MicroRNA164 Affects Plant Responses to UV Radiation in Perennial Ryegrass
Abstract
1. Introduction
2. Results
2.1. Generation of Transgenic Perennial Ryegrass Plants with Overexpression or Target Mimicry of the Rice miR164a Gene
2.2. Phenotypic Characterization of Transgenic Plants
2.3. MiR164 Affects Perennial Ryegrass Responses to UV Stress
2.3.1. MiR164 Enhances Perennial Ryegrass Sensitivity to UV
2.3.2. Leaf Pigments and Total Phenolic Content
2.3.3. Antioxidant Responses
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Plant Materials, Growth Conditions, and Experiment Treatments
5.2. Sampling and Measurements
5.2.1. Phenotypic Analysis of Transgenic Plants
5.2.2. Measurement of Physiological Parameters
5.3. Experimental Design and Statistical Analysis
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Sharma, S.; Chatterjee, S.; Kataria, S.; Joshi, J.; Datta, S.; Vairale, M.G.; Veer, V. A Review on Responses of Plants to UV-B Radiation Related Stress. In UV-B Radiation; John Wiley & Sons: Hoboken, NJ, USA, 2017; pp. 75–97. [Google Scholar] [CrossRef]
- Lemus-Deschamps, L.; Makin, J.K. Fifty years of changes in UV Index and implications for skin cancer in Australia. Int. J. Biometeorol. 2012, 56, 727–735. [Google Scholar] [CrossRef]
- Tevini, M. Plant Responses to Ultraviolet Radiation Stress. In Chlorophyll a Fluorescence: A Signature of Photosynthesis; Papageorgiou, G.C., Govindjee, Eds.; Springer: Dordrecht, The Netherlands, 2004; pp. 605–621. [Google Scholar] [CrossRef]
- Yadav, A.; Singh, D.; Lingwan, M.; Yadukrishnan, P.; Masakapalli, S.K.; Datta, S. Light signaling and UV-B-mediated plant growth regulation. J. Integr. Plant Biol. 2020, 62, 1270–1292. [Google Scholar] [CrossRef] [PubMed]
- Yin, R.; Ulm, R. How plants cope with UV-B: From perception to response. Curr. Opin. Plant Biol. 2017, 37, 42–48. [Google Scholar] [CrossRef]
- Singh, S.; Agrawal, S.B.; Agrawal, M. UVR8 mediated plant protective responses under low UV-B radiation leading to photosynthetic acclimation. J. Photochem. Photobiol. B Biol. 2014, 137, 67–76. [Google Scholar] [CrossRef]
- Reinhart, B.J.; Weinstein, E.G.; Rhoades, M.W.; Bartel, B.; Bartel, D.P. MicroRNAs in plants. Genes. Dev. 2002, 16, 1616–1626. [Google Scholar] [CrossRef] [PubMed]
- Khraiwesh, B.; Zhu, J.-K.; Zhu, J. Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants. Biochim. Et Biophys. Acta (BBA) Gene Regul. Mech. 2012, 1819, 137–148. [Google Scholar] [CrossRef]
- Casati, P. Analysis of UV-B regulated miRNAs and their targets in maize leaves. Plant Signal Behav. 2013, 8, e26758. [Google Scholar] [CrossRef] [PubMed]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
- Zhou, X.; Wang, G.; Zhang, W. UV-B responsive microRNA genes in Arabidopsis thaliana. Mol. Syst. Biol. 2007, 3, 103. [Google Scholar] [CrossRef]
- Jia, X.; Ren, L.; Chen, Q.J.; Li, R.; Tang, G. UV-B-responsive microRNAs in Populus tremula. J. Plant Physiol. 2009, 166, 2046–2057. [Google Scholar] [CrossRef]
- Wang, B.; Sun, Y.F.; Song, N.; Wang, X.J.; Feng, H.; Huang, L.L.; Kang, Z.S. Identification of UV-B-induced microRNAs in wheat. Genet. Mol. Res. 2013, 12, 4213–4221. [Google Scholar] [CrossRef] [PubMed]
- Sunitha, S.; Loyola, R.; Alcalde, J.A.; Arce-Johnson, P.; Matus, J.T.; Rock, C.D. The Role of UV-B light on Small RNA Activity During Grapevine Berry Development. G3 Genes Genomes Genet. 2019, 9, 769–787. [Google Scholar] [CrossRef] [PubMed]
- Pashkovskii, P.P.; Ryazanskii, S.S.; Radyukina, N.L.; Gvozdev, V.A.; Kuznetsov, V.V. MIR398 and expression regulation of the cytoplasmic Cu/Zn-superoxide dismutase gene in Thellungiella halophila plants under stress conditions. Russ. J. Plant Physiol. 2010, 57, 707–714. [Google Scholar] [CrossRef]
- Islam, W.; Waheed, A.; Idrees, A.; Rashid, J.; Zeng, F. Role of plant microRNAs and their corresponding pathways in fluctuating light conditions. Biochim. Et Biophys. Acta (BBA) Mol. Cell Res. 2023, 1870, 119304. [Google Scholar] [CrossRef]
- Sunkar, R.; Zhou, X.; Zheng, Y.; Zhang, W.; Zhu, J.K. Identification of novel and candidate miRNAs in rice by high throughput sequencing. BMC Plant Biol. 2008, 8, 25. [Google Scholar] [CrossRef]
- Fang, Y.; Xie, K.; Xiong, L. Conserved miR164-targeted NAC genes negatively regulate drought resistance in rice. J. Exp. Bot. 2014, 65, 2119–2135. [Google Scholar] [CrossRef]
- Lee, M.-H.; Jeon, H.S.; Kim, H.G.; Park, O.K. An Arabidopsis NAC transcription factor NAC4 promotes pathogen-induced cell death under negative regulation by microRNA164. New Phytol. 2017, 214, 343–360. [Google Scholar] [CrossRef]
- Huarancca Reyes, T.; Pompeiano, A.; Ranieri, A.; Volterrani, M.; Guglielminetti, L.; Scartazza, A. Photosynthetic performance of five cool-season turfgrasses under UV-B exposure. Plant Physiol. Biochem. 2020, 151, 181–187. [Google Scholar] [CrossRef] [PubMed]
- Qing, C.H.I.; Du, L.Y.; Wen, M.A.; Niu, R.Y.; Wu, B.W.; Guo, L.J.; Meng, M.A.; Liu, X.L.; Zhao, H.X. The miR164-TaNAC14 module regulates root development and abiotic-stress tolerance in wheat seedlings. J. Integr. Agric. 2023, 22, 981–998. [Google Scholar] [CrossRef]
- Zhan, J.; Chu, Y.; Wang, Y.; Diao, Y.; Zhao, Y.; Liu, L.; Wei, X.; Meng, Y.; Li, F.; Ge, X. The miR164-GhCUC2-GhBRC1 module regulates plant architecture through abscisic acid in cotton. Plant Biotechnol. J. 2021, 19, 1839–1851. [Google Scholar] [CrossRef]
- Wang, Z.; Xia, Y.; Lin, S.; Wang, Y.; Guo, B.; Song, X.; Ding, S.; Zheng, L.; Feng, R.; Chen, S.; et al. Osa-miR164a targets OsNAC60 and negatively regulates rice immunity against the blast fungus Magnaporthe oryzae. Plant J. 2018, 95, 584–597. [Google Scholar] [CrossRef]
- Lira, B.S.; Gramegna, G.; Trench, B.A.; Alves, F.R.R.; Silva, E.M.; Silva, G.F.F.; Thirumalaikumar, V.P.; Lupi, A.C.D.; Demarco, D.; Purgatto, E.; et al. Manipulation of a Senescence-Associated Gene Improves Fleshy Fruit Yield. Plant Physiol. 2017, 175, 77–91. [Google Scholar] [CrossRef]
- Phookaew, P.; Netrphan, S.; Sojikul, P.; Narangajavana, J. Involvement of miR164-and miR167-mediated target gene expressions in responses to water deficit in cassava. Biol. Plant. 2014, 58, 469–478. [Google Scholar] [CrossRef]
- Huang, T.; Lopez-Giraldez, F.; Townsend, J.P.; Irish, V.F. RBE controls microRNA164 expression to effect floral organogenesis. Development 2012, 139, 2161–2169. [Google Scholar] [CrossRef]
- Kim, J.H.; Woo, H.R.; Kim, J.; Lim, P.O.; Lee, I.C.; Choi, S.H.; Hwang, D.; Nam, H.G. Trifurcate Feed-Forward Regulation of Age-Dependent Cell Death Involving miR164 in Arabidopsis. Science 2009, 323, 1053–1057. [Google Scholar] [CrossRef]
- Laufs, P.; Peaucelle, A.; Morin, H.; Traas, J. MicroRNA regulation of the CUC genes is required for boundary size control in Arabidopsis meristems. Development 2004, 131, 4311–4322. [Google Scholar] [CrossRef]
- Mallory, A.C.; Dugas, D.V.; Bartel, D.P.; Bartel, B. MicroRNA Regulation of NAC-Domain Targets Is Required for Proper Formation and Separation of Adjacent Embryonic, Vegetative, and Floral Organs. Curr. Biol. 2004, 14, 1035–1046. [Google Scholar] [CrossRef]
- Geng, Y.; Jian, C.; Xu, W.; Liu, H.; Hao, C.; Hou, J.; Liu, H.; Zhang, X.; Li, T. miR164-targetedTaPSK5encodes a phytosulfokine precursor that regulates root growth and yield traits in common wheat (Triticum aestivum L.). Plant Mol. Biol. 2020, 104, 615–628. [Google Scholar] [CrossRef]
- Wang, J.; Bao, J.; Zhou, B.; Li, M.; Li, X.; Jin, J. The osa-miR164 target OsCUC1 functions redundantly with OsCUC3 in controlling rice meristem/organ boundary specification. New Phytol. 2021, 229, 1566–1581. [Google Scholar] [CrossRef]
- Wen, C.-H.; Hong, S.-F.; Hu, S.-F.; Lin, S.-S.; Chu, F.-H. Lfo-miR164b and LfNAC1 as autumn leaf senescence regulators in Formosan sweet gum (Liquidambar formosana Hance). Plant Sci. 2020, 291, 110325. [Google Scholar] [CrossRef]
- Li, J.; Lai, T.; Song, H.; Xu, X. MiR164 is involved in delaying senescence of strawberry (Fragaria ananassa) fruit by negatively regulating NAC transcription factor genes under low temperature. Russ. J. Plant Physiol. 2017, 64, 251–259. [Google Scholar] [CrossRef]
- Feng, H.; Duan, X.; Zhang, Q.; Li, X.; Wang, B.; Huang, L.; Wang, X.; Kang, Z. The target gene of tae-miR164, a novel NAC transcription factor from the NAM subfamily, negatively regulates resistance of wheat to stripe rust. Mol. Plant Pathol. 2014, 15, 284–296. [Google Scholar] [CrossRef] [PubMed]
- Brown, B.A.; Jenkins, G.I. UV-B Signaling Pathways with Different Fluence-Rate Response Profiles Are Distinguished in Mature Arabidopsis Leaf Tissue by Requirement for UVR8, HY5, and HYH. Plant Physiol. 2007, 146, 323–324. [Google Scholar] [CrossRef]
- Jayaraj, J.; Punja, Z.K. Transgenic carrot plants accumulating ketocarotenoids show tolerance to UV and oxidative stresses. Plant Physiol. Biochem. 2008, 46, 875–883. [Google Scholar] [CrossRef]
- Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef]
- Ahmed, F.; Schenk, P.M. UV-C radiation increases sterol production in the microalga Pavlova lutheri. Phytochem. 2017, 139, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Barnes, P.W.; Ryel, R.J.; Flint, S.D. UV Screening in Native and Non-native Plant Species in the Tropical Alpine: Implications for Climate Change-Driven Migration of Species to Higher Elevations. Front. Plant Sci. 2017, 8, 1451. [Google Scholar] [CrossRef] [PubMed]
- Blokhina, O.; Virolainen, E.; Fagerstedt, K.V. Antioxidants, oxidative damage and oxygen deprivation stress: A review. Ann. Bot. 2003, 91, 179–194. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Nahar, K.; Alam, M.; Roychowdhury, R.; Fujita, M. Physiological, Biochemical, and Molecular Mechanisms of Heat Stress Tolerance in Plants. Int. J. Mol. Sci. 2013, 14, 9643–9684. [Google Scholar] [CrossRef]
- Miller, G.; Suzuki, N.; Ciftci-Yilmaz, S.; Mittler, R. Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ. 2010, 33, 453–467. [Google Scholar] [CrossRef]
- Wang, K.; Zhang, X.; Ervin, E. Antioxidative responses in roots and shoots of creeping bentgrass under high temperature: Effects of nitrogen and cytokinin. J. Plant Physiol. 2012, 169, 492–500. [Google Scholar] [CrossRef]
- Yin, H.; Chen, Q.; Yi, M. Effects of short-term heat stress on oxidative damage and responses of antioxidant system in Lilium longiflorum. Plant Growth Regul. 2008, 54, 45–54. [Google Scholar] [CrossRef]
- Fini, A.; Brunetti, C.; Di Ferdinando, M.; Ferrini, F.; Tattini, M. Stress-induced flavonoid biosynthesis and the antioxidant machinery of plants. Plant Signal Behav. 2011, 6, 709–711. [Google Scholar] [CrossRef]
- Alonso, R.; Berli, F.J.; Fontana, A.; Piccoli, P.; Bottini, R. Malbec grape (Vitis vinifera L.) responses to the environment: Berry phenolics as influenced by solar UV-B, water deficit and sprayed abscisic acid. Plant Physiol. Biochem. 2016, 109, 84–90. [Google Scholar] [CrossRef]
- Agathokleous, E.; Feng, Z.; Peñuelas, J. Chlorophyll hormesis: Are chlorophylls major components of stress biology in higher plants? Sci. Total Environ. 2020, 726, 138637. [Google Scholar] [CrossRef]
- Salama, H.M.; Al Watban, A.A.; Al-Fughom, A.T. Effect of ultraviolet radiation on chlorophyll, carotenoid, protein and proline contents of some annual desert plants. Saudi J. Biol. Sci. 2011, 18, 79–86. [Google Scholar] [CrossRef]
- Chauhan, J.; Prathibha, M.D.; Singh, P.; Choyal, P.; Mishra, U.N.; Saha, D.; Kumar, R.; Anuragi, H.; Pandey, S.; Bose, B.; et al. Plant photosynthesis under abiotic stresses: Damages, adaptive, and signaling mechanisms. Plant Stress. 2023, 10, 100296. [Google Scholar] [CrossRef]
- Beneragama, C.; Goto, K. Chlorophyll a:b Ratio Increases Under Low-light in S‘hade-tolerant’ Euglena gracilis. Trop Agric. Res. 2011, 22, 12–25. [Google Scholar] [CrossRef]
- Kasajima, I. Difference in oxidative stress tolerance between rice cultivars estimated with chlorophyll fluorescence analysis. BMC Res. Notes 2017, 10, 168. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhou, S.; Wang, L.; Wu, D.; Cheng, H.; Du, X.; Mao, D.; Zhang, C.; Jiang, X. miR164c and miR168a regulate seed vigor in rice. J. Integr. Plant Biol. 2020, 62, 470–486. [Google Scholar] [CrossRef]
- Franco-Zorrilla, J.M.; Valli, A.; Todesco, M.; Mateos, I.; Puga, M.I.; Rubio-Somoza, I.; Leyva, A.; Weigel, D.; Garcia, J.A.; Paz-Ares, J. Target mimicry provides a new mechanism for regulation of microRNA activity. Nat. Genet. 2007, 39, 1033–1037. [Google Scholar] [CrossRef]
- Wang, H.; Li, Y.; Chern, M.; Zhu, Y.; Zhang, L.L.; Lu, J.H.; Li, X.P.; Dang, W.Q.; Ma, X.C.; Yang, Z.R.; et al. Suppression of rice miR168 improves yield, flowering time and immunity. Nat. Plants 2021, 7, 129–136. [Google Scholar] [CrossRef]
- Zhang, W.J.; Dewey, R.E.; Boss, W.; Phillippy, B.Q.; Qu, R. Enhanced Agrobacterium-mediated transformation efficiencies in monocot cells is associated with attenuated defense responses. Plant Mol. Biol. 2013, 81, 273–286. [Google Scholar] [CrossRef]
- Wellburn, A.R. The Spectral Determination of Chlorophylls a and b, as well as Total Carotenoids, Using Various Solvents with Spectrophotometers of Different Resolution. J. Plant Physiol. 1994, 144, 307–313. [Google Scholar] [CrossRef]
- Li, H.; Zhu, L.; Yuan, G.; Heng, S.; Yi, B.; Ma, C.; Shen, J.; Tu, J.; Fu, T.; Wen, J. Fine mapping and candidate gene analysis of an anthocyanin-rich gene, BnaA.PL1, conferring purple leaves in Brassica napus L. Mol. Genet. Genom. 2016, 291, 1523–1534. [Google Scholar] [CrossRef]
- Georgé, S.; Brat, P.; Alter, P.; Amiot, M.J. Rapid determination of polyphenols and vitamin C in plant-derived products. J. Agric. Food Chem. 2005, 53, 1370–1373. [Google Scholar] [CrossRef]
- Kupina, S.; Fields, C.; Roman, M.C.; Brunelle, S.L. Determination of Total Phenolic Content Using the Folin-C Assay: Single-Laboratory Validation, First Action 2017.13. J. AOAC Int. 2018, 101, 1466–1472. [Google Scholar] [CrossRef] [PubMed]
- Barrs, H.D.; Weatherley, P.E. A Re-Examination of the Relative Turgidity Technique for Estimating Water Deficits in Leaves. Aust. J. Biol. Sci. 1962, 15, 413–428. [Google Scholar] [CrossRef]
- Taier, G.; Hang, N.; Shi, T.; Liu, Y.; Ye, W.; Zhang, W.; Wang, K. Ectopic Expression of Os-miR408 Improves Thermo-Tolerance of Perennial Ryegrass. Agronomy 2021, 11, 1930. [Google Scholar] [CrossRef]
- Blum, A.; Ebercon, A. Cell Membrane Stability as a Measure of Drought and Heat Tolerance in Wheat. Crop Sci. 1981, 21, 43–47. [Google Scholar] [CrossRef]
- Chaitanya, K.V.; Sundar, D.; Masilamani, S.; Reddy, A.R. Variation in heat stress-induced antioxidant enzyme activities among three mulberry cultivars. Plant Growth Regul. 2002, 36, 175–180. [Google Scholar] [CrossRef]
- Hüve, K.; Bichele, I.; Rasulov, B.; Niinemets, Ü. When it is too hot for photosynthesis: Heat-induced instability of photosynthesis in relation to respiratory burst, cell permeability changes and H2O2 formation. Plant Cell Environ. 2011, 34, 113–126. [Google Scholar] [CrossRef]
- Jambunathan, N. Determination and Detection of Reactive Oxygen Species (ROS), Lipid Peroxidation, and Electrolyte Leakage in Plants. In Plant Stress Tolerance: Methods and Protocols; Sunkar, R., Ed.; Humana Press: Totowa, NJ, USA, 2010; pp. 291–297. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence (5′–3′) | Purpose |
---|---|---|
miR164-F-Xba | TCTAGATTGCTTCAGTTGTTCGCAGT | Vector construction and PCR and RT-PCR analysis |
miR164-R-Sal | GTCGACGCGTCTTAGTGTTACTTTGGAC | Vector construction and PCR and RT-PCR analysis |
ISP1-MIM164-F-Kpn | TGGTACCAAAACACCACAAAAACA | MIM164 vector construction |
ISP1-MIM164-R-Spel | ACTAGTAAGAGGAATTCACTATAAA | MIM164 vector construction |
MIM164-F | GCCTAAATACAAAATGAAAACTCTC | PCR and RT-PCR analysis |
MIM164-R | GTACAACCCAAACATAATGAAGAA | PCR and RT-PCR analysis |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, C.; Huang, X.; Ma, N.; Liu, Y.; Xu, A.; Zhang, X.; Li, D.; Li, Y.; Zhang, W.; Wang, K. MicroRNA164 Affects Plant Responses to UV Radiation in Perennial Ryegrass. Plants 2024, 13, 1242. https://doi.org/10.3390/plants13091242
Xu C, Huang X, Ma N, Liu Y, Xu A, Zhang X, Li D, Li Y, Zhang W, Wang K. MicroRNA164 Affects Plant Responses to UV Radiation in Perennial Ryegrass. Plants. 2024; 13(9):1242. https://doi.org/10.3390/plants13091242
Chicago/Turabian StyleXu, Chang, Xin Huang, Ning Ma, Yanrong Liu, Aijiao Xu, Xunzhong Zhang, Dayong Li, Yue Li, Wanjun Zhang, and Kehua Wang. 2024. "MicroRNA164 Affects Plant Responses to UV Radiation in Perennial Ryegrass" Plants 13, no. 9: 1242. https://doi.org/10.3390/plants13091242
APA StyleXu, C., Huang, X., Ma, N., Liu, Y., Xu, A., Zhang, X., Li, D., Li, Y., Zhang, W., & Wang, K. (2024). MicroRNA164 Affects Plant Responses to UV Radiation in Perennial Ryegrass. Plants, 13(9), 1242. https://doi.org/10.3390/plants13091242