Putative Allele of D10 Gene Alters Rice Tiller Response to Nitrogen
Abstract
:1. Introduction
2. Results
2.1. p47dt1 Mutant Showed Dwarfing Multiple Tillers
2.2. Dwarfing Multiple Tiller Traits of p47dt1 Were Controlled by a Single Recessive Gene
2.3. P47DT1 as a Putative Allele of D10
2.4. P47DT1 Changes the Response Pathway of Nitrogen Concentration in Rice
2.5. P47DT1 Alters Nitrogen Allocation Patterns in Rice
2.6. Potential Role of TCP19 in Regulating D10 Expression
3. Discussion
3.1. P47DT1 Mutation Affects Nitrogen Absorption Pathways
3.2. D10’s Possible Role in the TCP19-Mediated Nitrogen Response Pathway
4. Materials and Methods
4.1. Experimental Materials
4.2. Population Construction and Separation Statistics
4.3. Gene Mapping
4.4. Pot Test Scheme
4.5. Hydroponics Test Scheme
4.6. Nitrogen Content Determination
4.7. Transcription Factor Prediction
4.8. Determination of Gene Expression
4.9. Data Analysis
4.10. Graphical Software
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Liu, T.; Zhang, X.; Zhang, H.; Cheng, Z.; Liu, J.; Zhou, C.; Luo, S.; Luo, W.; Li, S.; Xing, X. Dwarf and High Tillering1 represses rice tillering through mediating the splicing of D14 pre-mRNA. Plant Cell 2022, 34, 3301–3318. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; He, W.; Lian, L.; Wei, Y.; Cai, Q. Research progress of rice plant type. Nat. Sci. Ed. 2020, 38, 61–66. [Google Scholar]
- Yan, Y.; Ding, C.; Zhang, G.; Hu, J.; Zhu, L.; Zeng, D.; Qian, Q.; Ren, D. Genetic and environmental control of rice tillering. Crop J. 2023, 11, 1287–1302. [Google Scholar] [CrossRef]
- Wei, G.; Xu, R.; Sun, H.; Wang, S. Quantitative relationship between tillering and leaf size of main stem and its response to nitrogen. J. Jiangsu Agric. 2014, 30, 950–958. [Google Scholar]
- Riou-Khamlichi, C.; Huntley, R.; Jacqmard, A.; Murray, J.A. Cytokinin activation of Arabidopsis cell division through a D-type cyclin. Science 1999, 283, 1541–1544. [Google Scholar] [CrossRef]
- Chen, T.; Xiao, W.; Huang, C.; Zhou, D.; Liu, Y.; Guo, T.; Chen, Z.; Wang, H. Fine Mapping of the Affecting Tillering and Plant Height Gene CHA-1 in Rice. Plants 2023, 12, 1507. [Google Scholar] [CrossRef] [PubMed]
- Hao, X.; Xiang, Y.; Zeng, M.; Yang, Y.; Xie, P.; Li, M.; Li, D.; Tian, L. Cytological characterization and gene mapping of rice dwarf rod mutants. Life Sci Res. 2021, 25, 39–47. Available online: http://smkx.hunnu.edu.cn/CN/abstract/abstract2341.shtml (accessed on 28 June 2024).
- Huang, W.; Weng, F.; Cha, M.; Ding, Y.; Wang, S. Relationship between multiple tiller phenotype production and cytokinin in rice mutant D12W191. J. Nanjing Agric. Univ. 2016, 39, 711–721. [Google Scholar]
- Sang, D.; Chen, D.; Liu, G.; Liang, Y.; Huang, L.; Meng, X.; Chu, J.; Sun, X.; Dong, G.; Yuan, Y. Strigolactones regulate rice tiller angle by attenuating shoot gravitropism through inhibiting auxin biosynthesis. Proc. Natl. Acad. Sci. USA 2014, 111, 11199–11204. [Google Scholar] [CrossRef]
- Sasaki, A.; Ashikari, M.; Ueguchi-Tanaka, m.; Itoh, H.; Nishimura, A.; Swapan, D.; Ishiyama, K.; Saito, T.; Kobayashi, M.; Khush, G.S.; et al. A mutant gibberellin-synthesis gene in rice. Nature 2002, 416, 701–702. [Google Scholar] [CrossRef] [PubMed]
- Umehara, M.; Hanada, A.; Yoshida, S.; Akiyama, K.; Arite, T.; Takeda-Kamiya, N.; Magome, H.; Kamiya, Y.; Shirasu, K.; Yoneyama, K. Inhibition of shoot branching by new terpenoid plant hormones. Nature 2008, 455, 195–200. [Google Scholar] [CrossRef] [PubMed]
- Gomez-Roldan, V.; Fermas, S.; Brewer, P.B.; Puech-Pagès, V.; Dun, E.A.; Pillot, J.P.; Letisse, F.; Matusova, R.; Danoun, S.; Portais, J.C. Strigolactone inhibition of shoot branching. Nature 2008, 455, 189–194. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Gao, J.; Li, J.; Wang, Y. Advances in regulating rice tillers by strigolactones. Chin. Bull. Bot. 2015, 50, 539. [Google Scholar]
- Wang, Y.; Shang, L.; Yu, H.; Zeng, L.; Hu, J.; Ni, S.; Rao, Y.; Li, S.; Chu, J.; Meng, X. A strigolactone biosynthesis gene contributed to the green revolution in rice. Mol. Plant 2020, 13, 923–932. [Google Scholar] [CrossRef] [PubMed]
- Zou, J.; Zhang, S.; Zhang, W.; Li, G.; Chen, Z.; Zhai, W.; Zhao, X.; Pan, X.; Xie, Q.; Zhu, L. The rice HIGH-TILLERING DWARF1 encoding an ortholog of Arabidopsis MAX3 is required for negative regulation of the outgrowth of axillary buds. Plant J. 2006, 48, 687–698. [Google Scholar] [CrossRef] [PubMed]
- Arite, T.; Iwata, H.; Ohshima, K.; Maekawa, M.; Nakajima, M.; Kojima, M.; Sakakibara, H.; Kyozuka, J. DWARF10, an RMS1/MAX4/DAD1 ortholog, controls lateral bud outgrowth in rice. Plant J. 2007, 51, 1019–1029. [Google Scholar] [CrossRef]
- Ito, S.; Kitahata, N.; Umehara, M.; Hanada, A.; Kato, A.; Ueno, K.; Mashiguchi, K.; Kyozuka, J.; Yoneyama, K.; Yamaguchi, S.; et al. A new lead chemical for strigolactone biosynthesis inhibitors. Plant Cell Physiol. 2010, 51, 1143–1150. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Li, G.; Fang, J.; Chen, W.; Jiang, H.; Zou, J.; Liu, X.; Zhao, X.; Li, X.; Chu, C. The interactions among DWARF10, auxin and cytokinin underlie lateral bud outgrowth in rice. J. Integr. Plant Biol. 2010, 52, 626–638. [Google Scholar] [CrossRef]
- Lin, H.; Wang, R.; Qian, Q.; Yan, M.; Meng, X.; Fu, Z.; Yan, C.; Jiang, B.; Su, Z.; Li, J.; et al. DWARF27, an iron-containing protein required for the biosynthesis of strigolactones, regulates rice tiller bud outgrowth. Plant Cell 2009, 21, 1512–1525. [Google Scholar] [CrossRef]
- Liu, W.; Kohlen, W.; Lillo, A.; Op den Camp, R.; Ivanov, S.; Hartog, M.; Limpens, E.; Jamil, M.; Smaczniak, C.; Kaufmann, K. Strigolactone biosynthesis in Medicago truncatula and rice requires the symbiotic GRAS-type transcription factors NSP1 and NSP2. Plant Cell 2011, 23, 3853–3865. [Google Scholar] [CrossRef]
- Tong, H.; Liu, L.; Jin, Y.; Du, L.; Yin, Y.; Qian, Q.; Zhu, L.; Chu, C. DWARF AND LOW-TILLERING acts as a direct downstream target of a GSK3/SHAGGY-like kinase to mediate brassinosteroid responses in rice. Plant Cell 2012, 24, 2562–2577. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Huang, Z.; Wang, Z.; Liu, L. Progress of brassinosterols in growth, development and stress resistance in rice. Chin. Agric. Bull. 2012, 28, 1–5. Available online: https://www.casb.org.cn/CN/Y2012/V28/I9/1 (accessed on 28 June 2024).
- Liu, Y.; Wang, H.; Jiang, Z.; Wang, W.; Xu, R.; Wang, Q.; Zhang, Z.; Li, A.; Liang, Y.; Ou, S. Genomic basis of geographical adaptation to soil nitrogen in rice. Nature 2021, 590, 600–605. [Google Scholar] [CrossRef] [PubMed]
- Shou, P.; Le, L.; Xiaohong, L.; Hongxuan, W.; Guohua, X.U. Effects of nitrogen on rice tiller bud development and its mechanism. J. Nanjing Agric. Univ. 2016, 39, 973–978. [Google Scholar]
- Forde, B.G. Local and long-range signaling pathways regulating plant responses to nitrate. Annu. Rev. Plant Biol. 2002, 53, 203–224. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Gu, D.; Ding, Y.; Wang, Q.; Li, G.; Wang, S. The relationship between nitrogen, auxin and cytokinin in the growth regulation of rice (Oryza sativa L.) tiller buds. Aust. J. Crop Sci. 2011, 5, 1019–1026. [Google Scholar]
- Pan, S. Regulation of the Growth and Development of Rice Tiller Buds by Nitrogen and Monogolactone. Ph.D. Dissertation, Nanjing Agricultural University, Nanjing, China, 1 June 2016. [Google Scholar]
- Xu, J.; Zha, M.; Li, Y.; Ding, Y.; Chen, L.; Ding, C.; Wang, S. The interaction between nitrogen availability and auxin, cytokinin, and strigolactone in the control of shoot branching in rice (Oryza sativa L.). Plant Cell Rep. 2015, 34, 1647–1662. [Google Scholar] [CrossRef]
- Hong, Z.; Ueguchi-Tanaka, M.; Shimizu-Sato, S.; Inukai, Y.; Fujioka, S.; Shimada, Y.; Takatsuto, S.; Agetsuma, M.; Yoshida, S.; Watanabe, Y. Loss-of-function of a rice brassinosteroid biosynthetic enzyme, C-6 oxidase, prevents the organized arrangement and polar elongation of cells in the leaves and stem. Plant J. 2002, 32, 495–508. [Google Scholar] [CrossRef]
- Leyser, O. The fall and rise of apical dominance. Curr. Opin. Genet. Dev. 2005, 15, 468–471. [Google Scholar] [CrossRef]
- Li, B. Analysis of the Physiological Characteristics of Different N and Expression Regulation of Related Genes in Rice. Ph.D. Dissertation, Nanjing Agricultural University, Nanjing, China, 1 June 2007. [Google Scholar]
- Sun, L.; Zhu, L.; Zheng, G.; Zhu, F.; Guo, X.; Lugo, O.; Zhang, Z.; Kim, J.H. Study on the characteristics of nitrate and ammonium nitrogen accumulation and the regulation of nitrogen fertilizer in rice grain. Rice China 2016, 22, 25–29. [Google Scholar]
- Liu, X.; Hu, Q.; Yan, J.; Sun, K.; Liang, Y.; Jia, M.; Meng, X.; Fang, S.; Wang, Y.; Jing, Y.; et al. ζ-Carotene isomerase suppresses tillering in rice through the coordinated biosynthesis of strigolactone and abscisic acid. Mol. Plant 2020, 13, 1784–1801. [Google Scholar] [CrossRef] [PubMed]
- Dong, H.; Liu, Q. Analysis on the rationality of nitrogen and phosphorus chemical fertilizer in farmland of Anhui Province. Soil Fertil. Sci. China 2018, 1673–6257. [Google Scholar]
- Jahan, A.; Islam, A.; Sarkar, M.I.U.; Iqbal, M.; Ahmed, M.N.; Islam, M.R. Nitrogen response of two high yielding rice varieties as influenced by nitrogen levels and growing seasons. Geol. Ecol. Landsc. 2022, 6, 24–31. [Google Scholar] [CrossRef]
- Li, W.; Zhou, Y.; Hu, J.; Wang, L. Determination of an unknown nitrogen compound by KN method. China Health Stand. Manag. 2016, 7, 110–112. [Google Scholar]
- Sedri, M.H.; Niedbała, G.; Roohi, E.; Niazian, M.; Szulc, P.; Rahmani, H.A.; Feiziasl, V. Comparative analysis of plant growth-promoting rhizobacteria (PGPR) and chemical fertilizers on quantitative and qualitative characteristics of rainfed wheat. Agronomy 2022, 12, 1524. [Google Scholar] [CrossRef]
Agronomic Traits | P47-1 | p47dt1 |
---|---|---|
Plant height (cm) | 94.80 ± 2.73 | 55.33 ± 3.79 ** |
Number of tillers | 16.1 ± 1.9 | 84.5 ± 14.0 *** |
Panicle length (cm) | 16.33 ± 0.57 | 10.73 ± 0.21 ** |
Effective panicles | 16.3 ± 0.5 | 34.3 ± 4.9 ** |
Total grains per plant | 1884.33 ± 116.42 | 1219.66 ± 132.34 ** |
Number of solid grains | 1505.33 ± 72.96 | 369.33 ± 65.49 *** |
1000-grain-weight (g) | 25.03 ± 0.12 | 13.53 ± 0.24 ** |
Seed setting rate (%) | 80.00 ± 4.54 | 30.66 ± 9.56 *** |
Population | Population Size | The Phenotype of P47-1 | The Phenotype of p47dt1 | Value of Expectation | χ2 | χ2(0.05) |
---|---|---|---|---|---|---|
F2 | 150 | 113 | 37 | 3:1 | 0.009 | 3.84 |
Stock-2 Drugs | 0.2 (mol/L) | 1.5 (mol/L) |
---|---|---|
NH4Cl (53.49 g/mol) | 10.69 (g/L) | 80.23 (g/L) |
KNO3 (101.1 g/mol) | 20.22 (g/L) | 151.65 (g/L) |
NH4NO3 (80 g/mol) | 16 (g/L) | 120 (g/L) |
Gene Name | Accession No. | Forward-Primer (5′-3′) | Reverse-Primer (5′-3′) |
---|---|---|---|
D10 | LOC_Os01g54270 | GGAAGAGTGTACGGCAGGAG | GTAGTCGCCGAGGTTCCATA |
TCP19 | LOC_Os06g12230 | GACAGTGTACCGTGGCGT | CGCCGGGAAGTTCATGAAAT |
QUBI | LOC_Os03g13170 | GCTCCGTGGCGGTATCAT | CGGCAGTTGACAGCCCTAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rimi, T.I.; Zhang, M.; Zhang, R.; Zhang, Z.; Leng, X.; Han, J.; Meng, S.; Du, W.; Zhang, Z. Putative Allele of D10 Gene Alters Rice Tiller Response to Nitrogen. Plants 2024, 13, 3349. https://doi.org/10.3390/plants13233349
Rimi TI, Zhang M, Zhang R, Zhang Z, Leng X, Han J, Meng S, Du W, Zhang Z. Putative Allele of D10 Gene Alters Rice Tiller Response to Nitrogen. Plants. 2024; 13(23):3349. https://doi.org/10.3390/plants13233349
Chicago/Turabian StyleRimi, Tamanna Islam, Meirong Zhang, Ruixin Zhang, Zhe Zhang, Xueyu Leng, Jiafang Han, Sihan Meng, Wen Du, and Zhongchen Zhang. 2024. "Putative Allele of D10 Gene Alters Rice Tiller Response to Nitrogen" Plants 13, no. 23: 3349. https://doi.org/10.3390/plants13233349
APA StyleRimi, T. I., Zhang, M., Zhang, R., Zhang, Z., Leng, X., Han, J., Meng, S., Du, W., & Zhang, Z. (2024). Putative Allele of D10 Gene Alters Rice Tiller Response to Nitrogen. Plants, 13(23), 3349. https://doi.org/10.3390/plants13233349