Au-Based Nanoparticles Enhance Low Temperature Tolerance in Wheat by Regulating Some Physiological Parameters and Gene Expression
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Experimental Design
4.2. The synthesis of Au-NPs
4.3. Growth Conditions
4.4. Parameters of Growth
4.5. Survival of Plants after Freezing
4.6. Quantification of Au
4.7. Dry Matter Content
4.8. Lipid Peroxidation Level (LPO)
4.9. Content of Chlorophylls and Carotenoids
4.10. Soluble Sugars (Glucose, Fructose, and Sucrose) Content
4.11. Total RNA Extraction and cDNA Synthesis
4.12. Gene Expression by RT-qPCR
4.13. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hosseini, M.; Maali-Amiri, R.; Mahfoozi, S.; Fowler, D.B.; Mohammadi, R. Developmental regulation of metabolites and low temperature tolerance in lines of crosses between spring and winter wheat. Acta Physiol. Plant. 2016, 38, 87. [Google Scholar] [CrossRef]
- Hassan, M.A.; Xiang, C.; Farooq, M.; Muhammad, N.; Yan, Z.; Hui, X.; Yuanyuan, K.; Bruno, A.K.; Lele, Z.; Jincai, L. Cold Stress in Wheat: Plant Acclimation Responses and Management Strategies. Front. Plant Sci. 2021, 12, 676884. [Google Scholar] [CrossRef] [PubMed]
- Darkó, É.; Pál, M.; Janda, T. Abiotic stress responses and tolerance in wheat under climate change. In Sustainable Crop Productivity and Quality under Climate Change Responses of Crop Plants to Climate Change; Liu, F., Li, X., Hogy, P., Jiang, D., Brestic, M., Liu, B., Eds.; Elsevier: Amsterdam, The Netherlands; Academic press: Cambridge, MA, USA, 2022; pp. 137–155. [Google Scholar] [CrossRef]
- Hurry, V.M.; Strand, A.; Tobiaeson, M.; Gardestrom, P.; Oquist, G. Cold Hardening of Spring and Winter Wheat and Rape Results in Differential Effects on Growth, Carbon Metabolism, and Carbohydrate Content. Plant Physiol. 1995, 109, 697–706. [Google Scholar] [CrossRef] [PubMed]
- Venzhik, Y.; Talanova, V.; Titov, A. Features of the Photosynthetic Apparatus in Winter and Spring Wheat Plants with Different Cold Tolerance. Russ. Agric. Sci. 2014, 40, 233–236. [Google Scholar] [CrossRef]
- Janmohammadi, M.; Enayati, V.; Sabaghnia, N. Impact of cold acclimation, de-acclimation and re-acclimation on carbohydrate content and antioxidant enzyme activities in spring and winter wheat. Icel. Agric. Sci. 2012, 25, 3–11. [Google Scholar]
- Winfield, M.O.; Lu, C.; Wilson, I.D.; Coghill, J.A.; Edwards, K.J. Plant responses to cold: Transcriptome analysis of wheat. Plant Biotechnol. J. 2010, 8, 749–771. [Google Scholar] [CrossRef] [PubMed]
- Tsvetanov, S.; Atanassov, A.; Nakamura, C. Gold Responsive Gene/Protein Families and Cold/Freezing Tolerance in Cereals. Biotechnol. Biotechnol. Equip. 2014, 14, 3–11. [Google Scholar] [CrossRef]
- Savitch, L.V.; Harney, T.; Huner, N.P.A. Sucrose metabolism in spring and winter wheat in response to high irradiance, cold stress and cold acclimation. Physiol. Plant 2000, 108, 270–278. [Google Scholar] [CrossRef]
- Goyal, K.; Walton, L.J.; Tunnacliffe, A. LEA proteins prevent protein aggregation due to water stress. Biochem. J. 2005, 388, 151–157. [Google Scholar] [CrossRef]
- Fowler, S.; Thomashow, M.F. Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 2002, 14, 1675–1690. [Google Scholar] [CrossRef] [PubMed]
- Talanova, V.; Titov, A.F.; Topchieva, L.; Malysheva, I.; Venzhik, Y.; Frolova, S.A. Expression of WRKY Transcription Factor and Stress Protein Genes in Wheat Plants during Cold Hardening and ABA Treatment. Russ. J. Plant Physiol. 2009, 56, 702–708. [Google Scholar] [CrossRef]
- Takumi, S.; Koike, A.; Nakata, M.; Kume, S.; Ohno, R.; Nakamura, C. Cold-specific and light-stimulated expression of a wheat (Triticum aestivum L.) Cor gene Wcor15 encoding a chloroplast-targeted protein. J. Exp. Bot. 2003, 54, 2265–2274. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.; Thomashow, M.F. A cold-regulated Arabidopsis gene encodes a polypeptide having potent cryoprotective activity. Biochem. Biophys. Res. Commun. 1992, 183, 1103–1108. [Google Scholar] [CrossRef] [PubMed]
- Artus, N.N.; Uemura, M.; Steponkus, P.L.; Gilmour, S.J.; Lin, C.; Thomashow, M.F. Constitutive expression of the cold-regulated Arabidopsis thaliana COR15a gene affects both chloroplast and protoplast freezing tolerance. Proc. Natl. Acad. Sci. USA 1996, 93, 13404–13409. [Google Scholar] [CrossRef] [PubMed]
- Thalhammer, A.; Bryant, G.; Sulpice, R.; Hincha, D.K. Disordered cold regulated15 proteins protect chloroplast membranes during freezing through binding and folding, but do not stabilize chloroplast enzymes in vivo. Plant Physiol. 2014, 166, 190–201. [Google Scholar] [CrossRef] [PubMed]
- Sarraf, M.; Vishwakarma, K.; Kumar, V.; Arif, N.; Das, S.; Johnson, R.; Janeeshma, E.; Puthur, J.T.; Aliniaeifard, S.; Chauhan, D.K.; et al. Metal/Metalloid-Based Nanomaterials for Plant Abiotic Stress Tolerance: An Overview of the Mechanisms. Plants 2022, 11, 316. [Google Scholar] [CrossRef] [PubMed]
- Azameti, M.K.; Imoro, A.-W.M. Nanotechnology: A promising field in enhancing abiotic stress tolerance in plants. Crop Des. 2023, 2, 100037. [Google Scholar] [CrossRef]
- Ijaz, M.; Khan, F.; Ahmed, T.; Noman, M.; Zulfiqar, F.; Rizwan, M.; Chen, J.; Siddique, K.H.M.; Li, B. Nanobiotechnology to advance stress resilience in plants: Current opportunities and challenges. Mater. Today Bio 2023, 22, 100759. [Google Scholar] [CrossRef] [PubMed]
- Zafar, H.; Javed, R.; Zia, M. Nanotoxicity assessment in plants: An updated overview. Environ. Sci. Poll. Res. 2023, 30, 93323–93344. [Google Scholar] [CrossRef] [PubMed]
- Sanzari, I.; Leone, A.; Ambrosone, A. Nanotechnology in plant science: To make a long story short. Front. Bioeng. Biotechnol. 2019, 7, 120. [Google Scholar] [CrossRef] [PubMed]
- Solano, R.; Patino-Ruiz, D.; Tejeda-Benitez, L.; Herrera, A. Metal- and metal/oxide-based engineered nanoparticles and nanostructures: A review on the applications, nanotoxicological effects, and risk control strategies. Env. Sci. Pollut. Res. Int. 2021, 28, 16962–16981. [Google Scholar] [CrossRef] [PubMed]
- Goswami, P.; Yadav, S.; Mathur, J. Positive and negative effects of nanoparticles on plants and their applications in agriculture. Plant Sci. Today 2019, 6, 232. [Google Scholar] [CrossRef]
- Alaqad, K.; Saleh, T.A. Gold and silver nanoparticles: Synthesis methods, characterization routes and applications towards drugs. J. Environ. Anal. Toxicol. 2016, 6, 384. [Google Scholar] [CrossRef]
- Dykman, L.; Khlebtsov, N. Methods for chemical synthesis of colloidal gold. Russ. Chem. Rev. 2019, 88, 229. [Google Scholar] [CrossRef]
- Bandi, R.; Dadigala, R.; Alle, M. Emerging role of gold nanoparticles for healthier crop plants growth and enhanced yield. In Engineered Nanomaterials for Sustainable Agricultural Production, Soil Improvement and Stress Management; Husen, A., Ed.; Elsevier: Amsterdam, The Netherlands, 2022; pp. 125–143. [Google Scholar]
- Siegel, J.; Zaruba, K.; Svorcik, V.; Kroumanova, K.; Burketova, L.; Martinec, J. Round-shape gold nanoparticles: Effect of particle size and concentration on Arabidopsis thaliana root growth. Nanoscale Res. Lett. 2018, 13, 95. [Google Scholar] [CrossRef] [PubMed]
- Ramalingam, V. Multifunctionality of gold nanoparticles: Plausible and convincing properties. Adv. Colloid. Interface Sci. 2019, 271, 101989. [Google Scholar] [CrossRef] [PubMed]
- Ferrari, E.; Barbero, F.; Busquets-Fite, M.; Franz-Wachtel, M.; Kohler, H.R.; Puntes, V.; Kemmerling, B. Growth-Promoting Gold Nanoparticles Decrease Stress Responses in Arabidopsis Seedlings. Nanomaterials 2021, 11, 3161. [Google Scholar] [CrossRef] [PubMed]
- Venzhik, Y.; Moshkov, I.; Dykman, L. Gold Nanoparticles in Plant Physiology: Principal Effects and Prospects of Application. Russ. J. Plant Physiol. 2021, 68, 401–412. [Google Scholar] [CrossRef]
- Mahakham, W.; Theerakulpisut, P.; Maensiri, S.; Phumying, S.; Sarmah, A.K. Environmentally benign synthesis of phytochemicals-capped gold nanoparticles as nanopriming agent for promoting maize seed germination. Sci. Total Environ. 2016, 573, 1089–1102. [Google Scholar] [CrossRef] [PubMed]
- Kumar, V.; Guleria, P.; Kumar, V.; Yadav, S.K. Gold nanoparticle exposure induces growth and yield enhancement in Arabidopsis thaliana. Sci. Total Environ. 2013, 461–462, 462–468. [Google Scholar] [CrossRef] [PubMed]
- Das, S.; Debnath, N.; Pradhan, S.; Goswami, A. Enhancement of photon absorption in the light-harvesting complex of isolated chloroplast in the presence of plasmonic gold nanosol—A nanobionic approach towards photosynthesis and plant primary growth augmentation. Gold Bull. 2017, 50, 247–257. [Google Scholar] [CrossRef]
- Arora, S.; Sharma, P.; Kumar, S.; Nayan, R.; Khanna, P.; Zaidi, M.G.H. Gold-nanoparticle induced enhancement in growth and seed yield of Brassica juncea. Plant Growth Regul. 2012, 66, 303–310. [Google Scholar] [CrossRef]
- Gunjan, B.; Zaidi, M.G.H.; Sandeep, A. Impact of gold nanoparticles on physiological and biochemical characteristics of Brassica juncea. J. Plant Biochem. Physiol. 2014, 2, 3. [Google Scholar] [CrossRef]
- Gopinath, K.; Gowri, S.; Karthika, V.; Arumugam, A. Green synthesis of gold nanoparticles from fruit extract of Terminalia arjuna, for the enhanced seed germination activity of Gloriosa superb. J. Nanostructure Chem. 2014, 4, 115–125. [Google Scholar] [CrossRef]
- Zaka, M.; Abbasi, B.H.; Rahman, L.U.; Shah, A.; Zia, M. Synthesis and characterisation of metal nanoparticles and their effects on seed germination and seedling growth in commercially important Eruca sativa. IET Nanobiotechnol. 2016, 10, 134–140. [Google Scholar] [CrossRef] [PubMed]
- Jadczak, P.; Kulpa, D.; Bihun, M.; Przewodowski, W. Positive effect of AgNPs and AuNPs in in vitro cultures of Lavandula angustifolia Mill. Plant Cell Tissue Organ Cult. (PCTOC) 2019, 139, 191–197. [Google Scholar] [CrossRef]
- Wan, Y.; Li, J.; Ren, H.; Huang, J.; Yuan, H. Physiological investigation of gold nanorods toward watermelon. J. Nanosci. Nanotechnol. 2014, 14, 6089–6094. [Google Scholar] [CrossRef] [PubMed]
- Debnath, P.; Mondal, A.; Hajra, A.; Das, C.; Mondal, N.K. Cytogenetic effects of silver and gold nanoparticles on Allium cepa roots. JGEB 2018, 16, 519–526. [Google Scholar] [CrossRef] [PubMed]
- Milewska-Hendel, A.; Gepfert, V.; Zubko, M.; Kurczyńska, E. Morphological, histological and ultrastructural changes in Hordeum vulgare (L.) roots that have been exposed to negatively charged gold nanoparticles. Appl. Sci. 2022, 12, 3265. [Google Scholar] [CrossRef]
- Avellan, A.; Yun, J.; Zhang, Y.; Spielman-Sun, E.; Unrine, J.M.; Thieme, J.; Li, J.; Lombi, E.; Bland, G.; Lowry, G.V. Nanoparticle Size and Coating Chemistry Control Foliar Uptake Pathways, Translocation, and Leaf-to-Rhizosphere Transport in Wheat. ACS Nano 2019, 13, 5291–5305. [Google Scholar] [CrossRef] [PubMed]
- Torres, R.; Diz, V.E.; Lagorio, M.G. Effects of gold nanoparticles on the photophysical and photosynthetic parameters of leaves and chloroplasts. Photochem. Photobiol. Sci. 2018, 17, 505–516. [Google Scholar] [CrossRef] [PubMed]
- Alkilany, A.M.; Murphy, C.J. Toxicity and cellular uptake of gold nanoparticles: What we have learned so far? J. Nanopart Res. 2010, 12, 2313–2333. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Xianyu, Y. When nano meets plants: A review on the interplay between nanoparticles and plants. Nano Today 2021, 38, 101143. [Google Scholar] [CrossRef]
- Lou-Franco, J.; Das, B.; Cao, c.; Elliott, C. Gold Nanozymes: From Concept to Biomedical Applications. Nano-Micro Lett. 2020, 13, 1–36. [Google Scholar] [CrossRef] [PubMed]
- Dai, S.; Wang, B.; Song, Y.; Xie, Z.; Li, C.; Li, S.; Huang, Y.; Jiang, M. Astaxanthin and its gold nanoparticles mitigate cadmium toxicity in rice by inhibiting cadmium translocation and uptake. Sci. Total Environ. 2021, 786, 147496. [Google Scholar] [CrossRef] [PubMed]
- Jiang, M.; Dai, S.; Wang, B.; Xie, Z.; Li, J.; Wang, L.; Li, S.; Tan, Y.; Tian, B.; Shu, Q.; et al. Gold nanoparticles synthesized using melatonin suppress cadmium uptake and alleviate its toxicity in rice. Environ. Sci. Nano 2021, 8, 1042–1056. [Google Scholar] [CrossRef]
- Wahid, I.; Rani, P.; Kumari, S.; Ahmad, R.; Hussain, S.J.; Alamri, S.; Tripathy, N.; Khan, M.I.R. Biosynthesized gold nanoparticles maintained nitrogen metabolism, nitric oxide synthesis, ions balance, and stabilizes the defense systems to improve salt stress tolerance in wheat. Chemosphere 2022, 287, 132142. [Google Scholar] [CrossRef]
- Venzhik, Y.; Deryabin, A.; Popov, V.; Dykman, L.; Moshkov, I. Gold nanoparticles as adaptogens increasing the freezing tolerance of wheat seedlings. Environ. Sci. Poll. Res. 2022, 9, 55235–55249. [Google Scholar] [CrossRef]
- Rhaman, M.S.; Tania, S.S.; Imran, S.; Rauf, F.; Kibria, M.G.; Ye, W.; Hasanuzzaman, M.; Murata, Y. Seed Priming with Nanoparticles: An Emerging Technique for Improving Plant Growth, Development, and Abiotic Stress Tolerance. J. Soil Sci. Plant Nutr. 2022, 22, 4047–4062. [Google Scholar] [CrossRef]
- Parveen, A.; Mazhari, B.B.Z.; Rao, S. Impact of bio-nanogold on seed germination and seedling growth in Pennisetum glaucum. Enzym. Microb. Technol. 2016, 95, 107–111. [Google Scholar] [CrossRef] [PubMed]
- Joshi, A.; Nayyar, H.; Dharamvir, K.; Verma, G. Detection of gold nanoparticles signal inside wheat (Triticum aestivum L) and oats (Avena sativa) seedlings. AIP Conf. Proc. 2018, 1953, 030058. [Google Scholar] [CrossRef]
- Pissuwan, D.; Poomrattanangoon, S.; Chungchaiyart, P. Trends in using gold nanoparticles for inducing cell differentiation: A review. ACS Appl. Nano Mater. 2022, 5, 3110–3120. [Google Scholar] [CrossRef]
- Falco, W.F.; Botero, E.R.; Falcão, E.A.; Santiago, E.F.; Bagnato, V.S.; Caires, A.R.L. In vivo observation of chlorophyll fluorescence quenching induced by gold nanoparticles. J. Photochem. Photobiol. A Chem. 2011, 225, 65–71. [Google Scholar] [CrossRef]
- Wang, X.; Yang, X.; Chen, S.; Li, Q.; Wang, W.; Hou, C.; Gao, X.; Wang, L.; Wang, S. Zinc Oxide Nanoparticles Affect Biomass Accumulation and Photosynthesis in Arabidopsis. Front. Plant Sci. 2015, 6, 1243. [Google Scholar] [CrossRef] [PubMed]
- Hassan, H.; Alatawi, A.; Abdulmajeed, A.; Emam, M.; Khattab, H. Roles of Si and SiNPs in Improving Thermotolerance of Wheat Photosynthetic Machinery via Upregulation of PsbH, PsbB and PsbD Genes Encoding PSII Core Proteins. Horticulturae 2021, 7, 16. [Google Scholar] [CrossRef]
- Hasanpour, H.; Maali Amiri, R.; Zeinali, H. Effect of TiO2 nanoparticles on metabolic limitations to photosynthesis under cold in chickpea. Russ. J. Plant Physiol. 2015, 62, 779–787. [Google Scholar] [CrossRef]
- Kreslavskii, V.; Los, D.; Allakhverdiev, S.; Kuznetsov, V. Signaling Role of Reactive Oxygen Species in Plants under Stress. Russ. J. Plant Physiol. 2012, 59, 141–154. [Google Scholar] [CrossRef]
- John, R.; Anjum, N.A.; Sopory, S.K.; Akram, N.A.; Ashraf, M. Some key physiological and molecular processes of cold acclimation. Biol. Plant. 2016, 60, 603–618. [Google Scholar] [CrossRef]
- Keunen, E.; Peshev, D.; Vangronsveld, J.; Van Den Ende, W.; Cuypers, A. Plant sugars are crucial players in the oxidative challenge during abiotic stress: Extending the traditional concept. Plant Cell Environ. 2013, 36, 1242–1255. [Google Scholar] [CrossRef]
- Kolupaev, Y.; Karpets, Y.; Kabashnikova, L. Antioxidative System of Plants: Cellular Compartmentalization, Protective and Signaling Functions, Mechanisms of Regulation (Review). Appl. Biochem. Microbiol. 2019, 55, 441–459. [Google Scholar] [CrossRef]
- Rihan, H.Z.; Al-Issawi, M.; Fuller, M.P. Advances in physiological and molecular aspects of plant cold tolerance. J. Plant Interact. 2017, 12, 143–157. [Google Scholar] [CrossRef]
- Chang, C.Y.; Brautigam, K.; Huner, N.P.A.; Ensminger, I. Champions of winter survival: Cold acclimation and molecular regulation of cold hardiness in evergreen conifers. New Phytol. 2021, 229, 675–691. [Google Scholar] [CrossRef] [PubMed]
- Deryabin, A.N.; Trunova, T.I. Colligative effects of solutions of low-molecular sugars and their role in plants under hypothermia. Biol. Bull. 2021, 48, 29–37. [Google Scholar] [CrossRef]
- Khan, M.R.; Adam, V.; Rizvi, T.F.; Zhang, B.; Ahamad, F.; Josko, I.; Zhu, Y.; Yang, M.; Mao, C. Nanoparticle-Plant Interactions: Two-Way Traffic. Small 2019, 15, e1901794. [Google Scholar] [CrossRef] [PubMed]
- Ding, Y.; Shi, Y.; Yang, S. Advances and challenges in uncovering cold tolerance regulatory mechanisms in plants. New Phytol. 2019, 222, 1690–1704. [Google Scholar] [CrossRef] [PubMed]
- Ouellet, F.; Vazquez-Tello, A.; Sarhan, F. The wheat wcs120 promoter is cold-inducible in both monocotyledonous and dicotyledonous species. FEBS Lett. 1998, 423, 324–328. [Google Scholar] [CrossRef] [PubMed]
- Rehman, S.; Khushi, M.; Sher, H.; Que, Y.; Ali, R.; Ali, S.; Hassan, I.; Murad, A.; Rahat, M. Molecular Analysis of Cold Responsive (COR) Genes in Selected Sugarcane and Saccharum spontaneum L. Adv. Life Sci. 2022, 9, 547–551. [Google Scholar]
- NDong, C.; Danyluk, J.; Wilson, K.E.; Pocock, T.; Huner, N.P.; Sarhan, F. Cold-regulated cereal chloroplast late embryogenesis abundant-like proteins. Molecular characterization and functional analyses. Plant Physiol. 2002, 129, 1368–1381. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.; Si, H.; Wang, C.; Sun, G.; Zhou, E.; Chen, C.; Ma, C. Molecular evolution of Wcor15 gene enhanced our understanding of the origin of A, B and D genomes in Triticum aestivum. Sci. Rep. 2016, 6, 31706. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, Y.; Yamamoto, S.; Minami, H.; Kagaya, Y.; Hattori, T. Differential activation of the rice sucrose nonfermenting1-related protein kinase2 family by hyperosmotic stress and abscisic acid. Plant Cell 2004, 16, 1163–1177. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.W.; Huang, Y.C.; Chang, H.Y. CIA2 coordinately up-regulates protein import and synthesis in leaf chloroplasts. Plant Physiol. 2009, 150, 879–888. [Google Scholar] [CrossRef] [PubMed]
- Dykman, L.; Khlebtsov, N. Gold nanoparticles in biomedical applications: Recent advances and perspectives. Chem. Soc. Rev. 2012, 41, 2256–2282. [Google Scholar] [CrossRef] [PubMed]
- Heath, R.L.; Packer, L. Photoperoxidation in isolated chloroplasts. I. Kinetics and stoichiometry of fatty acid peroxidation. Arch. Biochem. Biophys. 1968, 125, 189–198. [Google Scholar] [CrossRef]
- Wellburn, A.R. The Spectral Determination of Chlorophylls a and b, as well as Total Carotenoids, Using Various Solvents with Spectrophotometers of Different Resolution. J. Plant Physiol. 1994, 144, 307–313. [Google Scholar] [CrossRef]
- Lichtenthaler, H. Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. Methods Enzymol. 1987, 148C, 350–382. [Google Scholar] [CrossRef]
- Nakamura, M. Determination of Fructose in the Presence. Agric. Biol. Chem. 1968, 32, 701–706. [Google Scholar] [CrossRef]
- Kalinowska, E.; Chodorska, M.; Paduch-Cichal, E.; Mroczkowska, K. An improved method for RNA isolation from plants using commercial extraction kits. Acta Biochim. Pol. 2012, 59, 391–393. [Google Scholar] [CrossRef] [PubMed]
- Perdomo, J.A.; Buchner, P.; Carmo-Silva, E. The relative abundance of wheat Rubisco activase isoforms is post-transcriptionally regulated. Photosynth. Res. 2021, 148, 47–56. [Google Scholar] [CrossRef] [PubMed]
- Dudziak, K.; Sozoniuk, M.; Szczerba, H.; Kuzdraliński, A.; Kowalczyk, K.; Börner, A.; Nowak, M. Identification of stable reference genes for qPCR studies in common wheat (Triticum aestivum L.) seedlings under short-term drought stress. Plant Methods 2020, 16, 58. [Google Scholar] [CrossRef] [PubMed]
- Xue, G.-P.; Sadat, S.; Drenth, J.; McIntyre, C.L. The heat shock factor family from Triticum aestivum in response to heat and other major abiotic stresses and their role in regulation of heat shock protein genes. J. Exp. Bot. 2014, 65, 539–557. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
Temperature of Freezing | Concentration of Au-NPs, µg mL−1 | ||||
---|---|---|---|---|---|
0 | 5 | 10 | 20 | 50 | |
Unhardened seedlings | |||||
−3 °C | 15 ± 3 c | 30 ± 5 b | 50 ± 5 a | 10 ± 3 c | 10 ± 3 c |
−5 °C | 0 | 0 | 0 | 0 | 0 |
Hardened seedlings | |||||
−3 °C | 60 ± 3 b | 90 ± 3 a | 97 ± 3 a | 90 ± 3 a | 90 ± 3 a |
−5 °C | 7 ± 3 c | 50 ± 3 b | 67 ± 3 a | 50 ± 3 b | 50 ± 3 b |
−7 °C | 0 | 5 ± 3 a | 7 ± 3 a | 6 ± 3 a | 0 |
−9 °C | 0 | 0 | 0 | 0 | 0 |
Variant of Experiment | Au, µg g−1 Dry Weight | ||
---|---|---|---|
Roots | Leaves | Seeds | |
Control | <0.05 | <0.05 | <0.05 |
Au-NPs | 1.6 ± 0.1 | 0.28 ± 0.01 | 3.9 ± 0.2 |
Variant of Experiment | MDA (µmol/g DW) | DW (%) | Monosaccharide (mg g−1 DW) | Sucrose (mg g−1 DW) | Sum of Sugars (mg g−1 DW) |
---|---|---|---|---|---|
Unhardened seedlings | |||||
Control | 36.8 ± 1.8 a | 13.2 ± 0.2 c | 55.0 ± 1.5 a | 4.4 ± 0.2 d | 59.4 ± 3.0 b |
Au-NPs | 36.4 ± 1.2 a | 13.3 ± 0.2 c | 42.8 ± 1.5 b | 7.6 ± 0.2 c | 50.4 ± 2.5 c |
Hardened seedlings | |||||
Control | 20.8 ± 1.0 b | 17.8 ± 0.3 b | 45.2 ± 1.2 b | 14.1 ± 0.2 b | 59.3 ± 3.0 b |
Au-NPs | 19.8 ± 1.3 b | 19.1 ± 0.4 a | 44.2 ± 1.7 b | 24.5 ± 0.2 a | 68.7 ± 3.4 a |
Gene | Primer | Primer Sequences |
---|---|---|
TaAct7 | Forward | TGCTATCCTTCGTTTGGACCTT |
Reverse | AGCGGTTGTTGTGAGGGAGT | |
TaRP15 | Forward | TCATTGTGGAGGACTCGTGG |
Reverse | GCAGACATAGCCCACACAT | |
RbcS | Forward | GGATTCGACAACATGCGCCAGG |
Reverse | ATATGGCCTGTCGTGAGTGAGC | |
RbcL | Forward | ACCATTTATGCGCTGGAGAGACC |
Reverse | CAAGTAATGCCCCTTGATTTCACC | |
Wcor726 | Forward | ACTGGAATGACCGGCTCG |
Reverse | TGTCCCGACTTCCCGTAGTT | |
Wcor15 | Forward | CCACCCATCCATCAGCAGTT |
Reverse | CTTGGAGCGTTCTGCAGGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Venzhik, Y.; Deryabin, A.; Zhukova, K. Au-Based Nanoparticles Enhance Low Temperature Tolerance in Wheat by Regulating Some Physiological Parameters and Gene Expression. Plants 2024, 13, 1261. https://doi.org/10.3390/plants13091261
Venzhik Y, Deryabin A, Zhukova K. Au-Based Nanoparticles Enhance Low Temperature Tolerance in Wheat by Regulating Some Physiological Parameters and Gene Expression. Plants. 2024; 13(9):1261. https://doi.org/10.3390/plants13091261
Chicago/Turabian StyleVenzhik, Yuliya, Alexander Deryabin, and Kseniya Zhukova. 2024. "Au-Based Nanoparticles Enhance Low Temperature Tolerance in Wheat by Regulating Some Physiological Parameters and Gene Expression" Plants 13, no. 9: 1261. https://doi.org/10.3390/plants13091261
APA StyleVenzhik, Y., Deryabin, A., & Zhukova, K. (2024). Au-Based Nanoparticles Enhance Low Temperature Tolerance in Wheat by Regulating Some Physiological Parameters and Gene Expression. Plants, 13(9), 1261. https://doi.org/10.3390/plants13091261