang, F.; Wei, L.; Lu, K.; Li, M.; Shi, Y.; Zhao, J.; et al. CRISPR/Cas9-mediated enhancement of semi-dwarf glutinous traits in elite Xiangdaowan rice (Oryza sativa L.): Targeting SD1 and Wx genes for yield and quality improvement. Front. Plant Sci. 2024, 15, 1333191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Sharon, M.; Mao, H.; Erba, E.B.; Stephens, E.; Zheng, N.; Robinson, C.V. Symmetrical modularity of the COP9 signalosome complex suggests its multifunctionality. Structure 2009, 17, 31–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Wei, N.; Deng, X.W. The COP9 signalosome. Annu. Rev. Cell Dev. Biol. 2003, 19, 261–286. [Google Scholar] [CrossRef] [Scilit]
  34. Schulze-Niemand, E.; Naumann, M. The COP9 signalosome: A versatile regulatory hub of Cullin-RING ligases. Trends Biochem. Sci. 2023, 48, 82–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Lee, J.H.; Yi, L.; Li, J.; Schweitzer, K.; Borgmann, M.; Naumann, M.; Wu, H. Crystal structure and versatile functional roles of the COP9 signalosome subunit 1. Proc. Natl. Acad. Sci. USA 2013, 110, 11845–11850. [Google Scholar] [CrossRef] [Scilit]
  36. Singh, S.; Vergish, S.; Jain, N.; Sharma, A.K.; Khurana, P.; Khurana, J.P. OsCRY2 and OsFBO10 co-regulate photomorphogenesis and photoperiodic flowering in indica rice. Plant Sci. Int. J. Exp. Plant Biol. 2023, 330, 111631. [Google Scholar] [CrossRef] [Scilit]
  37. Ye, H.; Han, G.M.; Ma, Q.; Tan, Y.Q.; Jiang, H.Y.; Zhu, S.W.; Cheng, B.J. Effect of temperature on endogenous hormone levels and opposite phyllotaxy in maize leaf primordial. Genet. Mol. Res. GMR 2015, 14, 17019–17027. [Google Scholar] [CrossRef] [Scilit]
  38. Zhang, G.; Yang, J.; Zhang, M.; Li, Q.; Wu, Y.; Zhao, X.; Zhang, H.; Wang, Y.; Wu, J.; Wang, W. Wheat TaPUB1 Regulates Cd Uptake and Tolerance by Promoting the Degradation of TaIRT1 and TaIAA17. J. Agric. Food Chem. 2021, 69, 5818–5829. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Plant height, coleoptile length, and first incomplete leaf of WT and OsCSN2 mutants under different condition treatments. The red arrow in the figure points to the coleoptile, and the yellow arrow in the figure points to the first incomplete leaf. (Different letters within the same group indicate significant differences (p ≤ 0.05), while the same letters indicate no significant differences.) (A) The aboveground of WT and OsCSN2 mutants grown for 9 days under natural light, blue light, blue light and GA3 co-treatment, and blue light and PAC co-treatment. (B) Plant height data graph of WT and OsCSN2 mutants grown 9 days under light, blue light, blue light and GA3 co-processed, blue and PAC co-processed. (C) Coleoptile length data graph of WT and OsCSN2 mutants grown 9 days under light, blue light, blue light and GA3 co-processed, and blue light and PAC co-processed. (D) First incomplete leaf length data graph of WT and OsCSN2 mutants grown 9 days under light, blue light, blue light and GA3 co-processed, and blue light and PAC co-processed.
Figure 1. Plant height, coleoptile length, and first incomplete leaf of WT and OsCSN2 mutants under different condition treatments. The red arrow in the figure points to the coleoptile, and the yellow arrow in the figure points to the first incomplete leaf. (Different letters within the same group indicate significant differences (p ≤ 0.05), while the same letters indicate no significant differences.) (A) The aboveground of WT and OsCSN2 mutants grown for 9 days under natural light, blue light, blue light and GA3 co-treatment, and blue light and PAC co-treatment. (B) Plant height data graph of WT and OsCSN2 mutants grown 9 days under light, blue light, blue light and GA3 co-processed, blue and PAC co-processed. (C) Coleoptile length data graph of WT and OsCSN2 mutants grown 9 days under light, blue light, blue light and GA3 co-processed, and blue light and PAC co-processed. (D) First incomplete leaf length data graph of WT and OsCSN2 mutants grown 9 days under light, blue light, blue light and GA3 co-processed, and blue light and PAC co-processed.
Plants 14 02015 g001
Figure 2. Endogenous hormone GA3 content measured at different sites of WT and OsCSN2 mutants grown under different conditions for 9 days. (A) Data plots of the content of the endogenous hormone GA3 in stems of WT and OsCSN2 mutants grown for 9 days under light, blue light, co-treatment of blue light and GA3, and co-treatment of blue and PAC. (B) Data plots of the content of the endogenous hormone GA3 in coleoptile length of WT and OsCSN2 mutants grown for 9 days under light, blue light, co-treatment of blue light and GA3, and co-treatment of blue and PAC. (C) Data plots of the content of the endogenous hormone GA3 in first incomplete leaf of WT and OsCSN2 mutants grown for 9 days under light, blue light, co-treatment of blue light and GA3, and co-treatment of blue and PAC.
Figure 2. Endogenous hormone GA3 content measured at different sites of WT and OsCSN2 mutants grown under different conditions for 9 days. (A) Data plots of the content of the endogenous hormone GA3 in stems of WT and OsCSN2 mutants grown for 9 days under light, blue light, co-treatment of blue light and GA3, and co-treatment of blue and PAC. (B) Data plots of the content of the endogenous hormone GA3 in coleoptile length of WT and OsCSN2 mutants grown for 9 days under light, blue light, co-treatment of blue light and GA3, and co-treatment of blue and PAC. (C) Data plots of the content of the endogenous hormone GA3 in first incomplete leaf of WT and OsCSN2 mutants grown for 9 days under light, blue light, co-treatment of blue light and GA3, and co-treatment of blue and PAC.
Plants 14 02015 g002
Figure 3. Root length of WT and OsCSN2 mutants under different condition treatments. (A) Root length of WT and OsCSN2 mutants grown for 9 days under natural light, blue light, blue light and GA3 co-treatment, and blue and PAC co-treatment. (Different letters within the same group indicate significant differences (p ≤ 0.05), while the same letters indicate no significant differences.) (B) Root length data graph of WT and OsCSN2 mutants grown 9 days under light, blue light, blue light and GA3 co-processed, and blue and PAC co-processed.
Figure 3. Root length of WT and OsCSN2 mutants under different condition treatments. (A) Root length of WT and OsCSN2 mutants grown for 9 days under natural light, blue light, blue light and GA3 co-treatment, and blue and PAC co-treatment. (Different letters within the same group indicate significant differences (p ≤ 0.05), while the same letters indicate no significant differences.) (B) Root length data graph of WT and OsCSN2 mutants grown 9 days under light, blue light, blue light and GA3 co-processed, and blue and PAC co-processed.
Plants 14 02015 g003
Figure 4. Changes in expression of related proteins under different treatments in WT and OsCSN2 mutants. (A) Under light. (B) Under blue light. (C) Under blue light and GA3. (D) Under blue light and PAC.
Figure 4. Changes in expression of related proteins under different treatments in WT and OsCSN2 mutants. (A) Under light. (B) Under blue light. (C) Under blue light and GA3. (D) Under blue light and PAC.
Plants 14 02015 g004
Figure 5. Experimental map of changes in OsCSN2-related genes and protein interactions during the growth of rice seedlings under blue light. Changes in the expression of genes associated with mRNA levels in WT and OsCSN2 mutants after 9 days of growth under different treatment conditions. Expression of OsSLR1, OsABI5, OsCSN1, OsCSN5, OsCUL4, OsCRY2, OsCOP1, and OsBBX14 genes in the sample lines was examined using qPCR. (Different letters within the same group indicate significant differences (p ≤ 0.05), while the same letters indicate no significant differences.)
Figure 5. Experimental map of changes in OsCSN2-related genes and protein interactions during the growth of rice seedlings under blue light. Changes in the expression of genes associated with mRNA levels in WT and OsCSN2 mutants after 9 days of growth under different treatment conditions. Expression of OsSLR1, OsABI5, OsCSN1, OsCSN5, OsCUL4, OsCRY2, OsCOP1, and OsBBX14 genes in the sample lines was examined using qPCR. (Different letters within the same group indicate significant differences (p ≤ 0.05), while the same letters indicate no significant differences.)
Plants 14 02015 g005
Figure 6. Putative signaling pathway for blue light-mediated regulation of rice seedling growth and devel-opment by OsCSN2.
Figure 6. Putative signaling pathway for blue light-mediated regulation of rice seedling growth and devel-opment by OsCSN2.
Plants 14 02015 g006
Table 1. All the primers that were used in this study.
Table 1. All the primers that were used in this study.
PrimerSequence (5′-3′)Purpose
Dye-SLR1FCATGCTTTCCGAGCTCAACGq RT-PCR
Dye-SLR1RTGACAGTGGACGAGGTGGAAq RT-PCR
Dye-CSN1FCGGCCCGTAAGTTTGTTGAGq RT-PCR
Dye-CSN1RAGGGCACCATAGACAGCAACq RT-PCR
Dye-CSN5FGAGCAAGCTGAGGGTCAACTq RT-PCR
Dye-CSN5RGACCATGGACCTHTTCAGCAq RT-PCR
Dye-ABI5FTGGTAGACAGTGGAAGCGGAAGq RT-PCR
Dye-ABI5RACAGCGGTAGCGGCAAGGq RT-PCR
Dye-CUL4FAGGACAGACAGTATCAGGTGGATGCq RT-PCR
Dye-CUL4RTCCGATGGCTTGATTGGGAACTTGq RT-PCR
Dye-CRY2FTGCTGATCCGAGCCGAGAGTACq RT-PCR
Dye-CRY2RACGCACAAGAGAAACAGGGTCATACq RT-PCR
Dye-COP1FCATCTCAGCCACAAGAGCGACTGq RT-PCR
Dye-COP1RGGTCTATCGGTGATGCTGTCTTCGq RT-PCR
Dye-BBX14FGCCGCCGACCAAGAGGAGq RT-PCR
Dye-BBX14RCCGAAGCCGAAGCCAAAGCq RT-PCR
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yu, X.; Jiao, T.; Liu, C.; Zhang, H.; Liu, Y.; Zhang, C.; Wu, M.; Guo, L. Under Blue Light Treatment, OsCSN2 Regulates the Phenotype of Rice Seedlings Through the GA Signaling Pathway. Plants 2025, 14, 2015. https://doi.org/10.3390/plants14132015

AMA Style

Yu X, Jiao T, Liu C, Zhang H, Liu Y, Zhang C, Wu M, Guo L. Under Blue Light Treatment, OsCSN2 Regulates the Phenotype of Rice Seedlings Through the GA Signaling Pathway. Plants. 2025; 14(13):2015. https://doi.org/10.3390/plants14132015

Chicago/Turabian Style

Yu, Xinhai, Tongtong Jiao, Changfeng Liu, Hexin Zhang, Yanxi Liu, Chunyu Zhang, Ming Wu, and Liquan Guo. 2025. "Under Blue Light Treatment, OsCSN2 Regulates the Phenotype of Rice Seedlings Through the GA Signaling Pathway" Plants 14, no. 13: 2015. https://doi.org/10.3390/plants14132015

APA Style

Yu, X., Jiao, T., Liu, C., Zhang, H., Liu, Y., Zhang, C., Wu, M., & Guo, L. (2025). Under Blue Light Treatment, OsCSN2 Regulates the Phenotype of Rice Seedlings Through the GA Signaling Pathway. Plants, 14(13), 2015. https://doi.org/10.3390/plants14132015

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop