Salicylic Acid Spray Delays Sand Pear Fruit Senescence during Room Temperature Shelf Life by Regulating Antioxidant Capacity and Senescence-Related Genes
Abstract
1. Introduction
2. Results
2.1. Effects of SA Treatment on Pear Fruit Coloration during Room Temperature Shelf Life
2.2. Effects of SA Treatment on PPO Activity and MDA Content in Pear Fruit during Shelf Life at Room Temperature
2.3. Exogenous SA Application Regulates Antioxidant Enzymes in Sand Pear Fruits during Shelf Life at Room Temperature
2.4. Analysis of Expression Levels of Genes Related to Antioxidant Enzyme Activity during Pear Fruit Senescence
2.5. SA Regulates the Expression of Plant Hormone Synthesis and Metabolism Genes during Shelf Life at Room Temperature
2.6. Exogenous SA Treatment Regulates Cell Wall Metabolism and Modification-Related Genes Expression
2.7. SA Regulates the Expression of Genes Related to Sugar and Acid Metabolism during Room Temperature Shelf Life
2.8. Pearson Correlation Analysis of Senescence-Related Indexes
3. Discussion
4. Materials and Methods
4.1. Fruit Materials and Treatments
4.2. Fruit Appearance Observation
4.3. Extraction and Assay of PPO Activity
4.4. Determination of Malondialdehyde (MDA) Content
4.5. Crude Enzyme Extraction and Antioxidant Enzymes Activity Assay
4.6. Crude Enzyme Extraction and Ascorbate Peroxidase (APX) Activity Assay
4.7. Quantitative Real-Time PCR (qRT-PCR) Expression Analysis
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Imran, H.; Zhang, Y.X.; Du, G.Q.; Wang, G.Y.; Zhang, J.H. Effect of salicylic acid (SA) on delaying fruit senescence of Huang Kum pear. Front. Agric. China 2007, 1, 456–459. [Google Scholar] [CrossRef]
- Zhou, X.R.; Xiao, Y.J.; Meng, X.H.; Liu, B.J. Full inhibition of Whangkeumbae pear polyphenol oxidase enzymatic browning reaction by L-cysteine. Food Chem. 2018, 266, 1–8. [Google Scholar] [CrossRef]
- Zhou, H.S.; Tian, M.Y.; Huang, W.; Luo, S.F.; Hu, H.L.; Zhang, Y.T.; Zhang, L.G.; Li, P.X. Physiological and transcriptomic analysis of ‘Whangkeumbae’ pear core browning during low-temperature storage. Gene Expr. Patterns 2020, 36, 119113. [Google Scholar] [CrossRef] [PubMed]
- Chomkitichai, W.; Chumyam, A.; Rachtanapun, P.; Uthaibutra, J.; Saengnil, K. Reduction of reactive oxygen species production and membrane damage during storage of ‘Daw’ longan fruit by chlorine dioxide. Sci. Hortic. 2014, 170, 143–149. [Google Scholar] [CrossRef]
- Pott, D.M.; Vallarino, J.G.; Osorio, S. Metabolite changes during postharvest storage: Effects on fruit quality traits. Metabolites 2020, 10, 187. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.L.; Lu, Z.M.; Su, J.L.; Li, Y.Y.; Cao, M.M.; Gao, H. 24-Epibrassinolide delays senescence in harvested kiwifruit through effects on mitochondrial membrane and antioxidant activity. LWT-Food Sci. Technol. 2020, 118, 108833. [Google Scholar] [CrossRef]
- Huang, Q.; Huang, L.L.; Chen, J.Y.; Zhang, Y.J.; Kai, W.B.; Chen, C.Y. Maintenance of postharvest storability and overall quality of ‘Jinshayou’ pummelo fruit by salicylic acid treatment. Front. Plant Sci. 2023, 13, 1086375. [Google Scholar] [CrossRef]
- He, L.; He, T.; Farrar, S.; Ji, L.B.; Liu, T.Y.; Ma, X. Antioxidants maintain cellular redox homeostasis by elimination of reactive oxygen species. Cell. Physiol. Biochem. 2017, 44, 532–553. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Raihan, M.R.H.; Masud, A.A.C.; Rahman, K.; Nowroz, F.; Rahman, M.; Nahar, K.; Fujita, M. Regulation of reactive oxygen species and antioxidant defense in plants under salinity. Int. J. Mol. Sci. 2021, 22, 9326. [Google Scholar] [CrossRef]
- Tian, S.P.; Qin, G.Z.; Li, B.Q. Reactive oxygen species involved in regulating fruit senescence and fungal pathogenicity. Plant Mol. Biol. 2013, 82, 593–602. [Google Scholar] [CrossRef]
- Meitha, K.; Pramesti, Y.; Suhandono, S. Reactive oxygen species and antioxidants in postharvest vegetables and fruits. Int. J. Food Sci. 2020, 2020, 8817778. [Google Scholar] [CrossRef]
- Corpas, F.J.; Freschi, L.; Palma, J.M. Ros metabolism and ripening of fleshy fruits. Adv. Bot. Res. 2023, 105, 205–238. [Google Scholar]
- Wu, X.Q.; Yuan, J.W.; Wang, X.Q.; Yu, M.L.; Ma, R.J.; Yu, Z.F. Synergy of nitric oxide and 1-methylcyclopropene treatment in prolong ripening and senescence of peach fruit. Foods 2021, 10, 2956. [Google Scholar] [CrossRef]
- Xu, Y.M.; Cai, Z.J.; Ba, L.J.; Qin, Y.H.; Su, X.G.; Luo, D.L.; Shan, W.; Kuang, J.F.; Lu, W.J.; Li, L.L.; et al. Maintenance of postharvest quality and reactive oxygen species homeostasis of pitaya fruit by essential oil p-anisaldehyde treatment. Foods 2021, 10, 2434. [Google Scholar] [CrossRef]
- Du, C.; Shen, F.Y.; Li, Y.; Zhao, Z.T.; Xu, X.Y.; Jiang, J.B.; Li, J.F. Effects of salicylic acid, jasmonic acid and reactive oxygen species on the resistance of Solanum peruvianum to Meloidogyne incognita. Sci. Hortic. 2021, 275, 109649. [Google Scholar] [CrossRef]
- Hou, Y.Y.; Li, Z.Y.; Zheng, Y.H.; Jin, P. Effects of CaCl2 treatment alleviates chilling injury of loquat fruit (Eribotrya japonica) by modulating ROS homeostasis. Foods 2021, 10, 1662. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.W.; Jing, G.Q.; Zhu, S.H. Nitric oxide (NO) involved in antioxidant enzyme gene regulation to delay mitochondrial damage in peach fruit. Postharvest Biol. Technol. 2022, 192, 111993. [Google Scholar] [CrossRef]
- Dixon, D.P.; Lapthorn, A.; Edwards, R. Plant glutathione transferases. Genome Biol. 2002, 3, reviews3004.1–reviews3004.10. [Google Scholar] [CrossRef] [PubMed]
- Shi, H.Y.; Li, Z.H.; Zhang, Y.X.; Chen, L.; Xiang, D.Y.; Zhang, Y.F. Two pear glutathione S-transferases genes are regulated during fruit development and involved in response to salicylic acid, auxin, and glucose signaling. PLoS ONE 2014, 9, e89926. [Google Scholar] [CrossRef]
- Iqbal, N.; Khan, N.A.; Ferrante, A.; Trivellini, A.; Francini, A.; Khan, M.I.R. Ethylene role in plant growth, development and senescence: Interaction with other phytohormones. Front. Plant Sci. 2017, 8, 475. [Google Scholar] [CrossRef]
- Pech, J.C.; Bouzayen, M.; Latché, A. Climacteric fruit ripening: Ethylene-dependent and independent regulation of ripening pathways in melon fruit. Plant Sci. 2008, 175, 114–120. [Google Scholar] [CrossRef]
- Nashima, K.; Shimizu, T.; Nishitani, C.; Yamamoto, T.; Takahashi, H.; Nakazono, M.; Itai, A.; Isuzugawa, K.; Hanada, T.; Takashina, T.; et al. Microarray analysis of gene expression patterns during fruit development in European pear (Pyrus communis). Sci. Hortic. 2013, 164, 466–473. [Google Scholar] [CrossRef]
- Massolo, J.F.; Concellón, A.; Chaves, A.R.; Vicente, A.R. 1-Methylcyclopropene (1-MCP) delays senescence, maintains quality and reduces browning of non-climacteric eggplant (Solanum melongena L.) fruit. Postharvest Biol. Technol. 2011, 59, 10–15. [Google Scholar] [CrossRef]
- Ebrahimi, A.; Khajavi, M.Z.; Ahmadi, S.; Mortazavian, A.M.; Abdolshahi, A.; Rafiee, S.; Farhoodo, M. Novel strategies to control ethylene in fruit and vegetables for extending their shelf life: A review. Int. J. Environ. Sci. Technol. 2021, 19, 4599–4610. [Google Scholar] [CrossRef]
- Pattyn, J.; Vaughan-Hirsch, J.; Van de Poel, B. The regulation of ethylene biosynthesis: A complex multilevel control circuitry. New Phytol. 2020, 229, 770–782. [Google Scholar] [CrossRef] [PubMed]
- Shen, W.J.; Li, W.; Shao, Y.Z.; Zeng, J.K. Proanthocyanidin delays litchi peel browning by inhibiting ethylene biosynthesis, respiratory metabolism, and phenol oxidase activities. Sci. Hortic. 2023, 309, 111677. [Google Scholar] [CrossRef]
- Wang, K.L.C.; Li, H.; Ecker, J.R. Ethylene biosynthesis and signaling networks. Plant Cell. 2002, 14, S131–S151. [Google Scholar] [CrossRef] [PubMed]
- Janda, T.; Szalai, G.; Pál, M. Salicylic acid signalling in plants. Int. J. Mol. Sci. 2020, 21, 2655. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.J.; Yang, J.F.; Li, X.; Zhang, Y.L. Salicylic acid: Biosynthesis and signaling. Annu. Rev. Plant Biol. 2021, 72, 761–791. [Google Scholar] [CrossRef]
- Meng, X.Z.; Fang, J.Z.; Fu, M.R.; Jiao, W.X.; Ren, P.F.; Yang, X.Y. The role of 1-methylcyclopropylene (1-MCP) and salicylic acid (SA) in induced resistance of postharvest fruits. Horticulturae 2023, 9, 108. [Google Scholar] [CrossRef]
- Madhav, J.V.; Sethi, S.; Sharma, R.R.; Nagaraja, A.; Arora, A.; Varghese, E. Influence of bilayer coating of salicylic acid and edible wax on chilling injury and functional attributes of guava. J. Food Process. Preserv. 2021, 45, e15601. [Google Scholar] [CrossRef]
- Zhang, H.Y.; Ma, Z.M.; Wang, J.J.; Wang, P.; Lu, D.Y.; Deng, S.F.; Lei, H.L.; Gao, Y.F.; Tao, Y.Y. Treatment with exogenous salicylic acid maintains quality, increases bioactive compounds, and enhances the antioxidant capacity of fresh goji (Lycium barbarum L.) fruit during storage. LWT-Food Sci. Technol. 2021, 140, 110837. [Google Scholar] [CrossRef]
- Geng, Y.; Li, B.B.; Zhang, P.; Yang, L.; Zhao, X.M.; Tan, Y.P. Preharvest foliar spraying combined with postharvest salicylic acid treatment regulates Panzao (Ziziphus jujuba Mill. cv. ‘Jingcang1’) fruit quality and softening during storage. Horticulturae 2023, 9, 1260. [Google Scholar] [CrossRef]
- Dokhanieh, A.Y.; Aghdam, M.S.; Fard, J.R.; Hassanpour, H. Postharvest salicylic acid treatment enhances antioxidant potential of cornelian cherry fruit. Sci. Hortic. 2013, 154, 31–36. [Google Scholar] [CrossRef]
- Gu, S.T.; Xu, D.Y.; Zhou, F.H.; Feng, K.; Chen, C.; Jiang, A. Repairing ability and mechanism of methyl jasmonate and salicylic acid on mechanically damaged sweet cherries. Sci. Hortic. 2022, 292, 110567. [Google Scholar] [CrossRef]
- Zhang, N.; Ji, N.; Liu, R.C.; Wang, R.; Chen, C.K.; Ma, C.; Nie, H.L.; Lei, J.Q.; Tao, Q.Y. Effects of pre-harvest spraying with salicylic acid (SA) and sodium nitroprusside (SNP) on storage quality and pathogenic fungal species in ‘Manaohong’ cherries. Agronomy 2023, 13, 2853. [Google Scholar] [CrossRef]
- Zhu, F.; Chen, J.J.; Xiao, X.; Zhang, M.F.; Yun, Z.; Zeng, Y.L.; Xu, J.; Cheng, Y.J.; Deng, X.X. Salicylic acid treatment reduces the rot of postharvest citrus fruit by inducing the accumulation of H2O2, primary metabolites and lipophilic polymethoxylated flavones. Food Chem. 2016, 207, 68–74. [Google Scholar] [CrossRef] [PubMed]
- Lo’ay, A.A.; Taher, M.A. Influence of edible coatings chitosan/PVP blending with salicylic acid on biochemical fruit skin browning incidence and shelf life of guava fruits cv. ‘Banati’. Sci. Hortic. 2018, 235, 424–436. [Google Scholar] [CrossRef]
- Khademi, O.; Ashtari, M.; Razavi, F. Effects of salicylic acid and ultrasound treatments on chilling injury control and quality preservation in banana fruit during cold storage. Sci. Hortic. 2019, 249, 334–339. [Google Scholar] [CrossRef]
- Chen, Y.H.; Sun, J.Z.; Lin, H.T.; Lin, M.S.; Lin, Y.F.; Wang, H.; Hung, Y.C. Salicylic acid treatment suppresses Phomopsis longanae Chi-induced disease development of postharvest longan fruit by modulating membrane lipid metabolism. Postharvest Biol. Technol. 2020, 164, 111168. [Google Scholar] [CrossRef]
- Zhang, H.L.; Shan, T.T.; Chen, Y.; Lin, M.S.; Chen, Y.Z.; Lin, L.J.; Chen, Y.H.; Wang, H.; Fan, Z.Q.; Lin, H.T.; et al. Salicylic acid treatment delayed the browning development in the pericarp of fresh longan by regulating the metabolisms of ROS and membrane lipid. Sci. Hortic. 2023, 318, 112073. [Google Scholar] [CrossRef]
- Jiang, B.; Liu, R.L.; Fang, X.J.; Tong, C.; Chen, H.J.; Gao, H.Y. Effects of salicylic acid treatment on fruit quality and wax composition of blueberry (Vaccinium virgatum Ait). Food Chem. 2022, 368, 130757. [Google Scholar] [CrossRef] [PubMed]
- Hazarika, T.K.; Marak, T. Salicylic acid and oxalic acid in enhancing the quality and extending the shelf life of grape cv. Thompson seedless. Food Sci. Technol. Int. 2021, 28, 463–475. [Google Scholar] [CrossRef] [PubMed]
- Yuan, R.M.; Mao, L.L.; Min, T.; Zhao, Y.Y.; Duan, Y.Q.; Wang, H.X.; Lin, Q. Salicylic acid treatment inhibits ethylene synthesis and starch-sugar conversion to maintain apple fruit quality during shelf life. Sci. Hortic. 2023, 308, 111586. [Google Scholar] [CrossRef]
- Wang, Y.F.; Chen, J.H.; Bian, W.Y.; Yang, X.B.; Ye, L.; He, S.K.; Song, X.Q. Control efficacy of salicylic acid microcapsules against postharvest blue mold in apple fruit. Molecules 2022, 27, 8108. [Google Scholar] [CrossRef] [PubMed]
- Liang, C.C.; Cui, X.Z.; Sun, C.C.; Ye, S.X.; Huang, N.X.; Chen, R.; Zhang, A.; Yang, Y.Q.; Gong, H.S.; Sun, S.Y.; et al. Synergistic and antagonistic effects of preharvest salicylic acid and postharvest 1-methylcyclopropene treatments on the storage quality of apricot. Food Chem. 2023, 405, 134764. [Google Scholar] [CrossRef]
- Zhang, Y.T.; Li, S.L.; Deng, M.Y.; Gui, R.; Liu, Y.Q.; Chen, X.P.; Lin, Y.X.; Li, M.Y.; Wang, Y.; He, W.; et al. Blue light combined with salicylic acid treatment maintained the postharvest quality of strawberry fruit during refrigerated storage. Food Chem. X 2022, 15, 100384. [Google Scholar] [CrossRef] [PubMed]
- El-Beltagi, H.S.; Al-Otaibi, H.H.; Ali, M.R. A new approach for extending shelf-life of pomegranate arils with combined application of salicylic acid and methyl jasmonate. Horticulturae 2023, 9, 225. [Google Scholar] [CrossRef]
- Taher, M.A.; Lo’ay, A.A.; Gouda, M.; Limam, S.A.; Abdelkader, M.F.M.; Osman, S.O.; Fikry, M.; Ali, E.F.; Mohamed, S.Y.; Khalil, H.A.; et al. Impacts of gum arabic and polyvinylpyrrolidone (PVP) with salicylic acid on peach fruit (Prunus persica) shelf life. Molecules 2022, 27, 2595. [Google Scholar] [CrossRef]
- Adhikary, T.; Gill, P.S.; Jawandha, S.K.; Bhardwaj, R.D.; Anurag, R.K. Browning and quality management of pear fruit by salicylic acid treatment during low temperature storage. J. Sci. Food Agric. 2020, 101, 853–862. [Google Scholar] [CrossRef]
- Wang, L.J.; Chen, S.J.; Kong, W.F.; Li, S.H.; Archbold, D.D. Salicylic acid pretreatment alleviates chilling injury and affects the antioxidant system and heat shock proteins of peaches during cold storage. Postharvest Biol. Technol. 2006, 41, 244–251. [Google Scholar] [CrossRef]
- Ezzat, A.; Ammar, A.; Szabó, Z.; Nyéki, J.; Holb, I.J. Postharvest treatments with methyl jasmonate and salicylic acid for maintaining physico-chemical characteristics and sensory quality properties of apricot fruit during cold storage and shelf-life. Pol. J. Food Nutr. Sci. 2017, 67, 159–166. [Google Scholar] [CrossRef]
- Ezzat, A.; Hegedűs, A.; Szabó, S.; Ammar, A.; Szabó, Z.; Nyéki, J.; Molnar, B.; Holb, I.J. Temporal changes and correlations between quality loss parameters, antioxidant properties and enzyme activities in apricot fruit treated with methyl jasmonate and salicylic acid during cold storage and shelf-life. Appl. Sci. 2020, 10, 8071. [Google Scholar] [CrossRef]
- Xu, Y.; Huo, L.Y.; Zhao, K.K.; Li, Y.W.; Zhao, X.R.; Wang, H.Y.; Wang, W.L.; Shi, H.Y. Salicylic acid delays pear fruit senescence by playing an antagonistic role toward ethylene, auxin, and glucose in regulating the expression of PpEIN3a. Front. Plant Sci. 2023, 13, 1096645. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.D.; Yeats, T.H.; Uluisik, S.; Rose, J.K.C.; Seymour, G.B. Fruit softening: Revisiting the role of pectin. Trends Plant Sci. 2018, 23, 302–310. [Google Scholar] [CrossRef]
- Wang, H.; Chen, Y.H.; Lin, H.T.; Lin, M.S.; Chen, Y.H.; Lin, Y.F. 1-Methylcyclopropene containing-papers suppress the disassembly of cell wall polysaccharides in Anxi persimmon fruit during storage. Int. J. Biol. Macromol. 2020, 151, 723–729. [Google Scholar] [CrossRef]
- Li, R.G.; Rimmer, R.; Yu, M.; Sharpe, A.G.; Se´guin-Swartz, G.; Lydiate, D.; Hegedus, D.D. Two Brassica napus polygalacturonase inhibitory protein genes are expressed at different levels in response to biotic and abiotic stresses. Planta 2003, 217, 299–308. [Google Scholar] [CrossRef]
- Kalunke, R.M.; Tundo, S.; Benedetti, M.; Cervone, F.; Lorenzo, G.D.; D’Ovidio, R. An update on polygalacturonase-inhibiting protein (PGIP), a leucine-rich repeat protein that protects crop plants against pathogens. Front. Plant Sci. 2015, 6, 146. [Google Scholar] [CrossRef] [PubMed]
- Li, J.M.; Zhu, R.X.; Zhang, M.Y.; Cao, B.B.; Li, X.L.; Song, B.B.; Liu, Z.C.; Wu, J. Natural variations in the PbCPK28 promoter regulate sugar content through interaction with PbTST4 and PbVHA-A1 in pear. Plant J. 2023, 114, 124–141. [Google Scholar] [CrossRef]
- Li, X.L.; Liu, L.; Ming, M.L.; Hu, H.J.; Zhang, M.Y.; Fan, J.; Song, B.B.; Zhang, S.L.; Wu, J. Comparative transcriptomic analysis provides insight into the domestication and improvement of pear (P. pyrifolia) fruit. Plant Physiol. 2019, 180, 435–452. [Google Scholar] [CrossRef]
- Liu, J.L.; Yue, R.R.; Si, M.; Wu, M.; Cong, L.; Zhai, R.; Yang, C.Q.; Wang, Z.J.; Ma, F.W.; Xu, L.F. Effects of Exogenous Application of melatonin on quality and sugar Metabolism in ‘Zaosu’ pear fruit. J. Plant. Growth Regul. 2019, 38, 1161–1169. [Google Scholar] [CrossRef]
- Shi, H.Y.; Zhang, Y.X. Pear ACO genes encoding putative 1-aminocyclopropane-1-carboxylate oxidase homologs are functionally expressed during fruit ripening and involved in response to salicylic acid. Mol. Biol. Rep. 2012, 39, 9509–9519. [Google Scholar] [CrossRef]
- Sun, L.; Zhang, M.; Ren, J.; Qi, J.X.; Zhang, G.J.; Leng, P. Reciprocity between abscisic acid and ethylene at the onset of berry ripening and after harvest. BMC Plant Biol. 2010, 10, 257. [Google Scholar] [CrossRef] [PubMed]
- Nham, N.T.; Macnish, A.J.; Zakharov, F.; Mitcham, E.J. ‘Bartlett’ pear fruit (Pyrus communis L.) ripening regulation by low temperatures involves genes associated with jasmonic acid, cold response, and transcription factors. Plant Sci. 2017, 260, 8–18. [Google Scholar] [CrossRef] [PubMed]
- Shi, H.Y.; Cao, L.W.; Xu, Y.; Yang, X.; Liu, S.L.; Liang, Z.S.; Li, G.C.; Yang, Y.P.; Zhang, Y.X.; Chen, L. Transcriptional profiles underlying the effects of salicylic acid on fruit ripening and senescence in pear (Pyrus pyrifolia Nakai). J. Integr. Agric. 2021, 20, 2424–2437. [Google Scholar] [CrossRef]
- Yue, P.T.; Wang, Y.N.; Bu, H.D.; Li, X.Y.; Yuan, H.; Wang, A.D. Ethylene promotes IAA reduction through PuERFs-activated PuGH3.1 during fruit ripening in pear (Pyrus ussuriensis). Postharvest Biol. Technol. 2019, 157, 110955. [Google Scholar] [CrossRef]
- Ahammed, G.J.; Xu, W.; Liu, A.R.; Chen, S.C. COMT1 silencing aggravates heat stress-induced reduction in photosynthesis by decreasing chlorophyll content, photosystem II activity, and electron transport efficiency in tomato. Plant Sci. 2018, 9, 998. [Google Scholar] [CrossRef]
- Song, L.Y.; Wang, Z.G.; Wang, Z.M.; Meng, G.; Zhai, R.; Cai, M.; Ma, F.W.; Xu, L.F. Screening of cell wall-related genes that are expressed differentially during ripening of pears with different softening characteristics. Postharvest Biol. Technol. 2016, 115, 1–8. [Google Scholar] [CrossRef]
- Shi, H.Y.; Zhang, Y.X.; Chen, L. Expression and regulation of a pear polygalacturonase inhibitor protein gene (PpPGIP1) during fruit development, under salicylic acid treatment, and in diseased fruit. Acta Physiol. Plant. 2013, 35, 3181–3189. [Google Scholar] [CrossRef]
- Wang, Y.L.; Zhang, X.F.; Wang, R.; Bai, Y.X.; Liu, C.L.; Yuan, Y.B.; Yang, Y.J.; Yang, S.L. Differential gene expression analysis of ‘Chili’ (Pyrus bretschneideri) fruit pericarp with two types of bagging treatments. Hortic. Res. 2017, 4, 17005. [Google Scholar] [CrossRef]
- Anur, R.M.; Mufithah, N.; Sawitri, W.D.; Sakakibara, H.; Sugiharto, B. Overexpression of sucrose phosphate synthase enhanced sucrose content and biomass production in transgenic sugarcane. Plants 2020, 9, 200. [Google Scholar] [CrossRef]
- Cai, Y.Y.; Cheng, H.Y.; Cheng, R.; Qi, K.J.; Chao, G.; Zhang, S.L. Expression analysis of sorbitol transporters in pear tissues reveals that PbSOT6/20 is associated with sorbitol accumulation in pear fruits. Sci. Hortic. 2019, 243, 595–601. [Google Scholar] [CrossRef]
- Cheng, R.; Cheng, Y.S.; Lv, J.H.; Chen, J.Q.; Wang, Y.Z.; Zhang, S.L.; Zhang, H.P. The gene PbTMT4 from pear (Pyrus bretschneideri) mediates vacuolar sugar transport and strongly affects sugar accumulation in fruit. Physiol. Plant. 2018, 164, 307–319. [Google Scholar] [CrossRef]
- Li, X.Y.; Guo, W.; Li, J.C.; Yue, P.T.; Bu, H.D.; Jiang, J.; Liu, W.T.; Xu, Y.X.; Yuan, H.; Li, T.; et al. Histone acetylation at the promoter for the transcription factor PuWRKY31 affects sucrose sccumulation in pear fruit. Plant Physiol. 2020, 182, 2035–2046. [Google Scholar] [CrossRef]
- Wang, L.B.; Ma, M.; Zhang, Y.R.; Wu, Z.F.; Guo, L.; Luo, W.Q.; Wang, L.; Zhang, Z.; Zhang, S.L. Characterization of the genes involved in malic acid metabolism from pear fruit and their expression profile after postharvest 1-MCP/Ethrel treatment. J. Agric. Food Chem. 2018, 66, 8772–8782. [Google Scholar] [CrossRef]
- Ruiz-Aracil, M.C.; Guillén, F.; Ilea, M.I.M.; Martínez-Romero, D.; Lorente-Mento, J.M.; Valverde, J.M. Comparative effect of melatonin and 1-methylcyclopropene postharvest applications for extending ‘Hayward’ kiwifruit storage life. Agriculture 2023, 13, 806. [Google Scholar] [CrossRef]
- Matsumoto, H.; Ikoma, Y. Effect of different postharvest temperatures on the accumulation of sugars, organic acids, and amino acids in the juice sacs of Satsuma mandarin (Citrus unshiu Marc.) fruit. J. Agric. Food Chem. 2012, 60, 9900–9909. [Google Scholar] [CrossRef]
- Deng, W.J.; Wu, J.L.; Da, Y.R.; Ma, Z.C. Effect of temperature treatment on fruit quality and immunoregulation of Satsuma (Citrus unshiu Marc.) during storage. Food Sci. Nutr. 2020, 8, 5443–5451. [Google Scholar] [CrossRef] [PubMed]
- Ryu, S.; Han, H.H.; Jeong, J.H.; Kwon, Y.H.; Han, J.H.; Do, G.R.; Choi, I.M.; Lee, H.J. Night temperatures affect fruit coloration and expressions of anthocyanin biosynthetic genes in ‘Hongro’ apple fruit skins. Eur. J. Hortic. Sci. 2017, 82, 232–238. [Google Scholar] [CrossRef]
- Jiang, W.Q.; Chen, L.H.; Han, Y.R.; Cao, B.; Song, L.H. Effects of elevated temperature and drought stress on fruit coloration in the jujube variety ‘Lingwuchangzao’ (Ziziphus jujube cv. Lingwuchangzao). Sci. Hortic. 2020, 274, 109667. [Google Scholar] [CrossRef]
- Nogales-Delgado, S. Polyphenoloxidase (PPO): Effect, current determination and inhibition treatments in fresh-cut produce. Appl. Sci. 2021, 11, 7813. [Google Scholar] [CrossRef]
- Sui, X.; Meng, Z.; Dong, T.T.; Fan, X.T.; Wang, Q.G. Enzymatic browning and polyphenol oxidase control strategies. Curr. Opin. Biotechnol. 2023, 81, 102921. [Google Scholar] [CrossRef]
- Luo, Z.S.; Chen, C.; Xie, J. Effect of salicylic acid treatment on alleviating postharvest chilling injury of ‘Qingnai’ plum fruit. Postharvest Biol. Technol. 2011, 62, 115–120. [Google Scholar] [CrossRef]
- Charoenphun, N.; Ali, A.M.M.; Paulraj, B.; Venkatachalam, K. Effect of aqueous n-butanol treatments on shelf-life extension of longkong fruit during ambient storage. Horticulturae 2023, 9, 938. [Google Scholar] [CrossRef]
- Sinha, A.; Gill, P.P.S.; Jawandha, S.K.; Kaur, P.; Grewal, S.K. Chitosan-enriched salicylic acid coatings preserves antioxidant properties and alleviates internal browning of pear fruit under cold storage and supermarket conditions. Postharvest Biol. Technol. 2021, 182, 111721. [Google Scholar] [CrossRef]
- Cheng, Y.D.; Liu, L.Q.; Zhao, G.Q.; Shen, C.G.; Yan, H.B.; Guan, J.F.; Yang, K. The effects of modified atmosphere packaging on core browning and the expression patterns of PPO and PAL genes in ‘Yali’ pears during cold storage. LWT-Food Sci. Technol. 2015, 60, 1243–1248. [Google Scholar] [CrossRef]
- Kumari, R.; Goldar, W.A.; Mondal, S.; Patra, S.; Bhattacharya, S.; Haldar, P.K. Protective effect of Basella alba leaf against diabetic nephropathy in rats. Adv. Tradit. Med. 2020, 21, 111–119. [Google Scholar] [CrossRef]
- Li, Y.; Han, L.X.; Wang, B.B.; Zhang, J.; Nie, J.Y. Dynamic degradation of penconazole and its effect on antioxidant enzyme activity and malondialdehyde content in apple fruit. Sci. Hortic. 2022, 300, 111053. [Google Scholar] [CrossRef]
- Lin, Y.F.; Lin, H.T.; Zhang, S.; Chen, Y.H.; Chen, M.Y.; Lin, Y.X. The role of active oxygen metabolism in hydrogen peroxide-induced pericarp browning of harvested longan fruit. Postharvest Biol. Technol. 2014, 96, 42–48. [Google Scholar] [CrossRef]
- Dong, B.Y.; Da, F.F.; Chen, Y.L.; Ding, X.C. Melatonin treatment maintains the quality of fresh-cut gastrodia elata under low-temperature conditions by regulating reactive oxygen species metabolism and phenylpropanoid pathway. Int. J. Mol. Sci. 2023, 24, 14284. [Google Scholar] [CrossRef] [PubMed]
- Xin, Q.; Zhou, X.Q.; Jiang, W.B.; Zhang, M.; Sun, J.; Cui, K.B.; Liu, Y.; Jiao, W.X.; Zhao, H.D.; Liu, B.D. Effects of reactive oxygen levels on chilling injury and storability in 21 apricot varieties from different production areas in China. Foods 2023, 12, 2378. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.L.; Jia, X.Y.; Duan, L.H.; Li, X.H.; Zhao, Z.Y. Synergistic Effects of 1-MCP fumigation and ε-Poly-L-Lysine treatments on delaying softening and enhancing disease resistance of flat peach fruit. Foods 2023, 12, 3683. [Google Scholar] [CrossRef] [PubMed]
- Bi, X.F.; Dai, Y.S.; Zhou, Z.Y.; Xing, Y.G.; Che, Z.M. Combining natamycin and 1-methylcyclopropene with modified atmosphere packaging to evaluate plum (Prunus salicina cv. ‘Cuihongli’) quality. Postharvest Biol. Technol. 2022, 183, 111749. [Google Scholar] [CrossRef]
- Li, X.Y.; Xiong, T.T.; Zhu, Q.N.; Zhou, Y.W.; Lei, Q.M.; Lu, H.Y.; Chen, W.X.; Li, X.P.; Zhu, X.Y. Combination of 1-MCP and modified atmosphere packaging (MAP) maintains banana fruit quality under high temperature storage by improving antioxidant system and cell wall structure. Postharvest Biol. Technol. 2023, 198, 112265. [Google Scholar] [CrossRef]
- Choudhury, F.K.; Rivero, R.M.; Blumwald, E.; Mittler, R. Reactive oxygen species, abiotic stress and stress combination. Plant J. 2017, 90, 856–867. [Google Scholar] [CrossRef]
- Medina, E.; Kim, S.H.; Yun, M.; Choi, W.G. Recapitulation of the function and role of ROS generated in response to heat stress in plants. Plants 2021, 10, 371. [Google Scholar] [CrossRef] [PubMed]
- Mittler, R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002, 7, 405–410. [Google Scholar] [CrossRef]
- Xu, W.T.; Peng, X.L.; Luo, Y.B.; Wang, J.A.; Guo, X.; Huang, K.L. Physiological and biochemical responses of grapefruit seed extract dip on ‘Redglobe’ grape. LWT-Food Sci. Technol. 2009, 42, 471–476. [Google Scholar] [CrossRef]
- Chen, J.; Li, F.F.; Li, Y.X.; Wang, Y.S.; Wang, C.Z.; Yuan, D.B.; Jiang, Y.M. Exogenous procyanidin treatment delays senescence of harvested banana fruit by enhancing antioxidant responses and in vivo procyanidin content. Postharvest Biol. Technol. 2019, 158, 110999. [Google Scholar] [CrossRef]
- Tareen, M.J.; Abbasi, N.A.; Hafiz, I.A. Postharvest application of salicylic acid enhanced antioxidant enzyme activity and maintained quality of peach cv. ‘Flordaking’ fruit during storage. Sci. Hortic. 2012, 142, 221–228. [Google Scholar] [CrossRef]
- Siboza, X.I.; Bertling, I.; Odindo, A.O. Enzymatic antioxidants in response to methyl jasmonate and salicylic acid and their effect on chilling tolerance in lemon fruit Citrus Limon (L.) Burm. F. Sci. Hortic. 2017, 225, 659–667. [Google Scholar] [CrossRef]
- Ullah, S.; Khan, A.S.; Malik, A.U.; Razzaq, K.; Amin, M.; Akhtar, G.; Faried, H.N. Exogenous application of salicylic acid influences fruit softening and quality of ‘flordaking’ peach during ripening at ambient conditions. Pure Appl. Biol. 2020, 9, 1009–1024. [Google Scholar] [CrossRef]
- Mittler, R.; Zandalinas, S.I.; Fichman, Y.; Breusegem, F.V. Reactive oxygen species signalling in plant stress responses. Nat. Rev. Mol. Cell Biol. 2022, 23, 663–679. [Google Scholar] [CrossRef]
- Pasquariello, M.S.; Di Patre, D.; Mastrobuoni, F.; Zampella, L.; Scortichini, M.; Petriccione, M. Influence of postharvest chitosan treatment on enzymatic browning and antioxidant enzyme activity in sweet cherry fruit. Postharvest Biol. Technol. 2015, 109, 45–56. [Google Scholar] [CrossRef]
- Regoli, F.; Giuliani, M.E.; Benedetti, M.; Arukwe, A. Molecular and biochemical biomarkers in environmental monitoring: A comparison of biotransformation and antioxidant defense systems in multiple tissues. Aquat. Toxicol. 2011, 105S, 56–66. [Google Scholar] [CrossRef]
- Gu, Y.F.; Liang, C.J. Responses of antioxidative enzymes and gene expression in Oryza sativa L. and Cucumis sativus L. seedlings to microcystins stress. Ecotoxicol. Environ. Saf. 2020, 193, 110351. [Google Scholar] [CrossRef]
- An, J.P.; Zhang, X.W.; Liu, Y.J.; Zhang, J.C.; Wang, X.; You, C.X.; Hao, Y.J. MdABI5 works with its interaction partners to regulate abscisic acid-mediated leaf senescence in apple. Plant J. 2021, 105, 1566–1581. [Google Scholar] [CrossRef] [PubMed]
- Ding, Y.L.; Sun, T.J.; Ao, K.; Peng, Y.J.; Zhang, Y.X.; Li, X.; Zhang, Y.L. Opposite roles of salicylic acid receptors NPR1 and NPR3/NPR4 in transcriptional regulation of plant immunity. Cell 2018, 173, 1454–1467. [Google Scholar] [CrossRef]
- Posadinu, C.M.; Rodriguez, M.; Conte, P.; Piga, A.; Attene, G. Fruit quality and shelf-life of Sardinian tomato (Solanum lycopersicum L.) landraces. PLoS ONE 2023, 18, e0290166. [Google Scholar] [CrossRef]
- Chen, C.Y.; Huang, Q.; Peng, X.; Wan, C.P.; Zeng, J.K.; Zhang, Y.J.; Chen, J.Y. Alleviatory effects of salicylic acid on postharvest softening and cell wall degradation of ‘Jinshayou’pummelo (Citrus maxima Merr.): A comparative physiological and transcriptomic analysis. Food Chem. 2023, 424, 136428. [Google Scholar] [CrossRef]
- Li, X.L.; Su, Q.F.; Jia, R.J.; Wang, Z.D.; Fu, J.H.; Guo, J.H.; Zhao, Z.Y. Comparison of cell wall changes of two different types of apple cultivars during fruit development and ripening. J. Integr. Agric. 2023, 22, 2705–2718. [Google Scholar] [CrossRef]
- Li, X.; Xu, C.; Korban, S.S.; Chen, K. Regulatory mechanisms of textural changes in ripening fruits. CRC Crit. Rev. Plant Sci. 2010, 29, 222–243. [Google Scholar] [CrossRef]
- Aghdam, M.S.; Mukherjee, S.; Flores, F.B.; Arnao, M.B.; Luo, Z.; Corpas, F.J. Functions of melatonin during postharvest of horticultural crops. Plant Cell Physiol. 2022, 63, 1764–1786. [Google Scholar] [CrossRef] [PubMed]
- Hayat, I.; Masud, T.; Rathore, H.A. Effect of coating and wrapping materials on the shelf life of apple (Malus domestica cv. Borkh). Int. J. Food Saf. 2005, 5, 24–34. [Google Scholar]
- Ahn, T.; Paliyath, G.; Murr, D.P. Antioxidant enzyme activities in apple varieties and resistance to superficial scald development. Food Res. Int. 2007, 40, 1012–1019. [Google Scholar] [CrossRef]
- Gu, C.; Wu, R.F.; Yu, C.Y.; Qi, K.J.; Wu, C.; Zhang, H.P.; Zhang, S.L. Spatio-temporally expressed sorbitol transporters cooperatively regulate sorbitol accumulation in pear fruit. Plant Sci. 2021, 303, 110787. [Google Scholar] [CrossRef] [PubMed]
- Kumari, P.; Barman, K.; Patel, V.B.; Siddiqui, M.W.; Kole, B. Reducing postharvest pericarp browning and preserving health promoting compounds of litchi fruit by combination treatment of salicylic acid and chitosan. Sci. Hortic. 2015, 197, 555–563. [Google Scholar] [CrossRef]
- Asghari, M.; Aghdam, M.S. Impact of salicylic acid on post-harvest physiology of horticultural crops. Trends Food Sci. Technol. 2010, 21, 502–509. [Google Scholar] [CrossRef]
- Aghdam, M.S.; Asghari, M.; Khorsandi, O.; Mohayeji, M. Alleviation of postharvest chilling injury of tomato fruit by salicylic acid treatment. J. Food Sci. Technol. 2014, 51, 2815–2820. [Google Scholar] [CrossRef]
- Khademi, Z.; Ershadi, A. Postharvest application of salicylic acid improves storability of peach (Prunus persica cv. Elberta) fruits. Int. J. Agric. Crop. Sci. 2013, 5, 651–655. [Google Scholar]
- Shafiee, M.; Taghavi, T.S.; Babalar, M. Addition of salicylic acid to nutrient solution combined with postharvest treatments (hot water, salicylic acid, and calcium dipping) improved postharvest fruit quality of strawberry. Sci. Hortic. 2010, 124, 40–45. [Google Scholar] [CrossRef]
- Yao, H.J.; Tian, S.P. Effects of pre-and post-harvest application of salicylic acid or methyl jasmonate on inducing disease resistance of sweet cherry fruit in storage. Postharvest Biol. Technol. 2005, 35, 253–262. [Google Scholar] [CrossRef]
- Zhang, Y.F.; Shi, H.Y.; Zhang, Y.X. Expression and regulation of the ethylene receptor PpERS gene during pear fruit development and following salicylic acid treatment. Plant Cell Tissue Organ Cult. 2013, 114, 385–394. [Google Scholar] [CrossRef]
- Cao, J.K.; Jiang, W.B.; Zhao, Y.M. Experiment Guidance on Postharvest Physiology and Biochemistry of Fruits and Vegetables; China Light Industry Press: Beijing, China, 2007. [Google Scholar]
- Chai, J.X.; Wang, Y.T.; Liu, Y.F.; Yong, K.; Liu, Z.D. 1-MCP extends the shelf life of ready-to-eat ‘Hayward’ and ‘Qihong’ kiwifruit stored at room temperature. Sci. Hortic. 2021, 289, 110437. [Google Scholar] [CrossRef]
- Xu, F.X.; Liu, S.Y.; Liu, Y.F.; Xu, J.; Liu, T.; Dong, S.Z. Effectiveness of lysozyme coatings and 1-MCP treatments on storage and preservation of kiwifruit. Food Chem. 2019, 288, 201–207. [Google Scholar] [CrossRef]
- Zhu, L.J.; Yu, H.T.; Dai, X.M.; Yu, M.L.; Yu, Z.F. Effect of methyl jasmonate on the quality and antioxidant capacity by modulating ascorbate-glutathione cycle in peach fruit. Sci. Hortic. 2022, 303, 111216. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2–ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Gene Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
PpPPO1 | TCCCTACTCACAAAGCCCAAG | GACCTCCAAGACCAAGAAGCA |
PpSOD1 | TTCCCTACGACTATGGGGCT | GTTGGTGACGTAAGCCTGGT |
PpPOD1 | AAGGCATGCATGTGGTCAGT | CGACATATCCACCATGCCCA |
PpCAT1 | GCAACTACCCGGAGTGGAAA | TACCAAACGTCCAACTGGCT |
PpAPX6 | TCATTGGGACACCCAACAGC | GACATGCCGGGAATTGAAGC |
PpGST2 | CTTATCTTTTGGATGGATAGCATTC | CGTGTTTGGTTCATGTATATATATTA |
PpACO2 | ATGGAGAACTTCCCAGTTATCAACT | TCAAGCAGTAGTTTTAACTGGACCC |
PpEIN3a | GGAGTTGATGATGGGCAGAAAATG | GGTTCAGACATGTTGATGTTGCAT |
PpNCED1 | TCGTCTACCACAACTGCCAC | TCGTAGCTAAGCGCGAAGAG |
PpAOC2 | GGACACGTATCTGGCTGTGA | AAGCTCCTCAGGCAAATCCT |
PpNPR-1 | TTCTCACTAAAGGAGCTCGTGCGT | GCAACTCCATGTGCAGATCATCAG |
PpTAR2 | CCTTGCTGGTTTTTGGAGCC | GGACTTCAAGCAGTCCGTCA |
PpCOMT1 | GGCCTCACATCCATCGTTGA | GCGCAGCATAGCAGTTCTTC |
PpPG1 | ATGGCTTTAAAAACACAGTTGTTGT | ACCTTCAATGGTGTCCATGTATG |
PpPME2 | ACCATCCTTGTTCGTCCTAGACA | GTCTCCCCAGGTAGTTCTTGTGC |
PpCEL3 | GCTCCACTGCCTAAAGTTGCTC | GGCCCCAAATAGGACCGTAAAG |
PpPGIP1 | CTTCGTCTAGACCGCAATAAGCTCA | ATTGCTGGCCAAATCTGCAGTTGTG |
PpSPS1 | ACTCATGAGAATTCAGGCTCTC | GTCGTCTGGAAAGACATGTTC |
PpSUS1 | ATGGAGAATCGCCGTAAGTTC | AAGGTCCATTTTTGAGCTGCTG |
PpSOT1 | TCCAATTACGTGGGTTTACAGTTC | TGGAACTTGCCAAACAAGACC |
PpTMT4 | GGGTTCTTCTTTCGAACTTGG | TCTGGTGGGAAAGATTTCTGC |
PpSWEET15 | TTTATGCACCAAAGGAAGCTAGG | ACACAAAACCCAGAACGTTTGG |
PpcyNAD-MDH | TGCTGAGGCTTTGAATGGTG | TTTCCAGTGCAGAAGCTTGG |
PpcyNADP-ME | GTGGGAAAACAATTCACGAAGG | ACTTTAGCAGCAATGTTGGCTG |
PpUBI | TGCAGATCTTCGTGAAAACCCTAAC | CATAGCACTTGCGGCAGATCATCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, H.; Li, Y.; Wassie, M.; Huo, L.; Shi, H. Salicylic Acid Spray Delays Sand Pear Fruit Senescence during Room Temperature Shelf Life by Regulating Antioxidant Capacity and Senescence-Related Genes. Plants 2024, 13, 848. https://doi.org/10.3390/plants13060848
Wang H, Li Y, Wassie M, Huo L, Shi H. Salicylic Acid Spray Delays Sand Pear Fruit Senescence during Room Temperature Shelf Life by Regulating Antioxidant Capacity and Senescence-Related Genes. Plants. 2024; 13(6):848. https://doi.org/10.3390/plants13060848
Chicago/Turabian StyleWang, Huiying, Yawei Li, Misganaw Wassie, Liyue Huo, and Haiyan Shi. 2024. "Salicylic Acid Spray Delays Sand Pear Fruit Senescence during Room Temperature Shelf Life by Regulating Antioxidant Capacity and Senescence-Related Genes" Plants 13, no. 6: 848. https://doi.org/10.3390/plants13060848
APA StyleWang, H., Li, Y., Wassie, M., Huo, L., & Shi, H. (2024). Salicylic Acid Spray Delays Sand Pear Fruit Senescence during Room Temperature Shelf Life by Regulating Antioxidant Capacity and Senescence-Related Genes. Plants, 13(6), 848. https://doi.org/10.3390/plants13060848