Optimization of Breeding Tools in Quinoa (Chenopodium quinoa) and Identification of Suitable Breeding Material for NW Europe
Abstract
1. Introduction
2. Results
2.1. Weather Conditions During the Trial
2.2. Screening of Quinoa Varieties in the Field
2.3. Paternity Analysis Through Multiplex SSR Set
3. Discussion
3.1. Phenotypic Screening of Varieties
3.2. Molecular Paternity Analysis Through SSR Markers
4. Materials and Methods
4.1. Plant Material
4.2. Field Trial Setup
4.3. NIRS for Crude Protein Content
4.4. Molecular Work
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Murphy, K.; Matanguihan, J. Quinoa: Sustainable Production, Variety Improvement, and Nutritive Value in Agroecological Systems; Wiley Blackwell: Hoboken, NJ, USA, 2015; 258p. [Google Scholar]
- Jacobsen, S.E.; Mujica, A. Genetic resources and breeding of the Andean grain crop quinoa (Chenopodium quinoa Willd.). Plant Genet. Resour. Newsl. 2002, 130, 54–61. [Google Scholar] [CrossRef]
- Manjarres-Hernández, E.H.; Arias-Moreno, D.M.; Morillo-Coronado, A.C.; Ojeda-Pérez, Z.Z.; Cárdenas-Chaparro, A. Phenotypic characterization of quinoa (Chenopodium quinoa Willd.) for the selection of promising materials for breeding programs. Plants 2021, 10, 1339. [Google Scholar] [CrossRef] [PubMed]
- De Bock, P.; Van Bockstaele, F.; Muylle, H.; Quataert, P.; Vermeir, P.; Eeckhout, M.; Cnops, G. Yield and nutritional characterization of thirteen quinoa (Chenopodium quinoa Willd.) varieties grown in North-West Europe—Part I. Plants 2021, 10, 2689. [Google Scholar] [CrossRef]
- Escuredo, O.; González Martín, M.I.; Moncada, G.W.; Fischer, S.; Hernández Hierro, J.M. Amino acid profile of the quinoa (Chenopodium quinoa Willd.) using near infrared spectroscopy and chemometric techniques. J. Cereal Sci. 2014, 60, 67–74. [Google Scholar] [CrossRef]
- Granado-Rodríguez, S.; Aparicio, N.; Matías, J.; Pérez-Romero, L.F.; Maestro, I.; Gracés, I.; Pedroche, J.J.; Haros, C.M.; Fernandez-Garcia, N.; Navarro del Hierro, J.; et al. Studying the impact of different field environmental conditions on seed quality of quinoa: The Case of three different years changing seed nutritional traits in Southern Europe. Front. Plant Sci. 2021, 12, 649132. [Google Scholar] [CrossRef]
- Präger, A.; Munz, S.; Nkebiwe, P.M.; Mast, B.; Graeff-Hönninger, S. Yield and quality characteristics of different quinoa (Chenopodium quinoa Willd.) cultivars grown under field conditions in southwestern Germany. Agronomy 2018, 8, 197. [Google Scholar] [CrossRef]
- Emrani, N.; Hasler, M.; Patiranage, D.S.R.; Nathaly, M.T.; Rey, E.; Jung, C. An efficient method to produce segregating populations in quinoa (Chenopodium quinoa). Plant Breed. 2020, 139, 1190–1200. [Google Scholar] [CrossRef]
- Zurita-Silva, A.; Fuentes, F.; Zamora, P.; Jacobsen, S.E.; Schwember, A.R. Breeding quinoa (Chenopodium quinoa Willd.): Potential and perspectives. Mol. Breed. 2014, 34, 13–30. [Google Scholar] [CrossRef]
- Koziol, J.M. Afrosimetric estimation of threshold saponin concentration for bitterness in quinoa (Chenopodium quinoa Wild). J. Sci. Food Agric. 1991, 54, 211–219. [Google Scholar] [CrossRef]
- Community Plant Variety Office (CPVO). Protocol for Tests on Distinctness, Uniformity and Stability Chenopodium quinoa Willd. Quinoa. 2021. 18p. Available online: https://cpvo.europa.eu/sites/default/files/documents/chenopodium.pdf (accessed on 30 October 2024).
- Ward, S.M. Response to selection for reduced grain saponin content in quinoa (Chenopodium quinoa Willd.). Field Crops Res. 2000, 68, 157–163. [Google Scholar] [CrossRef]
- Jacobsen, S.E. The scope for adaptation of quinoa in Northern Latitudes of Europe. J. Agron. Crop Sci. 2017, 203, 603–613. [Google Scholar] [CrossRef]
- European Commission: Agriculture and Rural Development: Greening. Available online: https://ec.europa.eu/agriculture/direct-support/greening_en (accessed on 27 August 2024).
- Ceglar, A.; Zampieri, M.; Toreti, A.; Dentener, F. Observed northward migration of agro-climate zones in Europe will further accelerate under climate change. Earth’s Future 2019, 7, 1088–1101. [Google Scholar] [CrossRef]
- Virto, I.; Imaz, M.J.; Fernández-Ugalde, O.; Gartzia-Bengoetxea, N.; Enrique, A.; Bescansa, P. Soil degradation and soil quality in Western Europe: Current situation and future perspectives. Sustainability 2015, 7, 313–365. [Google Scholar] [CrossRef]
- Rollano-Peñaloza, O.M.; Palma-Encinas, V.; Widell, S.; Rasmusson, A.G.; Mollinedo, P. The disease progression and molecular defense response in Chenopodium quinoa infected with Peronospora variabilis, the causal agent of quinoa downy mildew. Plants 2022, 11, 2946. [Google Scholar] [CrossRef] [PubMed]
- Bhargava, A.; Srivastava, S. Quinoa: Botany, Production and Uses; CABI Publisher: Wallingford, UK, 2013; 247p. [Google Scholar]
- Craine, E.B.; Davies, A.; Packer, D.; Miller, N.D.; Schmökel, S.M.; Spalding, E.P.; Tester, M.; Murphy, K.M. A comprehensive characterization of agronomic and end-use quality phenotypes across a quinoa world core collection. Front. Plant Sci. 2023, 14, 1101547. [Google Scholar] [CrossRef]
- Ren, A.; Jiang, Z.; Dai, J.; Sun, M.; Anwar, S.; Tang, P.; Wang, R.; Ding, P.; Li, L.; Wu, X.; et al. Phenotypic characterization and yield screening of quinoa germplasms in diverse low-altitude regions: A preliminary study. Agronomy 2024, 14, 1354. [Google Scholar] [CrossRef]
- Vleugels, T.; Cnops, G.; Roldán-Ruiz, I. Improving seed yield in red clover through marker assisted parentage analysis. Euphytica 2014, 200, 305–320. [Google Scholar] [CrossRef]
- Tew, T.L.; Pan, Y.B. Microsatellite (simple sequence repeat) marker–based paternity analysis of a seven-parent sugarcane polycross. Crop Sci. 2010, 50, 1401–1408. [Google Scholar] [CrossRef]
- Ferreira, D.S.; Pallone, J.A.L.; Poppi, R.J. Direct analysis of the main chemical constituents in Chenopodium quinoa grain using Fourier transform near-infrared spectroscopy. Food Control 2015, 48, 91–95. [Google Scholar] [CrossRef]
- Koninklijk Meteorologisch Instituut (KMI). Klimatologisch Jaaroverzicht Jaar 2021; KMI-IRM: Ukkel, Belgium, 2022; 12p. [Google Scholar]
- Stanschewski, C.S.; Rey, E.; Fiene, G.; Craine, E.B.; Wellman, G.; Melino, V.J.; S. R. Patiranage, D.; Johansen, K.; Schmöckel, S.M.; Bertero, D.; et al. Quinoa phenotyping methodologies: An international consensus. Plants 2021, 10, 1759. [Google Scholar] [CrossRef]
- Al-Fahham, A.A. Development of new LSD formula when numbers of observations are unequal. Open J. Stat. 2018, 8, 258–263. [Google Scholar] [CrossRef]
- Rojas, W.; Pinto, M.; Alanoca, C.; Gómez Pando, L.; Leon-Lobos, P.; Alercia, A.; Diulgheroff, S.; Padulosi, S.; Bazile, D. Quinoa genetic resources and ex situ conservation. In State of the Art Report on Quinoa Around the World in 2013; FAO: Rome, Italy, 2015; pp. 56–82. [Google Scholar]
- Gomaa, E.F. Effect of nitrogen, phosphorus and biofertilizers on quinoa plant. J. Appl. Sci. Res. 2013, 9, 5210–5222. [Google Scholar]
- Peterson, A.; Jacobsen, S.E.; Bonifacio, A.; Murphy, K. A crossing method for quinoa. Sustainability 2015, 7, 3230–3243. [Google Scholar] [CrossRef]
- Nadeem, M.A.; Nawaz, M.A.; Shahid, M.Q.; Dogan, Y.; Comertpay, G.; Yildiz, M.; Hatipoğlu, R.; Ahmad, F.; Alsaleh, A.; Labhane, N.; et al. DNA molecular markers in plant breeding: Current status and recent advancements in genomic selection and genome editing. Biotechnol. Biotechnol. Equip. 2018, 32, 261–285. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2023; Available online: https://www.R-project.org (accessed on 19 October 2024).
- RStudio Team. RStudio: Integrated Development for R; PBC: Boston, MA, USA, 2023; Available online: http://www.rstudio.com (accessed on 19 October 2024).
- Shenk, J.S.; Westerhaus, M.O. Population definition, sample selection, and calibration procedures for near infrared reflectance spectroscopy. Crop Sci. 1991, 31, 469–474. [Google Scholar] [CrossRef]
- Shenk, J.S.; Westerhaus, M.O. Populations structuring of near infrared spectra and modified partial least squares regression. Crop Sci. 1991, 31, 1548–1555. [Google Scholar] [CrossRef]
- Christensen, S.A.; Pratt, D.B.; Pratt, C.; Nelson, P.T.; Stevens, M.R.; Jellen, E.N.; Coleman, C.E.; Fairbanks, D.J.; Bonifacio, A.; Maughan, M.J. Assessment of genetic diversity in the USDA and CIP-FAO international nursery collections of quinoa (Chenopodium quinoa Willd.) using microsatellite markers. Plant Genet. Resour. Charact. Util. 2007, 5, 82–95. [Google Scholar] [CrossRef]
- Jarvis, D.E.; Kopp, O.R.; Jellen, E.N.; Mallory, M.A.; Pattee, J.; Bonifacio, A.; Coleman, C.E.; Stevens, M.R.; Fairbanks, D.J.; Maughan, P.J. Simple sequence repeat marker development and genetic mapping in quinoa (Chenopodium quinoa Willd.). J. Genet. 2008, 87, 39–51. [Google Scholar] [CrossRef]
- Mason, S.L.; Stevens, M.R.; Jellen, E.N.; Bonifacio, A.; Fairbanks, D.J.; Coleman, C.E.; McCarty, R.R.; Rasmussen, A.G.; Maughan, P.J. Development and use of microsatellite markers for germplasm characterization in quinoa (Chenopodium quinoa Willd.). Crop Sci. 2005, 45, 1618–1630. [Google Scholar] [CrossRef]
- Maughan, P.J.; Bonifacio, A.; Jellen, E.N.; Stevens, M.R.; Coleman, C.E.; Ricks, M.; Mason, S.L.; Jarvis, D.E.; Gardunia, B.W. A genetic linkage map of quinoa (Chenopodium quinoa) based on AFLP, RAPD, and SSR markers. Theor. Appl. Genet. 2004, 109, 1188–1195. [Google Scholar] [CrossRef]
- Romero, M.; Mujica, A.; Pineda, E.; Ccamapaza, Y.; Zavalla, N. Genetic identity based on simple sequence repeat (SSR) markers for Quinoa (Chenopodium quinoa Willd.). Cien. Inv. Agr. 2019, 46, 166–178. [Google Scholar] [CrossRef]
- Doyle, J.J.; Doyle, J.L. Isolation of Plant DNA from fresh tissue. Focus 1990, 12, 39–40. [Google Scholar]
- Hayden, M.J.; Nguyen, T.M.; Waterman, A.; Chalmers, K.J. Multiplex-ready PCR: A new method for multiplexed SSR and SNP genotyping. BMC Genom. 2008, 9, 80. [Google Scholar] [CrossRef] [PubMed]
- Smith, L.M.; Burgoyne, L.A. Collecting, archiving and processing DNA from wildlife samples using FTA databasing paper. BMC Ecol. 2004, 4, 4. [Google Scholar] [CrossRef]
- Zwart, A.B.; Elliot, C.; Hopley, T.; Lovell, D.; Young, A. PolyPatEx: An R package for paternity exclusion in autopolyploids. Mol. Ecol. Resour. 2016, 16, 694–700. [Google Scholar] [CrossRef]



| Variety | Foliage Color * | Foliage Glaucosity * | Stem Color * | Presence of Stem Stripes * | Pigmentation of Leaf Axil * | Leaf Size * | Leaf Dentation * | No. Plants Screened |
|---|---|---|---|---|---|---|---|---|
| Biobio | 1 (100%) | 1 (100%) | 4 (100%) | 1 (100%) | 1 (100%) | 5 (100%) | 5 (100%) | 25 |
| Black Quinoa | 1 (24%), 2 (56%), 5 (20%) | 1 (100%) | 2 (88%), 4 (12%) | 1 (84%), 9 (16%) | 1 (84%), 7 (16%) | 3 (100%) | 1 (100%) | 25 |
| Buffy | 1 (100%) | 1 (100%) | 4 (100%) | 1 (100%) | 1 (100%) | 5 (100%) | 5 (100%) | 25 |
| Chadmo | 2 (100%) | 3 (100%) | 2 (96%), 4 (4%) | 1 (100%) | 1 (96%), 7 (4%) | 5 (100%) | 1 (17%), 3 (42%), 5 (42%) | 24 |
| Cherry Vanilla | 1 (100%) | 1 (100%) | 4 (100%) | 1 (100%) | 1 (100%) | 5 (100%) | 3 (100%) | 24 |
| Cocoa Cherry | 1 (64%), 4 (4%), 5 (32%) | 1 (100%) | 4 (100%) | 1 (100%) | 1 (100%) | 7 (100%) | 3 (4%), 5 (96%) | 25 |
| Colorado Black Shelly 25 | 1 (8%), 2 (68%), 4 (4%), 5 (20%) | 3 (100%) | 2 (84%), 4 (16%) | 1 (16%), 9 (84%) | 1 (88%), 7 (12%) | 3 (100%) | 1 (28%), 3 (60%), 5 (12%) | 25 |
| Fingerhead GP | 1 (61%), 5 (39%) | 3 (91%), 5 (9%) | 2 (65%), 4 (35%) | 1 (70%), 9 (30%) | 1 (61%), 7 (39%) | 7 (100%) | 1 (4%), 3 (35%), 5 (61%) | 22 |
| French Vanilla | 1 (100%) | 3 (100%) | 2 (96%), 4 (4%) | 1 (96%), 9 (4%) | 3 (96%), 7 (4%) | 7 (100%) | 5 (100%) | 25 |
| Golden afternoon | 1 (100%) | 3 (100%) | 2 (92%), 4 (8%) | 1 (92%), 9 (8%) | 1 (88%), 7 (12%) | 7 (100%) | 5 (100%) | 25 |
| Incred White | 2 (100%) | 3 (100%) | 2 (100%) | 9 (100%) | 1 (100%) | 5 (100%) | 1 (12%), 3 (72%), 5 (16%) | 25 |
| Ivory | 3 (100%) | 1 (100%) | 2 (100%) | 9 (100%) | 3 (100%) | 7 (100%) | 3 (23%), 5 (77%) | 22 |
| Kaslala | 2 (67%), 3 (33%) | 1 (100%) | 2 (71%), 4 (29%) | 9 (100%) | 1 (71%), 7 (29%) | 3 (100%) | 1 (96%), 3 (4%) | 24 |
| Kcoito | 1 (4%), 2 (79%), 4 (4%), 5 (13%) | 1 (100%) | 2 (100%) | 9 (100%) | 1 (100%) | 3 (100%) | 1 (100%) | 24 |
| Magenta sunset | 2 (100%) | 3 (100%) | 2 (100%) | 9 (100%) | 1 (100%) | 5 (100%) | 1 (9%), 5 (91%) | 22 |
| Mint Vanilla | 1 (100%) | 3 (100%) | 2 (100%) | 1 (100%) | 1 (100%) | 7 (100%) | 5 (100%) | 25 |
| Oro de Valle | 1 (4%), 2 (96%) | 1 (100%) | 2 (100%) | 9 (100%) | 3 (100%) | 5 (100%) | 1 (100%) | 24 |
| Peppermint | 1 (100%) | 3 (100%) | 1 (100%) | 1 (100%) | 1 (100%) | 7 (100%) | 5 (100%) | 23 |
| Pink Nugget | 1 (20%), 4 (12%), 5 (68%) | 3 (100%) | 4 (100%) | 1 (100%) | 3 (100%) | 3 (100%) | 3 (100%) | 25 |
| Red Head | 1 (100%) | 3 (100%) | 4 (100%) | 1 (100%) | 1 (100%) | 5 (100%) | 5 (100%) | 23 |
| Red Nugget | 1 (14%), 4 (14%), 5 (73%) | 3 (100%) | 4 (100%) | 1 (100%) | 1 (100%) | 5 (100%) | 3 (100%) | 22 |
| Temuco | 1 (4%), 2 (96%) | 3 (100%) | 2 (100%) | 9 (100%) | 1 (100%) | 5 (100%) | 5 (100%) | 24 |
| White Nugget | 1 (100%) | 3 (100%) | 4 (100%) | 1 (100%) | 1 (100%) | 5 (100%) | 1 (8%), 3 (92%) | 24 |
| White Spike | 1 (100%) | 1 (100%) | 4 (100%) | 1 (100%) | 1 (100%) | 5 (100%) | 3 (4%), 5 (96%) | 25 |
| Zeno | 2 (100%) | 1 (100%) | 2 (100%) | 1 (100%) | 1 (100%) | 3 (100%) | 1 (100%) | 24 |
| Variety | Growth Habit * | Inflorescence Color * | Panicle Shape * | Panicle Width * | Panicle Density * | Panicle Color * | Seed Color ** | No. Plants Screened |
|---|---|---|---|---|---|---|---|---|
| Biobio | 1 (100%) | 2 (100%) | 1 (100%) | 5 (100%) | 1 (100%) | 3 (100%) | white | 25 |
| Black Quinoa | 5 (100%) | 2 (84%), 5 (8%), 6 (8%) | 1 (100%) | 7 (100%) | 1 (100%) | 2 (4%), 3 (8%), 4 (8%), 5 (56%), 10 (24%) | black, red | 25 |
| Buffy | 1 (100%) | 1 (100%) | 1 (100%) | 5 (100%) | 1 (100%) | 1 (4%), 3 (96%) | beige | 25 |
| Chadmo | 5 (100%) | 1 (96%), 6 (4%) | 1 (100%) | 7 (100%) | 3 (100%) | 5 (100%) | beige, red | 24 |
| Cherry Vanilla | 1 (100%) | 1 (96%), 5 (4%) | 1 (100%) | 5 (100%) | 1 (100%) | 1 (4%), 3 (92%), 5 (4%) | white | 24 |
| Cocoa Cherry | 1 (100%) | 2 (88%), 6 (12%) | 1 (100%) | 5 (100%) | 1 (100%) | 2 (12%), 3 (84%), 5 (4%) | beige-pink | 25 |
| Colorado Black Shelly 25 | 5 (100%) | 2 (88%), 6 (12%) | 1 (100%) | 7 (100%) | 3 (100%) | 2 (20%), 3 (16%), 5 (20%), 10 (44%) | red, black, brown | 25 |
| Fingerhead GP | 3 (100%) | 1 (52%), 6 (48%) | 1 (100%) | 3 (4%), 5 (96%) | 1 (100%) | 2 (48%), 5 (43%), 10 (9%) | beige, brown | 22 |
| French Vanilla | 5 (100%) | 1 (100%) | 1 (100%) | 5 (100%) | 1 (100%) | 5 (100%) | beige | 25 |
| Golden Afternoon | 5 (100%) | 1 (100%) | 1 (100%) | 5 (100%) | 3 (100%) | 3 (64%), 5 (28%), 8 (8%) | beige | 25 |
| Incred White | 5 (100%) | 2 (100%) | 1 (100%) | 7 (100%) | 5 (100%) | 7 (100%) | white | 25 |
| Ivory | 5 (100%) | 2 (100%) | 1 (100%) | 7 (100%) | 1 (100%) | 5 (100%) | beige | 22 |
| Kaslala | 5 (100%) | 2 (71%), 6 (29%) | 1 (100%) | 7 (100%) | 5 (100%) | 2 (25%), 4 (46%), 5 (21%), 7 (4%), 10 (4%) | red, beige | 24 |
| Kcoito | 5 (100%) | 2 (96%), 6 (4%) | 1 (100%) | 7 (100%) | 3 (100%) | 4 (63%), 6 (38%) | red, beige | 24 |
| Magenta Sunset | 5 (100%) | 1 (91%), 5 (9%) | 1 (100%) | 7 (100%) | 3 (100%) | 1 (4%), 3 (96%) | beige | 22 |
| Mint Vanilla | 5 (100%) | 1 (100%) | 1 (100%) | 5 (100%) | 3 (100%) | 5 (100%) | white | 25 |
| Oro de Valle | 5 (100%) | 2 (100%) | 1 (100%) | 7 (100%) | 3 (100%) | 5 (46%), 6 (54%) | beige | 24 |
| Peppermint | 5 (100%) | 1 (100%) | 1 (100%) | 5 (100%) | 3 (100%) | 5 (100%) | white | 23 |
| Pink Nugget | 5 (100%) | 2 (96%), 6 (4%) | 1 (100%) | 5 (100%) | 3 (100%) | 2 (4%), 3 (96%) | brown-pink | 25 |
| Red Head | 5 (100%) | 2 (100%) | 1 (100%) | 5 (100%) | 3 (100%) | 5 (83%), 10 (17%) | beige | 23 |
| Red Nugget | 5 (100%) | 2 (100%) | 1 (100%) | 5 (100%) | 3 (100%) | 3 (100%) | brown-pink | 22 |
| Temuco | 5 (100%) | 2 (100%) | 1 (100%) | 7 (100%) | 5 (100%) | 1 (79%), 7 (21%) | beige | 24 |
| White Nugget | 5 (100%) | 2 (100%) | 1 (100%) | 5 (100%) | 3 (100%) | 3 (13%), 5 (88%) | beige, beige-pink | 24 |
| White Spike | 5 (100%) | 1 (100%) | 1 (100%) | 5 (100%) | 3 (100%) | 5 (100%) | beige | 25 |
| Zeno | 5 (100%) | 1 (100%) | 1 (100%) | 7 (100%) | 1 (100%) | 5 (100%) | white | 24 |
| Variety | Heading Date (DAS) | Maturity Date (DAS) | Plant Height at Harvest (cm) | Seed Yield per Plant (g) | TSW (g) | Seed Saponin Content (cm Foam) | No. Low-Saponin Plants | Seed Protein Content (%) | No. Plants Screened |
|---|---|---|---|---|---|---|---|---|---|
| Biobio | 83 ± 0 | 138 ± 0 | 149 ± 17 | 65 ± 23 | 2.9 ± 0.2 | 1.9 ± 1.0 | 5 | 14.1 ± 0.6 | 25 |
| Black Quinoa | 66 ± 3 | 150 ± 8 | 119 ± 21 | 76 ± 42 | 3.2 ± 0.5 | 3.2 ± 1.3 | 1 | 13.2 ± 1.0 | 25 |
| Buffy | 83 ± 0 | 145 ± 0 | 138 ± 15 | 73 ± 24 | 2.7 ± 0.2 | 2.6 ± 0.6 | 1 | 13.6 ± 0.6 | 25 |
| Chadmo | 77 ± 9 | 169 ± 7 | 145 ± 37 | 56 ± 39 | 1.6 ± 0.2 | 1.6 ± 0.8 | 9 | 12.3 ± 1.3 | 22 |
| Cherry Vanilla | 83 ± 0 | 145 ± 0 | 147 ± 21 | 54 ± 22 | 2.7 ± 0.2 | 1.3 ± 0.9 | 8 | 14.3 ± 0.9 | 25 |
| Cocoa Cherry | 83 ± 0 | 147 ± 0 | 158 ± 24 | 90 ± 40 | 2.9 ± 0.3 | 3.7 ± 1.5 | 1 | 13.1 ± 0.6 | 25 |
| Colorado BS 25 | 71 ± 8 | 174 ± 11 | 164 ± 31 | 75 ± 63 | 3.0 ± 0.4 | 2.2 ± 2.1 | 9 | 14.0 ± 1.9 | 22 |
| Fingerhead GP | 90 ± 0 | 163 ± 6 | 184 ± 42 | 49 ± 30 | 2.6 ± 0.5 | 2.7 ± 1.8 | 7 | 15.0 ± 1.7 | 23 |
| French Vanilla | 90 ± 0 | 158 ± 0 | 154 ± 16 | 80 ± 44 | 3.1 ± 0.3 | 1.9 ± 1.4 | 6 | 13.6 ± 0.5 | 25 |
| Golden Afternoon | 66 ± 0 | 147 ± 0 | 147 ± 18 | 69 ± 33 | 2.4 ± 0.1 | 1.5 ± 1.1 | 10 | 14.0 ± 1.0 | 25 |
| Incred White | 72 ± 8 | 125 ± 0 | 136 ± 23 | 61 ± 36 | 2.4 ± 0.4 | 1.1 ± 1.1 | 16 | 13.6 ± 1.3 | 25 |
| Ivory | 70 ± 3 | 138 ± 0 | 146 ± 12 | 137 ± 51 | 2.9 ± 0.1 | 2.7 ± 0.8 | 4 | 12.4 ± 0.6 | 22 |
| Kaslala | 67 ± 1 | 125 ± 0 | 125 ± 21 | 52 ± 31 | 2.6 ± 0.3 | 2.2 ± 1.7 | 7 | 13.9 ± 1.5 | 24 |
| Kcoito | 66 ± 0 | 151 ± 6 | 115 ± 11 | 62 ± 34 | 2.6 ± 0.2 | 3.0 ± 1.0 | 3 | 14.3 ± 1.1 | 24 |
| Magenta sunset | 68 ± 3 | 125 ± 0 | 126 ± 21 | 60 ± 39 | 2.2 ± 0.2 | 0.8 ± 0.4 | 20 | 12.9 ± 1.3 | 23 |
| Mint Vanilla | 83 ± 0 | 151 ± 0 | 133 ± 17 | 71 ± 18 | 2.6 ± 0.2 | 0.9 ± 1.0 | 20 | 13.4 ± 0.6 | 25 |
| Oro de Valle | 67 ± 4 | 150 ± 7 | 134 ± 18 | 93 ± 48 | 3.0 ± 0.2 | 3.9 ± 1.0 | 3 | 12.1 ± 0.7 | 23 |
| Peppermint | 83 ± 0 | 151 ± 0 | 139 ± 15 | 63 ± 36 | 3.0 ± 0.2 | 1.1 ± 0.5 | 9 | 13.3 ± 0.6 | 24 |
| Pink Nugget | 83 ± 0 | 145 ± 0 | 170 ± 16 | 47 ± 19 | 2.8 ± 0.3 | 5.7 ± 1.5 | 1 | 16.1 ± 0.9 | 25 |
| Red Head | 83 ± 0 | 151 ± 0 | 163 ± 19 | 51 ± 30 | 3.1 ± 0.2 | 1.5 ± 0.4 | 3 | 13.8 ± 0.9 | 23 |
| Red Nugget | 83 ± 0 | 151 ± 0 | 167 ± 13 | 60 ± 18 | 2.7 ± 0.2 | 3.3 ± 1.7 | 3 | 15.4 ± 0.9 | 22 |
| Temuco | 67 ± 0 | 125 ± 0 | 119 ± 18 | 42 ± 18 | 1.8 ± 0.2 | 1.1 ± 0.6 | 11 | 14.3 ± 0.8 | 24 |
| White Nugget | 83 ± 0 | 152 ± 0 | 165 ± 18 | 55 ± 22 | 2.8 ± 0.2 | 5.2 ± 1.2 | 2 | 15.6 ± 0.6 | 23 |
| White Spike | 83 ± 0 | 152 ± 0 | 144 ± 25 | 68 ± 40 | 2.9 ± 0.2 | 3.1 ± 1.6 | 1 | 14.6 ± 0.6 | 25 |
| Zeno | 63 ± 1 | 116 ± 0 | 90 ± 10 | 39 ± 15 | 3.6 ± 0.1 | 1.9 ± 0.6 | 2 | 14.8 ± 0.5 | 24 |
| Variety average | 76 ± 2 | 146 ± 3 | 143 ± 4 | 66 ± 4 | 2.7 ± 0.1 | 2.4 ± 0.3 | 162 (total) | 13.9 ± 0.2 | 598 (total) |
| CV (%) | 1.9 | 1.6 | 15 | 54 | 9.9 | 49 | 7.2 | ||
| Significance | *** | *** | *** | *** | *** | *** | *** | ||
| LSDd | 20 | 28 | 47 | 47 | 3.0 | 1.0 | 2.3 |
| Maturity Date | Plant Height | Seed Yield | Saponin Content | TSW | Protein Content | |
|---|---|---|---|---|---|---|
| Heading date | 0.49 * | 0.73 * | −0.08 | 0.17 | −0.11 | 0.29 |
| Maturity date | 0.63 *** | 0.18 | 0.23 | 0.02 | −0.05 | |
| Plant height at seed harvest | 0.08 | 0.37 | −0.01 | 0.30 | ||
| Seed yield per plant | 0.12 | 0.24 | −0.60 ** | |||
| Saponin content | 0.30 | 0.43 * | ||||
| TSW | 0.13 |
| Multiplex | Marker | Fluorescent Label | SSR Fragments Observed in | ||
|---|---|---|---|---|---|
| SSR Set | Zeno | Black Quinoa | Oro de Valle | ||
| a | QCA071 F | FAM | 142 | 152 | 137 |
| a | QAAT069 | PET | 195 | 195/200 | 198 |
| a | QCA107 | NED | 155 | 155/157 | 155 |
| a | QCA024 | VIC | 226 | 236/238/255 | 225/226 |
| b | QATG019 | FAM | 163 | 163/166 | 162 |
| b | KGA003 | PET | 160/161 | 160 | 160 |
| b | QCA057 | NED | 184/185 | 168/186 | 187 |
| b | QCA037 | VIC | 179 | 177/187 | 187 |
| c | QAAT024 F | FAM | 235 | 195/235 | 222/235 |
| c | QAAT076 F | PET | 181 | 168/169/173 | 169/172 |
| c | KGA027 F | NED | 144 | 144/152 | 144 |
| c | QAAT050 F | VIC | 197 | 194/197/210/212 | 197 |
| Variety Pair | No. of Seed Lots Used (♀ × ♂) * | No. Pair Crosses Performed | No. Progeny Screened | Success Rate (%) | True F1 Identified (%) |
|---|---|---|---|---|---|
| 1 | 3 × 3 | 24 | 232 | 92 | 17 |
| 2 | 1 × 14 | 50 | 453 | 77 | 17 |
| 3 | 1 × 2 | 5 | 47 | 96 | 9 |
| 4 | 1 × 3 | 7 | 44 | 93 | 14 |
| 5 | 1 × 2 | 5 | 68 | 97 | 41 |
| Variety Name | Seed Source | Origin |
|---|---|---|
| Biobio | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Buffy | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Cherry Vanilla | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Cocoa Cherry | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Fingerhead GP | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| French Vanilla | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Golden afternoon | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Incred White | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Ivory | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Kaslala | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Mint Vanilla | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Peppermint | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Pink Nugget | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Red Head | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Red Nugget | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| White Nugget | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| White Spike | Wild Garden Seeds, Philomath, OR, USA | Oregon, USA |
| Black Quinoa | De Nieuwe tuin, De Klinge, Belgium | Colorado, USA |
| Kcoito | De Nieuwe tuin, De Klinge, Belgium | Bolivia |
| Oro de Valle | De Nieuwe tuin, De Klinge, Belgium | Oregon, USA |
| Chadmo | Association Kokopelli, Le Mas d’Azil, France | Chile |
| Colorado Black Shelly 25 | Association Kokopelli, Le Mas d’Azil, France | Colorado, USA |
| Magenta sunset | Association Kokopelli, Le Mas d’Azil, France | Oregon, USA |
| Temuco | Association Kokopelli, Le Mas d’Azil, France | Chile |
| Zeno | Hohenheim University, Stuttgart, Germany | Austria |
| Trait | Units | Observation Date (DAS) | Score 1 | Score 2 | Score 3 | Score 4 | Score 5 | Score 6 | Score 7 | Score 8 | Score 9 | Score 10 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Foliage color S | score | 62 | light green | medium green | dark green | red | purple | |||||
| Foliage glaucosity S | score | 70 | absent | weak | medium | strong | ||||||
| Stem color S | score | 69 | white | green | yellow | purple | NA | |||||
| Presence of stem stripes S | score | 69 | absent | present | ||||||||
| Pigmentation of leaf axil S | score | 69 | absent | very weak | weak | medium | strong | |||||
| Leaf size S | score | 76 | small | medium | large | |||||||
| Leaf dentation S | score | 68 | absent | weak | medium | strong | ||||||
| Growth habit S | score | 83 | not branched | sparse | substantial | no main panicle | ||||||
| Inflorescence color S | score | 76–90 | white | green | yellow | orange | pink | purple | ||||
| Panicle shape S | score | 83–90 | glomerulate | intermediate | amarantiform | |||||||
| Panicle width S | score | 84 | narrow | medium | broad | |||||||
| Panicle density S | score | 83–104 | loose | intermediate | axis rarely visible | compact | ||||||
| Panicle color S | color | 83–90 | white | purple | red | pink | yellow | orange | brown | gray | black | green |
| Seed color S | color | white | beige | yellow | brown | red | black | |||||
| Heading date S | DAS | 60–74 | ||||||||||
| Maturity date S | DAS | 116–185 | ||||||||||
| Plant height at harvest S | cm | 109 | ||||||||||
| Seed weight | g | |||||||||||
| TSW | g | |||||||||||
| Seed saponin content K | cm foam | |||||||||||
| No. of low-saponin plants | # | |||||||||||
| Seed crude protein content | % |
| Marker | Forward Primer | Reverse Primer | Amplification Range | Linkage Group | Number of Alleles | Fluorescent Label Used |
|---|---|---|---|---|---|---|
| KGA03 b | attgccgacaatgaacgaat | atgtaaatggcatgtcccaac | 140–182 | 26 | 5 [36], 21 [35] | HEX * |
| KGA27 c | ttgtacagaggaagtggcaaga | catcttacagctctggctttcc | 126–158 | NA | 6 [36], 16 [35] | NED |
| QAAT024 c | accataacagcacccacctt | agggatcaatcttgttcattca | 201–257 | 15 | 6 [37], 20 [35] | FAM |
| QAAT050 c | ggcacgtgctgctactcata | tatggcgaatggttaatttgc | 158–246 | 13 | 9 [37], 27 [35] | VIC |
| QAAT069 a | gtttcctttgaggcttggac | ggatttgtacgaatagttgggatt | 193–266 | NA | 4 [37], 15 [35] | NED |
| QAAT070 | tgaacaggatcgtcatagtcaa | cgttcatcatctgacccaat | 158–208 | NA | 7 [37], 17 [35] | NED |
| QAAT074 | atggaacacccatccgataa | atgcctatcctcatcctcca | 169–224 | NA | 9 [37], 16 [35] | FAM |
| QAAT076 c | gcttcatgtgttataaaatgccaat | tctcggcttcccactaatttt | 145–227 | NA | 8 [37], 27 [35] | HEX * |
| QAAT078 | agcgaaggaaatttggaact | taacgatacgctccaaggaa | 183–226 | 12 | 5 [37], 13 [35] | HEX * |
| QATG019 b | ccaaacaaagacaataaggaaacc | cgaggttgaaggagattcca | 175–193 | 11 | 6 [37], 7 [35] | FAM |
| QCA019 | tttcatcactcgaccgtatagc | agggtgactgttacacccaaa | 183–212 | 2 | 3 [37], 6 [35] | VIC |
| QCA024 a | agatgagcttgaatcattacatc | tacatactgtaaatcatgccaaa | 235–254 | NA | 3 [37], 7 [35] | VIC |
| QCA037 b | ccgttcttccagaccaattc | tcatgagccacttcatacacg | 186–206 | 18 | 5 [37], 9 [35] | VIC |
| QCA038 | catttcccaaactgcatgaat | atgtgtgttgcgtgtgagtg | 198–209 | NA | 4 [37], 5 [35] | VIC |
| QCA048 | acaatacatacataacccaatattcaa | tggaaatgtcactatgattgga | 246–258 | 12 | 3 [37], 6 [35] | FAM |
| QCA057 b | tgcaaggaaaccatctttgg | tgcctcacagtcacacctaca | 196-240 | 2 | 4 [37], 8 [35] | NED |
| QCA071 a | aacaacgaaattacgagaatgtca | tctcacgagagtcttccccta | 140–177 | NA | 4 [37], 16 [35] | FAM |
| QCA107 a | acaggctgtgggtccactt | tcaagcaatactcaccttgtgg | 153–167 | 1 | 5 [37], 5 [35] | NED |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vleugels, T.; Van Waes, C.; De Keyser, E.; Cnops, G. Optimization of Breeding Tools in Quinoa (Chenopodium quinoa) and Identification of Suitable Breeding Material for NW Europe. Plants 2025, 14, 3. https://doi.org/10.3390/plants14010003
Vleugels T, Van Waes C, De Keyser E, Cnops G. Optimization of Breeding Tools in Quinoa (Chenopodium quinoa) and Identification of Suitable Breeding Material for NW Europe. Plants. 2025; 14(1):3. https://doi.org/10.3390/plants14010003
Chicago/Turabian StyleVleugels, Tim, Chris Van Waes, Ellen De Keyser, and Gerda Cnops. 2025. "Optimization of Breeding Tools in Quinoa (Chenopodium quinoa) and Identification of Suitable Breeding Material for NW Europe" Plants 14, no. 1: 3. https://doi.org/10.3390/plants14010003
APA StyleVleugels, T., Van Waes, C., De Keyser, E., & Cnops, G. (2025). Optimization of Breeding Tools in Quinoa (Chenopodium quinoa) and Identification of Suitable Breeding Material for NW Europe. Plants, 14(1), 3. https://doi.org/10.3390/plants14010003

