Aqueous Extracts of Rhus trilobata Inhibit the Lipopolysaccharide-Induced Inflammatory Response In Vitro and In Vivo
Abstract
1. Introduction
2. Results
2.1. Effect of Rhus trilobata Extracts on MO Cell Viability
2.2. Rhus trilobata Anti-Inflammatory Activity in LPS-Induced MOs
2.3. In Vivo Evaluation of the Anti-Inflammatory Effects of RtAE and Its Fractions
2.4. Phytochemical Composition of F6
3. Discussion
4. Materials and Methods
4.1. Chemicals and Reagents
4.2. Recollection of Plant Material
4.3. Preparation of Plant Extracts and Fractionation
4.4. Cell Culture
4.5. Evaluation of the Cytotoxicity of Rhus trilobata to LPS-Induced MOs
4.6. In Vitro Evaluation of the Anti-Inflammatory Activity of Rhus trilobata in LPS-Induced MOs
Gene | Primer Sequence |
---|---|
GAPDH [73] | F: 5′-TGAAGGTCGGTGTGAACGG-3´ R: 5′-GTGAGTGGAGTCATACTGGAA-3´ |
IL-1β [74] | F: 5′-GCAACTGTTCCTGAACTCAACT-3´ R: 5′-TCAACTGCCTGGGGTTTTCTA-3´ |
IL-6 [75] | F: 5′-TAGTCCTTCCTACCCCAATTTCC-3′ R: 5′-CTTCCTCACCGATTCCTGGTT-3′ |
TNF-α [76] | F: 5′-CCCTCACACTCAGATCATCTTCT-3´ R: 5´-GACATCGGGTGCAGCATCG-3′ |
COX-2 [69] | F: 5´- CTGTATCCCGCCCTGCTGGTG -3′ R: 5’-TTCTGTCGGTGGTAGTTGCGTTCA-3’ |
4.7. Anti-Inflammatory Activity of Rhus trilobata in the LPS-Induced Paw Edema Model
4.8. Statistical Analysis
4.9. Ultra-Performance Liquid Chromatography-Mass Spectrometry Analysis (RP-UPLC-PAD-QTOF-MS)
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Non Communicable Diseases. Available online: https://www.who.int/news-room/fact-sheets/detail/noncommunicable-diseases (accessed on 23 April 2023).
- Demaio, A.; Jamieson, J.; Horn, R.; de Courten, M.; Tellier, S. Non-Communicable Diseases in Emergencies: A Call to Action. PLoS Curr. 2013, 5. [Google Scholar] [CrossRef] [PubMed]
- Straub, R.H.; Schradin, C. Chronic Inflammatory Systemic Diseases—An Evolutionary Trade-off between Acutely Beneficial but Chronically Harmful Programs. EMPH 2016, 1, 37–51. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Deng, H.; Cui, H.; Fang, J.; Zuo, Z.; Deng, J.; Li, Y.; Wang, X.; Zhao, L. Inflammatory Responses and Inflammation-Associated Diseases in Organs. Oncotarget 2018, 9, 7204–7218. [Google Scholar] [CrossRef] [PubMed]
- Brock, T.G.; McNish, R.W.; Peters-Golden, M. Arachidonic Acid Is Preferentially Metabolized by Cyclooxygenase-2 to Prostacyclin and Prostaglandin E2. J. Biol. Chem. 1999, 274, 11660–11666. [Google Scholar] [CrossRef] [PubMed]
- Kany, S.; Vollrath, J.T.; Relja, B. Cytokines in Inflammatory Disease. Int. J. Mol. Sci. 2019, 20, 6008. [Google Scholar] [CrossRef]
- Oishi, Y.; Manabe, I. Macrophages in Inflammation, Repair and Regeneration. Int. Immunol. 2018, 30, 511–528. [Google Scholar] [CrossRef]
- Farzaneh, Z.; Kalantar, K.; Iraji, A.; Amirghofran, Z. Inhibition of LPS-Induced Inflammatory Responses by Satureja hortensis Extracts in J774.1 Macrophages. J. Immunoass. Immunochem. 2018, 39, 274–291. [Google Scholar] [CrossRef]
- Gensel, J.C.; Zhang, B. Macrophage Activation and Its Role in Repair and Pathology after Spinal Cord Injury. Brain Res. 2015, 1619, 1–11. [Google Scholar] [CrossRef]
- Tanaka, T.; Narazaki, M.; Kishimoto, T. IL-6 in Inflammation, Immunity, and Disease. Cold Spring Harb. Perspect. Biol. 2014, 6, a016295. [Google Scholar] [CrossRef]
- Wauters, L.; Billiet, T.; Papamichael, K.; Ballet, V.; Joniau, S.; Verschueren, P.; Silversmit, G.; Van Assche, G.; Vermeire, S.; Ferrante, M. Incidence of Renal Cell Carcinoma in Inflammatory Bowel Disease Patients with and without Anti-TNF Treatment. Eur. J. Gastroenterol. Hepatol. 2017, 29, 84–90. [Google Scholar] [CrossRef]
- Nathan, C.; Ding, A. Nonresolving Inflammation. Cell 2010, 140, 871–882. [Google Scholar] [CrossRef] [PubMed]
- Owona, B.A.; Abia, W.A.; Moundipa, P.F. Natural Compounds Flavonoids as Modulators of Inflammasomes in Chronic Diseases. Int. Immunopharmacol. 2020, 84, 106498. [Google Scholar] [CrossRef] [PubMed]
- Atanasov, A.G.; Zotchev, S.B.; Dirsch, V.M.; Supuran, C.T. Natural Products in Drug Discovery: Advances and Opportunities. Nat. Rev. Drug. Discov. 2021, 20, 200–216. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Escalate, J.J.; Gilbert, E.E. Red de Herbarios del Noroeste de México—Rhus trilobata. Available online: https://herbanwmex.net/portal/taxa/index.php?taxauthid=1&taxon=13960&clid=3811 (accessed on 23 April 2023).
- Anderson, M.K. Rhus trilobata Nutt. var. simplicifolia (Greene) F.A. Barkley. Available online: https://plants.usda.gov/home/plantProfile?symbol=RHTRS (accessed on 7 July 2023).
- Varela-Rodríguez, L.; Sánchez-Ramírez, B.; Saenz-Pardo-Reyes, E.; Ordaz-Ortiz, J.J.; Castellanos-Mijangos, R.D.; Hernández-Ramírez, V.I.; Cerda-García-Rojas, C.M.; González-Horta, C.; Talamás-Rohana, P. Antineoplastic Activity of Rhus trilobata Nutt. (Anacardiaceae) against Ovarian Cancer and Identification of Active Metabolites in This Pathology. Plants 2021, 10, 2074. [Google Scholar] [CrossRef]
- Varela-Rodríguez, L.; Sánchez-Ramírez, B.; Rodríguez-Reyna, I.S.; Ordaz-Ortiz, J.J.; Chávez-Flores, D.; Salas-Muñoz, E.; Osorio-Trujillo, J.C.; Ramos-Martínez, E.; Talamás-Rohana, P. Biological and Toxicological Evaluation of Rhus trilobata Nutt. (Anacardiaceae) Used Traditionally in Mexico against Cancer. BMC Complement. Altern. Med. 2019, 19, 153. [Google Scholar] [CrossRef]
- Correa, L.B.; Seito, L.N.; Manchope, M.F.; Verri, W.A.; Cunha, T.M.; Henriques, M.G.; Rosas, E.C. Methyl Gallate Attenuates Inflammation Induced by Toll-like Receptor Ligands by Inhibiting MAPK and NF-Κb Signaling Pathways. Inflamm. Res. 2020, 69, 1257–1270. [Google Scholar] [CrossRef]
- Suryanti, V.; Wibowo, F.R.; Khotijah, S.; Andalucki, N. Antioxidant Activities of Cinnamaldehyde Derivatives. IOP Conf. Ser. Mater. Sci. Eng. 2018, 333, 012077. [Google Scholar] [CrossRef]
- Hada, Y.; Uchida, H.A.; Wada, J. Fisetin Attenuates Lipopolysaccharide-Induced Inflammatory Responses in Macrophage. Biomed Res Int 2021, 2021, 5570885. [Google Scholar] [CrossRef]
- Li, K.K.; Shen, S.S.; Deng, X.; Shiu, H.T.; Siu, W.S.; Leung, P.C.; Ko, C.H.; Cheng, B.H. Dihydrofisetin Exerts Its Anti-Inflammatory Effects Associated with Suppressing ERK/P38 MAPK and Heme Oxygenase-1 Activation in Lipopolysaccharide-Stimulated RAW 264.7 Macrophages and Carrageenan-Induced Mice Paw Edema. Int. Immunopharmacol. 2018, 54, 366–374. [Google Scholar] [CrossRef]
- Vajja, B.N.L.; Juluri, S.; Kumari, M.; Kole, L.; Chakrabarti, R.; Joshi, V.D. Lipopolysaccharide-Induced Paw Edema Model for Detection of Cytokine Modulating Anti-Inflammatory Agents. Int. Immunopharmacol. 2004, 4, 901–909. [Google Scholar] [CrossRef]
- Kesharwani, A. Siva Prasad Panda Isolation of Phytohormone Trans-Zeatin: Potential Oxidant Scavenger and Anti-Aging Compound. Neurochem. J. 2024, 18, 134–146. [Google Scholar] [CrossRef]
- Dey, A.; De, J.N. Neuroprotective Therapeutics from Botanicals and Phytochemicals against Huntington’s Disease and Related Neurodegenerative Disorders. J. Herb. Med. 2015, 5, 1–19. [Google Scholar] [CrossRef]
- Sidor, K.; Skirecki, T. A Bittersweet Kiss of Gram-Negative Bacteria: The Role of ADP-Heptose in the Pathogenesis of Infection. Microorganisms 2023, 11, 1316. [Google Scholar] [CrossRef]
- Kobylina, T.; Novikov, A.; Sadyrova, G.; Kyrbassova, E.; Nazarbekova, S.; Imanova, E.; Parmanbekova, M.; Tynybekov, B. The Volatile Compounds Composition of Different Parts of Wild Kazakhstan Sedum Ewersii Ledeb. Separations 2024, 11, 208. [Google Scholar] [CrossRef]
- Schmitt, C.; Pannier, A.; McIntyre, C.; Zandt, H.; Ciorciaro, C.; Winters, K.; Pepper, T. Crossover Dose Escalation Study to Assess Safety, Pharmacokinetics, and Pharmacodynamics of Single Doses of R1663, an Oral Factor Xa Inhibitor, in Healthy Male Volunteers. J. Clin. Pharmacol. 2012, 52, 499–510. [Google Scholar] [CrossRef]
- Chen, W.; Deng, Z.; Chen, K.; Dou, D.; Song, F.; Li, L.; Xi, Z. Synthesis and in Vitro Anticancer Activity Evaluation of Novel Bioreversible Phosphate Inositol Derivatives. Eur. J. Med. Chem. 2015, 93, 172–181. [Google Scholar] [CrossRef]
- Rossi, A.M.; Riley, A.M.; Potter, B.V.L.; Taylor, C.W. Chapter 10—Adenophostins: High-Affinity Agonists of IP3 Receptors. In Current Topics in Membranes; Serysheva, I.I., Ed.; Structure and Function of Calcium Release Channels; Academic Press: Cambridge, MA, USA, 2010; Volume 66, pp. 209–233. [Google Scholar]
- Nomura, T.; Hayashi, E.; Kawakami, S.; Ogita, S.; Kato, Y. Environmentally Benign Process for the Preparation of Antimicrobial α-Methylene-β-Hydroxy-γ-Butyrolactone (Tulipalin B) from Tulip Biomass. Biosci Biotechnol Biochem 2015, 79, 25–35. [Google Scholar] [CrossRef] [PubMed]
- Lim, T.K. Tulip Gesneriana. In Edible Medicinal and Non Medicinal Plants: Volume 8, Flowers; Lim, T.K., Ed.; Springer: Dordrecht, The Netherlands, 2014; pp. 221–231. ISBN 978-94-017-8748-2. [Google Scholar]
- Katsamakas, S.; Zografos, A.L.; Sarli, V. Advances of Phenoxazines: Synthesis, Reactivity and Their Medicinal Applications. Curr. Med. Chem. 2016, 23, 2972–2999. [Google Scholar] [CrossRef]
- Tallent, W.H. Two New Antibiotic Cyclopentanoid Monoterpenes of Plant Origin. Tetrahedron 1964, 20, 1781–1787. [Google Scholar] [CrossRef]
- Huynh, M.S.; Snell, E.E. Enzymes of Vitamin B6 Degradation. Purification and Properties of Two N-Acetylamidohydrolases. J. Biol. Chem. 1985, 260, 2379–2383. [Google Scholar] [CrossRef]
- Ekinci, G.N.; Sanlier, N. The Relationship between Nutrition and Depression in the Life Process: A Mini-Review. Exp. Gerontol. 2023, 172, 112072. [Google Scholar] [CrossRef] [PubMed]
- McEwen, B.J. Chapter 25—Impact of Cardiometabolic Disease on Cognitive Function. In Nutraceuticals in Brain Health and Beyond; Ghosh, D., Ed.; Academic Press: Cambridge, MA, USA, 2021; pp. 357–368. ISBN 978-0-12-820593-8. [Google Scholar]
- Wirthgen, E.; Hoeflich, A.; Rebl, A.; Günther, J. Kynurenic Acid: The Janus-Faced Role of an Immunomodulatory Tryptophan Metabolite and Its Link to Pathological Conditions. Front. Immunol. 2017, 8, 1957. [Google Scholar] [CrossRef] [PubMed]
- Turski, M.P.; Turska, M.; Zgrajka, W.; Bartnik, M.; Kocki, T.; Turski, W.A. Distribution, Synthesis, and Absorption of Kynurenic Acid in Plants. Planta. Med. 2011, 77, 858–864. [Google Scholar] [CrossRef]
- Korczynska, M.; Xiang, D.F.; Zhang, Z.; Xu, C.; Narindoshvili, T.; Kamat, S.S.; Williams, H.J.; Chang, S.S.; Kolb, P.; Hillerich, B.; et al. Functional Annotation and Structural Characterization of a Novel Lactonase Hydrolyzing D-Xylono-1,4-Lactone-5-Phosphate and L-Arabino-1,4-Lactone-5-Phosphate. Biochemistry 2014, 53, 4727–4738. [Google Scholar] [CrossRef]
- Ueland, P.M.; McCann, A.; Midttun, Ø.; Ulvik, A. Inflammation, Vitamin B6 and Related Pathways. Mol. Asp. Med. 2017, 53, 10–27. [Google Scholar] [CrossRef]
- Sibi, G.; Rabina, S. Inhibition of Pro-Inflammatory Mediators and Cytokines by Chlorella vulgaris Extracts. Phcog. Res. 2016, 8, 118. [Google Scholar] [CrossRef]
- Zhang, J.-M.; An, J. Cytokines, Inflammation, and Pain. Int. Anesthesiol. Clin. 2007, 45, 27–37. [Google Scholar] [CrossRef] [PubMed]
- Cheng, S.-C.; Huang, W.-C.; S. Pang, J.-H.; Wu, Y.-H.; Cheng, C.-Y. Quercetin Inhibits the Production of IL-1β-Induced Inflammatory Cytokines and Chemokines in ARPE-19 Cells via the MAPK and NF-κB Signaling Pathways. IJMS 2019, 20, 2957. [Google Scholar] [CrossRef]
- Lee, D.-S.; Jeong, G.-S. Butein Provides Neuroprotective and Anti-Neuroinflammatory Effects through Nrf2/ARE-Dependent Haem Oxygenase 1 Expression by Activating the PI3K/Akt Pathway. Br. J. Pharmacol. 2016, 173, 2894–2909. [Google Scholar] [CrossRef]
- Liu, Y.; Fu, Y.; Zhang, Y.; Liu, F.; Rose, G.M.; He, X.; Yi, X.; Ren, R.; Li, Y.; Zhang, Y.; et al. Butein Attenuates the Cytotoxic Effects of LPS-Stimulated Microglia on the SH-SY5Y Neuronal Cell Line. Eur. J. Pharmacol. 2020, 868, 172858. [Google Scholar] [CrossRef]
- Chen, J.-H.; Chen, W.-L.; Liu, Y.-C. Amentoflavone Induces Anti-Angiogenic and Anti-Metastatic Effects Through Suppression of NF-κB Activation in MCF-7 Cells. Anticancer Res. 2015, 35, 6685–6693. [Google Scholar]
- Okoye, F.; Osadebe, P.; Proksch, P.; Edrada-Ebel, R.; Nworu, C.; Esimone, C. Anti-Inflammatory and Membrane-Stabilizing Stigmastane Steroids from Alchornea floribunda Leaves. Planta Med. 2010, 76, 172–177. [Google Scholar] [CrossRef] [PubMed]
- Shahidullah, A.; Lee, J.-Y.; Kim, Y.-J.; Halimi, S.M.A.; Rauf, A.; Kim, H.-J.; Kim, B.-Y.; Park, W. Anti-Inflammatory Effects of Diospyrin on Lipopolysaccharide-Induced Inflammation Using RAW 264.7 Mouse Macrophages. Biomedicines 2020, 8, 11. [Google Scholar] [CrossRef]
- Roh, K.; Lee, J.; Kang, H.; Park, K.W.; Song, Y.; Lee, S.; Ku, J.-M. Synthesis and Evaluation of Butein Derivatives for in Vitro and in Vivo Inflammatory Response Suppression in Lymphedema. Eur. J. Med. Chem. 2020, 197, 112280. [Google Scholar] [CrossRef]
- Zheng, W.; Zhang, H.; Jin, Y.; Wang, Q.; Chen, L.; Feng, Z.; Chen, H.; Wu, Y. Butein Inhibits IL-1β-Induced Inflammatory Response in Human Osteoarthritis Chondrocytes and Slows the Progression of Osteoarthritis in Mice. Int. Immunopharmacol. 2017, 42, 1–10. [Google Scholar] [CrossRef]
- Khalil, M.; Bazzi, A.; Zeineddine, D.; Jomaa, W.; Daher, A.; Awada, R. Repressive Effect of Rhus Coriaria L. Fruit Extracts on Microglial Cells-Mediated Inflammatory and Oxidative Stress Responses. J. Ethnopharmacol. 2021, 269, 113748. [Google Scholar] [CrossRef]
- PubChem. Fludarabine Phosphate. Available online: https://pubchem.ncbi.nlm.nih.gov/compound/30751 (accessed on 26 September 2024).
- Liang, Z.; Wu, G.; Fan, C.; Xu, J.; Jiang, S.; Yan, X.; Di, S.; Ma, Z.; Hu, W.; Yang, Y. The Emerging Role of Signal Transducer and Activator of Transcription 3 in Cerebral Ischemic and Hemorrhagic Stroke. Prog. Neurobiol. 2016, 137, 1–16. [Google Scholar] [CrossRef]
- Dickson, L.; Tenon, M.; Svilar, L.; Fança-Berthon, P.; Martin, J.-C.; Rogez, H.; Vaillant, F. Genipap (Genipa americana L.) Juice Intake Biomarkers after Medium-Term Consumption. Food Res. Int. 2020, 137, 109375. [Google Scholar] [CrossRef]
- Ramírez-Marroquín, O.A.; Jiménez-Arellanes, M.A.; Luna-Herrera, J.; Olivares-Romero, J.L.; Bonilla-Landa, I.; Castro-Cerritos, K.V.; Ramírez-Marroquín, O.A.; Jiménez-Arellanes, M.A.; Luna-Herrera, J.; Olivares-Romero, J.L.; et al. Anti-Inflammatory Activity of Piperlotines. J. Mex. Chem. Soc. 2020, 64, 181–190. [Google Scholar] [CrossRef]
- Su, X.; Dohle, W.; Mills, S.J.; Watt, J.M.; Rossi, A.M.; Taylor, C.W.; Potter, B.V.L. Inositol Adenophostin: Convergent Synthesis of a Potent Agonist of d-Myo-Inositol 1,4,5-Trisphosphate Receptors. ACS Omega 2020, 5, 28793–28811. [Google Scholar] [CrossRef]
- Coutry, N.; Nguyen, J.; Soualhi, S.; Gerbe, F.; Meslier, V.; Dardalhon, V.; Almeida, M.; Quinquis, B.; Thirion, F.; Herbert, F.; et al. Cross Talk between Paneth and Tuft Cells Drives Dysbiosis and Inflammation in the Gut Mucosa. Proc. Natl. Acad. Sci. USA 2023, 120, e2219431120. [Google Scholar] [CrossRef] [PubMed]
- Krzymińska, A.; Gąsecka, M.; Magdziak, Z. Content of Phenolic Compounds and Organic Acids in the Flowers of Selected Tulipa gesneriana Cultivars. Molecules 2020, 25, 5627. [Google Scholar] [CrossRef]
- Mendonca, P.; Taka, E.; Bauer, D.; Cobourne-Duval, M.; Soliman, K.F.A. The Attenuating Effects of 1,2,3,4,6 Penta-O-Galloyl-β- d -Glucose on Inflammatory Cytokines Release from Activated BV-2 Microglial Cells. J. Neuroimmunol. 2017, 305, 9–15. [Google Scholar] [CrossRef] [PubMed]
- Yu, T.; Li, Z.; Xu, L.; Yang, M.; Zhou, X. Anti-Inflammation Effect of Qingchang Suppository in Ulcerative Colitis through JAK2/STAT3 Signaling Pathway in Vitro and in Vivo. J. Ethnopharmacol. 2021, 266, 113442. [Google Scholar] [CrossRef]
- Patil, K.R.; Mahajan, U.B.; Unger, B.S.; Goyal, S.N.; Belemkar, S.; Surana, S.J.; Ojha, S.; Patil, C.R. Animal Models of Inflammation for Screening of Anti-Inflammatory Drugs: Implications for the Discovery and Development of Phytopharmaceuticals. Int. J. Mol. Sci. 2019, 20, 4367. [Google Scholar] [CrossRef]
- Llorens, O.; Perez, J.J.; Palomer, A.; Mauleon, D. Differential Binding Mode of Diverse Cyclooxygenase Inhibitors. J. Mol. Graph. Model 2002, 20, 359–371. [Google Scholar] [CrossRef] [PubMed]
- D’Mello, P.; Gadhwal, M.; Joshi, U.; Shetgiri, P.; Pharmacy, P. Modeling of COX-2 Inhibotory Activity of Flavonoids. Int. J. Pharm. Pharm. Sci. 2011, 3, 33–40. [Google Scholar]
- Kiraly, A.J.; Soliman, E.; Jenkins, A.; Van Dross, R.T. Apigenin Inhibits COX-2, PGE2, and EP1 and Also Initiates Terminal Differentiation in the Epidermis of Tumor Bearing Mice. Prostaglandins Leukot. Essent. Fat. Acids 2016, 104, 44–53. [Google Scholar] [CrossRef]
- Bindu, S.; Mazumder, S.; Bandyopadhyay, U. Non-Steroidal Anti-Inflammatory Drugs (NSAIDs) and Organ Damage: A Current Perspective. Biochem. Pharmacol. 2020, 180, 114147. [Google Scholar] [CrossRef]
- Kim, B.-G.; Song, Y.; Lee, M.-G.; Ku, J.-M.; Jin, S.-J.; Hong, J.-W.; Lee, S.; Kang, H. Macrophages from Mice Administered Rhus verniciflua Stokes Extract Show Selective Anti-Inflammatory Activity. Nutrients 2018, 10, 1926. [Google Scholar] [CrossRef]
- Wu, Z.; Ma, Y.; Gong, X.; Zhang, Y.; Zhao, L.; Cheng, G.; Cai, S. Rhus chinensis Mill. Fruits Prevent High-Fat/Ethanol Diet-Induced Alcoholic Fatty Liver in Rats via AMPK/SREBP-1/FAS Signaling Pathway. J. Funct. Foods 2019, 61, 103498. [Google Scholar] [CrossRef]
- Montes-Fonseca, S.L.; Orrantia-Borunda, E.; Aguilar-Elguezabal, A.; González Horta, C.; Talamás-Rohana, P.; Sánchez-Ramírez, B. Cytotoxicity of Functionalized Carbon Nanotubes in J774A Macrophages. Nanomed. Nanotechnol. Biol. Med. 2012, 8, 853–859. [Google Scholar] [CrossRef]
- Quiñonez-Flores, C.M.; López-Loeza, S.M.; Pacheco-Tena, C.; Muñoz-Morales, P.M.; Acosta-Jiménez, S.; González-Chávez, S.A. Stability of Housekeeping Genes in Inflamed Joints of Spontaneous and Collagen-Induced Arthritis in DBA/1 Mice. Inflamm. Res. 2021, 70, 619–632. [Google Scholar] [CrossRef]
- Rao, X.; Huang, X.; Zhou, Z.; Lin, X. An Improvement of the 2(-△△CT) Method for Quantitative Real-Time Polymerase Chain Reaction Data Analysis. Biostat. Bioinforma. Biomath. 2013, 3, 71–85. [Google Scholar]
- Sánchez-Ramírez, B.; Escalante, B.; Rosales-Encina, J.L.; Talamás-Rohana, P. Role of Prostaglandin E2 on Amoebic Liver Abscess Formation in Hamsters. Prostaglandins 1997, 53, 411–421. [Google Scholar] [CrossRef] [PubMed]
- González-Chávez, S.A.; López-Loeza, S.M.; Acosta-Jiménez, S.; Cuevas-Martínez, R.; Pacheco-Silva, C.; Chaparro-Barrera, E.; Pacheco-Tena, C. Low-Intensity Physical Exercise Decreases Inflammation and Joint Damage in the Preclinical Phase of a Rheumatoid Arthritis Murine Model. Biomolecules 2023, 13, 488. [Google Scholar] [CrossRef]
- Sand, J.; Haertel, E.; Biedermann, T.; Contassot, E.; Reichmann, E.; French, L.E.; Werner, S.; Beer, H.-D. Expression of Inflammasome Proteins and Inflammasome Activation Occurs in Human, but Not in Murine Keratinocytes. Cell Death Dis. 2018, 9, 24. [Google Scholar] [CrossRef] [PubMed]
- Cai, Q.; Li, Y.; Pei, G. Polysaccharides from Ganoderma Lucidum Attenuate Microglia-Mediated Neuroinflammation and Modulate Microglial Phagocytosis and Behavioural Response. J. Neuroinflamm. 2017, 14, 63. [Google Scholar] [CrossRef]
- Moser, V.A.; Uchoa, M.F.; Pike, C.J. TLR4 Inhibitor TAK-242 Attenuates the Adverse Neural Effects of Diet-Induced Obesity. J. Neuroinflamm. 2018, 15, 306. [Google Scholar] [CrossRef]
- Diario Oficial de La Federación. Available online: https://www.dof.gob.mx/nota_detalle.php?codigo=762506&fecha=22/08/2001#gsc.tab=0 (accessed on 23 April 2023).
Sample | Concentration PGE2 (µg/mL) | PGE2 Decrease (%) |
---|---|---|
LPS-stimulated MOs (−) | 6.30 ± 0.334 a | |
Nonstimulated MOs (+) | 0.00 ± 0.085 f | 100 |
+DXM (10μM) | 0.78 ± 0.198 e | 90.7 |
+AE (15 µg/mL) | 2.87 ± 0.085 d | 53.68 |
+F2 (15 µg/mL) | 2.64 ± 0.245 d | 54.72 |
+F3 (15 µg/mL) | 0.68 ± 0.120 e | 88.91 |
+F4 (15 µg/mL) | 4.43 ± 0.359 b | 24.02 |
+F5 (15 µg/mL) | 3.60 ± 0.187 c | 45.78 |
+F6 (15 µg/mL) | 0.55 ± 0.159 e | 90.12 |
Treatment | Anti-Inflammatory Effect % (Range) | p-Value |
---|---|---|
DXM | 93 (58 to 127) | 0.005 |
AE | 41 (19 to 62) | 0.050 |
F2 | 23 (−20 to 66) | 0.230 |
F3 | 59 (21 to 98) | 0.028 |
F4 | 19.6 (−19 to 58) | 0.250 |
F5 | 27 (−17 to 22) | 0.200 |
F6 | 68.7 (10 to 127) | 0.050 |
Treatment | Concentration (μg) | Anti-Inflammatory Effects % (Range) | p-Value |
---|---|---|---|
DXM | 500 | 93 (58.1 to 127.1) | 0.005 |
AE | 750 | 80 (9 to 151.8) | 0.061 |
1000 | −27 (−85.1 to 30.7) | 0.769 | |
F3 | 750 | 36 (22.7 to 49.1) | 0.005 |
1000 | 37 (28.04 to 46.26) | 0.001 | |
F6 | 750 | 64 (17 to 111.8) | 0.039 |
1000 | 24 (−10.6 to 59.4) | 0.147 |
Peak No. | m/z | RT (min) | Maximum Abundance | Compound Name | Compound ID | DLMS | Biology Activity | Presence in Plants | Ref. |
---|---|---|---|---|---|---|---|---|---|
1 | 132.0554552 | 1.54 | 2.5 | L-asparaginium | CHEBI:32651 | −0.19 | ---- | ---- | |
2 | 275.9770172 | 8.65 | 2.6 | Indole-3-carboxylic acid-O-sulphate | HMDB0060002 | −1.49 | Antiviral | ---- | |
3 | 607.997306 | 9.22 | 7.1 | 9-ribosyl-trans-zeatin 5′-triphosphate(4-) | CHEBI:87953 | 0.38 | Antioxidant, Neuroprotective | Cocos nucifera | [24,25] |
4 | 652.0414331 | 9.4 | 5.3 | ADP-L-glycero-D-manno-heptose(2-) | CHEBI:57564 | 0.82 | Immunomodulator | ---- | [26] |
5 | 260.200245 | 9.45 | 4.9 | Butanamide | CHEBI:50724 | −1.61 | Anticancer, Anti-inflamatory, Neuroprotective, Antiviral | Sedum ewersii Ledeb | [27] |
6 | 260.0158199 | 9.45 | 114.8 | 1-(2,2-Difluoroethyl) pyrrolidine-3,4-dicarboxylic acid | HMDB0257565 | −0.14 | Antitrombotic, Antidiabetic, Anti-inflammatory, Antineurogenic pain | ---- | [28] |
7 | 517.8965765 | 9.97 | 7.4 | UTP(3-) | CHEBI:57481 | 0.38 | ---- | ---- | ---- |
8 | 561.9356555 | 10.2 | 6.4 | 2-Fluoro-araatp | HMDB0245128 | 0.95 | Anticancer, Antiviral, Immunomodulator, Antiinflamatory, Antioxidant, Cardioprotective | ---- | ---- |
9 | 650.0239725 | 10.58 | 4.0 | Adenophostin A | CHEBI:34524 | 0.99 | Anticancer, Antiprotozoal, Antiviral, Imunomodulator | ---- | [29,30] |
10 | 135.0054229 | 13.47 | 4.4 | Tulipalin B | CHEBI:87123 | −2.1 | Anticancer, Antidiabetic, Antimicrobial, Antiinflamatory, Antiviral, Hepatoprotective, Immunomodulator | Tulip gesneriana, Tulipa turkestanica | [31,32] |
11 | 224.0172865 | 13.73 | 7.4 | 2-(Methylthio)-3H-phenoxazin-3-one | HMDB0035996 | −1.05 | Antibiotic, Antiviral, Anticancer, Antioxidant, Anti-inflammatory, Neuroprotective, | ---- | [33] |
12 | 205.0454102 | 13.78 | 4.9 | Genipic acid | HMDB0036072 | −0.75 | Anticancer, Antimicrobial, Antiinflamatory | Genipa americana | [34] |
13 | 348.003809 | 14.47 | 2.1 | 4-mercapto-6-oxo-3-phenyl-2-thiophen-2-yl-1,2-dihydropyrimidine-5-carbonitrile | CHEBI:105511 | −0.65 | Anticancer | ---- | ---- |
14 | 242.1748489 | 16.02 | 2.4 | N-undecanoylglycine | CHEBI:74438 | −0.56 | Antiviral, Antithrombotic, Immunomodulato, Neuroprotective | ---- | ---- |
15 | 137.0262286 | 16.77 | 10.9 | 4-Methyl-3-oxoadipate-enol-lactone | CHEBI:81662 | −1.55 | Antiinflamatory, Antiviral, Antioxidant, Anticancer, Kidney protective | ---- | ---- |
16 | 251.9897988 | 17.57 | 9.8 | 3-(acetamidomethylene)-2-(hydroxymethyl)succinate(2-) | CHEBI:19418 | −0.82 | Antiinflamatory, Antioxidant, Cardioprotective, Inmodulator, Neuroprotective | ---- | [35,36,37] |
17 | 224.0155096 | 17.57 | 2.6 | Kynurenic acid | HMDB0000715 | −0.01 | Cardioprotective, Kindney protective, Neuroprotective | Taraxacum officinale, Urtica dioica, Chelidonium majus, Tripterygium wilfordii | [38,39] |
18 | 396.7970903 | 18.01 | 2.3 | Iodic acid | CHEBI:24857 | 0.98 | ---- | ---- | ---- |
19 | 256.0360889 | 18.06 | 16.3 | Unknown | ---- | ---- | ---- | ---- | ---- |
20 | 262.9347679 | 18.42 | 6.3 | D-xylono-1,4-lactone-5-phosphate(2-) | CHEBI:136751 | −0.34 | ---- | ---- | [40] |
21 | 290.9780115 | 20.97 | 2.9 | 5-(3′-carboxy-3′-oxopropyl)-4,6-dihydroxypicolinate | CHEBI:2013 | 0.06 | ---- | ---- | ---- |
22 | 368.0782567 | 23.8 | 2.6 | 5′-O-beta-D-Glucosylpyridoxine | HMDB0246884 | 0.97 | Anticancer, Cardioprotective, Neuroprotective | ---- | [41] |
23 | 412.8722317 | 26.41 | 72.0 | Arsonoacetic acid | CHEBI:28506 | −0.63 | ---- | ---- | ---- |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rodríguez-Castillo, A.J.; González-Chávez, S.A.; Portillo-Pantoja, I.; Cruz-Hermosillo, E.; Pacheco-Tena, C.; Chávez-Flores, D.; Delgado-Gardea, M.C.E.; Infante-Ramírez, R.; Ordaz-Ortiz, J.J.; Sánchez-Ramírez, B. Aqueous Extracts of Rhus trilobata Inhibit the Lipopolysaccharide-Induced Inflammatory Response In Vitro and In Vivo. Plants 2024, 13, 2840. https://doi.org/10.3390/plants13202840
Rodríguez-Castillo AJ, González-Chávez SA, Portillo-Pantoja I, Cruz-Hermosillo E, Pacheco-Tena C, Chávez-Flores D, Delgado-Gardea MCE, Infante-Ramírez R, Ordaz-Ortiz JJ, Sánchez-Ramírez B. Aqueous Extracts of Rhus trilobata Inhibit the Lipopolysaccharide-Induced Inflammatory Response In Vitro and In Vivo. Plants. 2024; 13(20):2840. https://doi.org/10.3390/plants13202840
Chicago/Turabian StyleRodríguez-Castillo, Alejandra Jazmín, Susana Aideé González-Chávez, Ismael Portillo-Pantoja, Eunice Cruz-Hermosillo, César Pacheco-Tena, David Chávez-Flores, Ma. Carmen E. Delgado-Gardea, Rocío Infante-Ramírez, José Juan Ordaz-Ortiz, and Blanca Sánchez-Ramírez. 2024. "Aqueous Extracts of Rhus trilobata Inhibit the Lipopolysaccharide-Induced Inflammatory Response In Vitro and In Vivo" Plants 13, no. 20: 2840. https://doi.org/10.3390/plants13202840
APA StyleRodríguez-Castillo, A. J., González-Chávez, S. A., Portillo-Pantoja, I., Cruz-Hermosillo, E., Pacheco-Tena, C., Chávez-Flores, D., Delgado-Gardea, M. C. E., Infante-Ramírez, R., Ordaz-Ortiz, J. J., & Sánchez-Ramírez, B. (2024). Aqueous Extracts of Rhus trilobata Inhibit the Lipopolysaccharide-Induced Inflammatory Response In Vitro and In Vivo. Plants, 13(20), 2840. https://doi.org/10.3390/plants13202840