Next Article in Journal
Role of Polyamines in the Response to Salt Stress of Tomato
Next Article in Special Issue
Morpho-Physiological Evaluation of Solanum betaceum Cav. In Vitro Cloned Plants: A Comparison of Different Micropropagation Methods
Previous Article in Journal
Characterization of Mineral Composition and Nutritional Value of Acacia Green Pods
Previous Article in Special Issue
Optimization of the In Vitro Proliferation of an Ancient Pear Tree Cultivar (‘Decana d’inverno’) through the Use of Neem Oil
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 12
Issue 9
10.3390/plants12091854
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ethylene Inhibition Reduces De Novo Shoot Organogenesis and Subsequent Plant Development from Leaf Explants of Solanum betaceum Cav.

by
Mariana Neves
1,
Sandra Correia
1,2 and
Jorge Canhoto
1,*
1
Centre for Functional Ecology, TERRA Associate Laboratory, Department of Life Sciences, University of Coimbra, 3000-456 Coimbra, Portugal
2
InnovPlantProtect CoLab, 7350-478 Elvas, Portugal
*
Author to whom correspondence should be addressed.
Plants 2023, 12(9), 1854; https://doi.org/10.3390/plants12091854
Submission received: 31 March 2023 / Revised: 28 April 2023 / Accepted: 28 April 2023 / Published: 30 April 2023
(This article belongs to the Special Issue Application of Biotechnology to Woody Propagation)
Browse Figures
Review Reports Versions Notes

Abstract

:
In de novo shoot organogenesis (DNSO) plant cells develop into new shoots, without the need of an existing meristem. Generally, this process is triggered by wounding and specific growth regulators, such as auxins and cytokinins. Despite the potential significance of the plant hormone ethylene in DNSO, its effect in regeneration processes of woody species has not been thoroughly investigated. To address this gap, Solanum betaceum Cav. was used as an experimental model to explore the role of this hormone on DNSO and potentially extend the findings to other woody species. In this work it was shown that ethylene positively regulates DNSO from tamarillo leaf explants. Ethylene precursors ACC and ethephon stimulated shoot regeneration by increasing the number of buds and shoots regenerated. In contrast, the inhibition of ethylene biosynthesis or perception by AVG and AgNO3 decreased shoot regeneration. Organogenic callus induced in the presence of ethylene precursors showed an upregulated expression of the auxin efflux carrier gene PIN1, suggesting that ethylene may enhance shoot regeneration by affecting auxin distribution prior to shoot development. Additionally, it was found that the de novo shoot meristems induced in explants in which ethylene biosynthesis and perception was suppressed were unable to further develop into elongated shoots. Overall, these results imply that altering ethylene levels and perception could enhance shoot regeneration efficiency in tamarillo. Moreover, we offer insights into the possible molecular mechanisms involved in ethylene-induced shoot regeneration.

1. Introduction

Ethylene is a gaseous plant hormone involved in several physiological processes, including plant growth and development, fruit ripening and seed germination [1]. Its effect on plant development encompasses inhibition on primary root growth [2] and lateral root formation [3] and a positive modulation of root hair formation and growth [4,5]. Ethylene is also involved in the inhibition of leaf growth due to its regulation of cell division and cell expansion (reviewed in [1]). Within the most varied roles of ethylene, its involvement in plant stress responses is notable. Ethylene is a key regulator of stress adaptation, mediating both abiotic [6] and biotic [7] stresses. This hormone acts as a signaling molecule, inducing a variety of physiological and biochemical changes and enabling plants to cope with environmental stress [8].
Plant regeneration systems, such as de novo shoot organogenesis (DNSO) or somatic embryogenesis, rely on plant cell plasticity, which is inherent to mechanisms of pluripotency/totipotency. It can be induced or enhanced by exogenous stress stimulus, such as wounding and hormonal treatments [9,10]. These plant regeneration processes are divided in different morphological stages, often in response to a balance between auxins and cytokinins [10]. DNSO is generally divided in pluripotency acquisition (cell dedifferentiation), shoot promeristem formation and shoot development [11].
DNSO has been extensively studied in Arabidopsis thaliana, typically involving an initial culture step in an auxin-rich medium (pluripotency acquisition) and posterior subculture in a cytokinin-rich medium (promeristem formation and shoot development) [11,12]. Generally, pluripotency acquisition occurs not only in response to exogenous auxin supplementation but is also triggered by wounding [10]. Wounding positively modulates callus formation with a marked accumulation of cytokinin at cutting sites and contributes to further organ regeneration [12,13]. In addition, ethylene biosynthesis is also triggered by wounding [14] and in response to cytokinin [15,16] and auxin [17] treatments. There is compelling evidence that callus formation and the subsequent ability to regenerate is derived from specific cell types that act as potential pluripotent stem cells [18,19]. Auxin-induced callus appears to originate from pericycle and pericycle-like cells located around the vasculature, while wound-induced callus can arise from various cell types such as epidermis, xylem parenchyma, procambium, and mesophyll [18]. In some species, de novo shoots and roots regenerate from procambium or cambium cells [18,19].
The effect of ethylene modulation on in vitro regeneration, focusing on DNSO and somatic embryogenesis was recently reviewed [20]. Ethylene seems to affect in vitro culture depending on the species or the explants used. Some studies point out a negative effect of ethylene on DNSO in Cucumis melo [21,22] and Brassica juncea [23,24]. Nevertheless, in Solanum pennellii [25] and Arabidopsis thaliana [26] ethylene perception seems to be required. For somatic embryogenesis, the role of ethylene in reverting recalcitrance in genotypes with low regeneration capacity was already described [27].
Ethylene can act in plant regeneration as a stress responsive agent in addition to its hormonal effect. The APETALA2/Ethylene responsive factor (AP2/ERF) transcription factors family has been highlighted for their regulation in multiple stress responses [28]. Some of these transcription factors respond to ethylene and promote the activation of ethylene-dependent responsive genes [28,29]. Regarding plant regeneration, in Medicago truncatula, a transcription factor of this family induced by ethylene, designated MtSERF1, seems to be required for somatic embryo development in the presence of auxin and cytokinin [30]. Likewise, in A. thaliana and Glycine max, orthologs of this transcription factor were also described with a positive correlation in somatic embryo development in the presence of auxin.
Solanum betaceum Cav., commonly known as tamarillo, is an Andean solanaceous tree, that has been used as a model system to study several micropropagation/regeneration processes, such as organogenesis [31,32,33,34] and somatic embryogenesis [35,36,37]. It has allowed a better understanding of these systems, and the possibility of further applications in other species to optimize protocols and regenerate adult selected trees [38].
In tamarillo, the effect of plant growth regulators, such as auxins and/or cytokinins on DNSO was already tested [31,32,33,34]. For instance, thidiazuron (TDZ) [31,32], benzylaminopurine (BAP) [31,33,34] or combinations of BAP and naphthaleneacetic acid [33,34] demonstrated to be the most suitable inducers of this process. In terms of initial explant, leaves proved to be the most effective explant for the induction of shoot regeneration, when compared to petioles or root seedlings [31,33].
DNSO has been highly applied for breeding purposes, especially in dicotyledonous species, due to the simplicity and robustness of culture conditions [9]. Ethylene response varies significantly based on the organ, time, and species; thus it is difficult to assign a unique and general role of ethylene in the regulation of biotechnological processes [39]. Therefore, understanding how ethylene regulates DNSO, focusing on woody species, could have important practical applications, such as developing new methods for plant propagation, regeneration and giving relevant insights about recalcitrance in some species.
The aim of this work was to evaluate the effect of ethylene on DNSO, from leaf explants of tamarillo. To achieve this goal, leaf explants were cultured in the presence of different ethylene modulators and their effects evaluated on shoot regeneration. The impact of this modulation on subsequent plant development from the regenerated shoots was also assessed. Finally, the expression of genes related to ethylene biosynthesis, in particular ACS1 and ACO1, of the transcription factor ERF061 and of the auxin efflux carrier PIN1, were evaluated to unveil possible molecular mechanisms behind the ethylene modulation effect.

2. Results

2.1. Effect of Ethylene Modulation on De Novo Shoot Organogenesis

To test the effect of ethylene on DNSO in tamarillo, leaf explants were cultured in the presence of 10 µM of each different ethylene modulator (Figure 1a). Silver nitrate (AgNO3) was used to inhibit ethylene perception and aminoethoxyvinylglycine (AVG) to inhibit ethylene biosynthesis. To stimulate ethylene action on plant tissues, the ethylene precursors, 1-aminocyclopropane-1-carboxylic acid (ACC) and 2-chloroethylphosphonic acid (commercially known as ethephon; ETH) were applied. The protocol for shoot regeneration involves 3 weeks in the dark followed by 5 weeks in a 16 h photoperiod (Figure 1b). These different ethylene modulators were present in culture medium during all the induction process. At the end of 8 weeks, the effect of each modulator on shoot regeneration percentage, the number of buds and shoots developed per explant and the morphology of the regenerated shoots (Figure 1c) were evaluated.
Callus formation was observed at the end of the third week at wounding sites (Figure 1d). Leaf explants exposed to inhibitors of ethylene biosynthesis or perception presented a reduced capacity for callus induction (Figure 1d(ii,iii)). Further shoot development and elongation was also compromised in ethylene inhibition treatments (Figure 1c(xi)). Furthermore, some abnormal leaf shape in shoots regenerated in the presence of AgNO3 (Figure 1c(iv)) were noticed. Few shoots regenerated in ACC treatments presented signs of hyperhydricity (Figure 1d(iv—left)), which was completely reversed when shoots were subcultured in hormone-free MS medium.
Regeneration percentage was not significantly affected by any treatment (Table 1). However, this parameter seemed to decrease across all conditions, with a marked reduction in AVG treatment (around 48%). The number of buds and shoots regenerated per responsive explant was the parameter significantly affected by ethylene modulation. We found a statistically significant increase in the number of buds and shoots developed when ethylene perception was enhanced by ACC and ETH treatments. The inhibition of ethylene perception or biosynthesis by AgNO3 and AVG significantly reduced the number of the buds and shoots regenerated per explant.
AgNO3 and AVG treatments decreased almost two-fold the number of buds and shoots regenerated per explant (around six/explant) relative to control conditions (around 12/explant). When the enhancement of ethylene availability by ACC and ETH was compared with the inhibition of its perception and biosynthesis by AgNO3 and AVG, it was found a three-fold increase in the number of buds and shoots regenerated per explant when ethylene perception is enhanced (19/explant for ACC and 18/explant for ETH) and vice-versa. Interestingly, opposite effects on ethylene modulation reduced or increased the number of buds or shoots per explant by around six explants compared to the control condition. Moreover, similar modulation treatments contributed to similar effects on regeneration.

2.2. Effect of Ethylene Modulation on the Expression of Ethylene-Related Genes and Auxin Efflux Carrier

The effect of ethylene modulation on the expression of specific genes was evaluated in two culture timepoints. Samples from the third week of culture, right before the transition to light and at the end of 8 weeks, defined as the final point of regeneration protocol (Figure 2a), were collected and analyzed.
Regarding ethylene biosynthesis, the expression of ACS1 and ACO1 (Figure 2b–c) was assessed. These genes encode for two specific isoforms of the main enzymes involved in ethylene biosynthesis, ACC synthase and ACC oxidase, respectively. In both timepoints, we found a statistically significant increase in ACS1 expression for the ETH condition (2.93 and 1.88 log2 fold). At the end of the eighth week, AVG promoted the opposite effect, with a statistically significant decrease of ACS1 expression (−0.85 log2 fold). AgNO3 and ACC treatments also showed a tendency to upregulate ACS expression at both timepoints.
For ACO1 expression (Figure 2c), a statistically significant downregulation in AgNO3 treatments for the first time point (−0.39 log2 fold) was found. At the end of 8 weeks, ACO1 expression tends to be upregulated in all conditions.
The expression of the gene ERF061, encoding for a transcription factor of the AP2/ERF superfamily was also evaluated. ERF061 was significantly upregulated in the presence of the ethylene precursor ETH, but also in the presence of the ethylene biosynthesis inhibitor AVG, post 3 weeks of culture (Figure 2d). However, the upregulation of this gene was more notorious in ETH treatments (6.36 log2 fold) than in AVG treatments (1.95 log2 fold). ERF061 expression remained significantly upregulated in the presence of ETH post 8 weeks (3.72 log2 fold). Similarly, we observed a statistically significant upregulation of this gene in ACC presence (1.92 log2 fold) for the same culture timepoint. The upregulation observed previously in AVG treatment for the first timepoint did not remain at the end of the eighth week, in contrast to ETH treatment. Moreover, in this second timepoint, although not statistically significant, ERF061 expression seemed to be downregulated when ethylene perception and biosynthesis were inhibited.
Finally, the effect of ethylene modulation in the expression of the auxin efflux carrier PIN1 (Figure 2e) was assessed. Before transition to light, a statistically significant increase in PIN1 expression was found in the presence of ethylene precursors ACC (1.24 log2 fold) and ETH (1.06 log2 fold). Furthermore, PIN1 expression was significantly downregulated in the presence of the ethylene biosynthesis inhibitor AVG (−1.72 log2 fold). PIN1 showed a tendency to be also downregulated when ethylene perception is inhibited by AgNO3. No significant statistical differences were found at the end of the eighth week. Nevertheless, PIN1 expression values showed a tendency to remain upregulated or downregulated in the ACC and AVG conditions, respectively.

2.3. In Vitro Rotting, Plant Development and Acclimatization

After 8 weeks, the 1 cm shoots regenerated in each condition were cultured in hormone-free MS medium for 1 month to induce rooting and shoot development (Figure 3a). Occasionally, shoots can be cultured in MS medium with low BAP concentrations to induce shoot development and elongation, before the rooting induction step. Nevertheless, this step was skipped to avoid additional hormonal stimuli that could mask ethylene modulation in the subsequent development of the regenerated shoots.
After 1 month in hormone-free MS medium, all shoots regenerated in control conditions and in the presence of ethylene precursors were successfully rooted with well-developed and elongated roots (Figure 3b,c). Interestingly, shoots regenerated in treatments in which ethylene perception and biosynthesis were inhibited had their capacity to develop adventitious roots disrupted (Figure 3b,c). Likewise, shoot development and elongation was also negatively affected. No significant differences in morphological parameters such as plant height, root length and number of roots per shoots, between control and both ACC and ETH treatments were found (Figure 3c).
Acclimatization was successfully achieved for plants regenerated from control and both ACC and ETH treatments (Figure 3d), reaching 83%, 89%, and 100%, respectively. No differences were found in plant height between treatments after 1- and 3-months of ex vitro growth (Figure 3d–f). Nevertheless, the plants developed from shoots regenerated in the presence of ACC presented a significantly higher dry matter percentage when compared to the control plants (Figure 3d) after 3 months in ex vitro conditions.

3. Discussion

3.1. Ethylene Positively Modulates Shoot Regeneration from Callus Induction to Shoot Development

Our results bring out a positive effect of ethylene on DNSO from tamarillo leaves, especially notorious in the number of buds and shoots regenerated per explant. While ethylene enhancement contributed to an effective increase in the number of regenerated shoots, the inhibition of its perception and biosynthesis had the opposite effect. A positive effect of ethylene was already described on DNSO from leaf explants of other Solanaceae, such as Solanum pennellii [25] and Petunia hybrida L. [40]. ACC and AgNO3 treatments affected S. pennellii regeneration in a similar manner as reported in our study. Likewise, exogenous ethylene applications or AgNO3 treatments increased or reduced the number of shoots per explant in P. hybrida, respectively. Ethylene is also essential to induce shoot regeneration from cotyledons explants in Arabidopsis [26].
Ethylene perception seems to be required to enhance pluripotent callus formation at the cutting sites of tamarillo leaf explants. In fact, less callus formation found in AgNO3 and AVG treatments negatively impacted further regeneration. Knowing pluripotent callus is formed at wounding sites in leaf explants, which later lead to shoot development [41], a positive correlation between ethylene perception, pluripotent callus formation, and the explant ability to regenerate can be assumed.
Our protocol for DNSO from tamarillo leaves only englobes an exogenous source of cytokinin (BAP, 8.8 µM) and wounding as stress stimulus, although it is sufficient to promote callus formation and subsequent shoot regeneration. Callus development relies on cytokinin accumulation at cutting sites [13] and also in exogenous auxin supplementation [42]. Organ regeneration requires pluripotent acquisition in the middle of the cell layer of the callus promoted by auxin production and enhancement of cytokinin sensitivity [43]. It is known wounding and cytokinin enhance ethylene biosynthesis [14,15,16,44,45,46,47,48] and, in turn, ethylene also increases cytokinin levels [49]. Likewise, ethylene also enhances auxin biosynthesis and vice-versa [2,17,50,51]. In tomato leaves, wounding stimulates ethylene production [44] and the cytokinin BAP upregulates the ACO-like gene [52]. TDZ and BAP treatments also increase ethylene production in cotton leaves [45]. In our study, BAP treatment (in the control condition) is effective to achieve shoot regeneration from tamarillo leaf explants. Furthermore, other studies have already demonstrated TDZ and BAP as good plant growth regulators to promote DNSO from leaf explants in tamarillo [31,32,33,34]. Recently, Shin et al. [53] demonstrated that ethylene facilitates cell dedifferentiation and auxin-induced callus formation by regulating the abundance of transcripts for auxin receptor genes. This background supports our results and suggests that ethylene can positively affect regeneration in a crosstalk between cytokinin and auxins. Further research is needed to confirm this assumption, but we can hypothesize that, in control conditions, cytokinin and wounding stimulates ethylene production, which in turn enhance auxin biosynthesis contributing to pluripotent callus formation, without the requirement of exogenous auxin supplementation. In the presence of AgNO3 and AVG treatments the effect of cytokinin and wounding on ethylene production is reduced and consequently auxin biosynthesis is downregulated leading to a decrease in callus formation and subsequent shoot regeneration. In addition, this regulation can be addictively regulated by the presence of the ethylene precursors justifying the enhancement of shoot regeneration.

3.2. Ethylene Modulation Differentially Regulates Gene Expression Related to Ethylene Biosynthesis and ERF061 Depending on Regeneration Stage

We explored the expression of two genes encoding for ethylene biosynthetic enzymes, ACC synthase and ACC oxidase (ACS1 and ACO1), and the transcription factor ERF061 that potentially affects regeneration and could be regulated by ethylene. We based our decision to analyze ERF061 expression on the knowledge that it has been considered a putative candidate gene related to shoot regeneration in Arabidopsis [54]. ERF061 belongs to the same AP2/ERF subfamily of WIND1, which promotes callus formation and shoot regeneration in Arabidopsis [55]. The acquisition of regeneration competency is heavily dependent on the role of WIND1, and its ectopic expression increases de novo shoot regeneration from Arabidopsis root explants, without the need for either wounding or auxin pre-treatment [56].
An upregulation of ACS1 expression by ETH treatment was found. In addition, ACC and AgNO3 also showed a tendency to upregulate its expression. On the contrary, a downregulation of ACS1 was found in AVG treatments post 8 weeks. AVG is a strong inhibitor of ACC synthase activity [57,58] while AgNO3 inhibits ethylene action at the receptor level [59]. Besides the negative effect on ethylene action by both modulators, these compounds seem to affect ACS1 gene expression differently. In agreement with our results, several ACS genes are downregulated by AVG in Cucurbita maxima [60] and Pyrus bretschneideri [61] while AgNO3 seems to only downregulate some ACS genes [60]. Both ethylene precursors and exogenous ethylene treatments also seem to upregulate some ACS genes [60,62,63,64], supporting our observations. In turn, the effect of ethylene modulation on ACO1 expression was less notorious compared to those of ACS1. Only AgNO3 treatment significantly downregulated ACO1 expression post 3 weeks of culture.
ERF061 seems to be involved in biotic and abiotic stress responses [65,66]. Some studies also point that ERF061 is upregulated by exogenous ethylene and ethephon treatments [67,68,69]. Effectively, we found in both ACC and ETH treatments an upregulation of ERF061 expression at the eighth week. Contradictory results were observed at the third week, in which ERF061 expression was not only upregulated by ETH, but also by the ethylene biosynthesis inhibitor AVG, albeit to a lesser extent. Nevertheless, at the end of the eighth week, the AVG effect shows the opposite trend while its upregulation by ETH is preserved. Recently, ERF061 was postulated to be a possible transcription factor involved in regulating plant flower development and flower tissue formation in Actinidia eriantha [70]. Our results do not allow us to affirm ERF061 expression is induced by ethylene. However, ERF061 upregulation by ACC and ETH found at the end of 8 weeks, in which shoot-buds are being developed raises some questions about the possible involvement of ERF061 in shoot regeneration, posterior to the callus formation stage.

3.3. Ethylene Precursors Upregulate PIN1 Expression in Cytokinin-Induced Callus

PIN1 is an auxin efflux carrier required for an efficient shoot meristem induction in cytokinin-rich medium [71]. Interestingly, ACC upregulates PIN1 expression in Arabidopsis roots [2]. Thus, we considered that a possible modulation of its expression by ethylene could impact shoot regeneration. In fact, one of the outstanding observations in our results was the significant upregulation of PIN1 at the end of the third week in the presence of ethylene precursors ACC and ETH while its expression was significantly downregulated by AVG treatment. The presence of AgNO3 tends to also downregulate PIN1 in the same culture timepoint, although not significantly. In shoot regeneration from Arabidopsis root explants, PIN1 is locally upregulated marking future sites of primordium initiation [71] and further development of shoot promeristem also requires its upregulation [9]. Moreover, PIN1 loss of function mutation reduces shoot regeneration [71]. Therefore, we can assume the downregulation of PIN1 in AVG and AgNO3 treatments explain their negative impact on shoot regeneration and postulate the requirement of ethylene for DNSO in tamarillo leaf explants.

3.4. Inhibition of Ethylene Biosynthesis and Perception during Shoot Regeneration Negatively Impacts Subsequent Plant Development

Ethylene also seems to be essential to plant development in tamarillo as the shoots regenerated in treatments where ethylene perception or biosynthesis was inhibited were visibly less developed. Subsequent development, such as shoot elongation and adventitious root (AR) formation was also disrupted. In S. pennellii, shoots regenerated in AgNO3 treatments were also less developed [25]. In agreement with our observations, in the woody species Populus tremula, AVG treatments also inhibited shoot elongation, induction and development of buds and root formation; in turn, ACC and ETH treatments stimulated these parameters [72]. The positive effect of ethylene in shoot proliferation of P. tremula raises the prospect of micropropagation protocols based on the action of ethylene produced by the plant itself instead of exogenous hormone treatment, such as the use of small-volume vessels with gas exchange restriction [73].
For biotechnological purposes subsequent AR formation is fundamental to a successful acclimatization. Studies have shown that ethylene can affect plant development differently, depending on the plant species, tissue type, and hormone supplementation [39,74]. In tomato and cucumber, ethylene also increases AR formation through an auxin-ethylene crosstalk [75,76,77], supporting our results. The inhibition of AR induction in shoots regenerated from AgNO3 and AVG impacted further acclimatization and ex vitro adaptation. Unknown molecular patterns previously induced in regenerated shoots seems to impact further AR initiation which is not reverted in the hormone-free MS medium.

4. Materials and Methods

4.1. Plant Material

Leaves of red tamarillo shoots previously established from in vitro germinated seeds were used for shoot regeneration assays. Tamarillo shoots were in vitro propagated in MS medium [78] supplemented with sucrose (0.07 M, Duchefa Biochemie B.V, Haarlem, The Netherlands), BAP (0.8 µM, Sigma-Aldrich, St. Louis, MO, USA), plant agar (0.7%, w/v, Duchefa) and pH adjusted to 5.7 before autoclaving at 121 °C for 20 min. Plants were subculture monthly and kept in a growth chamber at 25 °C, in a 16 h photoperiod, at 25–35 μmol m−2 s−1 (white cool fluorescent lamps).

4.2. Shoot Regeneration and Culture Conditions

Apical leaves of tamarillo shoots (3 weeks subcultures) cut in approximately 0.25 cm2 square segments including the midrib were used for shoot regeneration. MS medium supplemented with sucrose (0.07 M, Duchefa), BAP (8.8 µM, Sigma), plant agar (0.7%, w/v, Duchefa) and pH adjusted to 5.7 before autoclaving at 121 °C for 20 min was used to induce regeneration. Leaf explants were cultured with the abaxial side down in dark conditions at 24 °C for 3 weeks. After 3 weeks, the cultures were transferred to a 16 h photoperiod at 25–35 μmol m−2 s−1 and 25 °C for 5 weeks.
To test the effect of ethylene modulation on shoot regeneration, 10 µM of AgNO3 (Merck, Darmstadt, Germany), AVG (Sigma), ACC (Sigma) or ETH (Sigma) were added to the medium. All these modulators were sterilized by filtration with a 0.2 µm filter and added to the medium after autoclaving to avoid thermal degradation. At the end of 8 weeks, regeneration percentage ((number of responsive explants/total number of initial explants) × 100) and the number of shoots and buds developed in responsive explants were analyzed. Three biological replicates were made for the control and each treatment. Each replicate consisted of 8 glass jars fully closed with 3 explants (N = 24), in a total of 72 explants per condition.

4.3. Total RNA Isolation and Quantitative PCR Analysis

Samples from responsive explants with 3 and 8 weeks of culture were selected, frozen in liquid N2 and stored at −80 °C until RNA extraction. Samples (80 mg) were carefully collected from the visible regeneration sites of the explant. RNA was extracted using the kit NucleoSpin® RNA Plant (MACHEREY-NAGEL GmbH & Co. KG, Duren, Germany) following the manufacturer’s instructions. The final concentration of RNA of each sample was measured using a spectrophotometer (NanoDrop One, Thermo Scientific, MA, USA) and its purity was confirmed with the A260/A280 and A260/A230 ratios. RNA integrity was further validated using the Qubit™ RNA IQ Assay Kit (Invitrogen™, Thermo Fisher Scientific, MA, USA).
First-strand cDNA synthesis was produced from 1 μg of total RNA from 3 biological replicates for each treatment and time-point using the NZY First-Strand cDNA Synthesis Flexible Pack (NZYTech, Lda.—Genes and Enzymes, Lisbon, Portugal) according to the manufacturer’s instructions. Quantitative PCR gene expression analysis of two genes coding for ethylene biosynthetic enzymes, 1-AMINOCYCLOPROPANE-1-CARBOXYLIC ACID SYNTHASE1 (ACS1) and 1-AMINOCYCLOPROPANE-1-CARBOXYLIC ACID OXIDASE-HOMOLOG 1 (ACO1), the transcription factor ETHYLENE-RESPONSIVE TRANSCRIPTION FACTOR 61 (ERF061) and the auxin efflux carrier PIN-FORMED1 (PIN1), was made using NZYSpeedy qPCR Green Master Mix (2×) (NZYTech, Lda.—Genes and Enzymes, Lisbon, Portugal), following the instructions provided with 50-fold diluted cDNA template. Reactions were performed in a 96-well plate, with two technical replicates measured in CFX96 Real-Time System (Bio-Rad, CA, USA). Gene expression was normalized for both IRON SUPEROXIDE DISMUTASE, FeSOD and ACTIN, ACT reference genes [79]. All the primers (Table 2), except for PIN1 gene primers, were designed from Solanum betaceum transcript sequences obtained from embryogenic cell RNA-seq libraries (unpublished data), using the NCBI primer design tool. PIN1 gene primers were designed from the reference sequence of Solanum lycopersicum (NM_001247234.2) after the selection of conserved coding regions based on the alignment of Solanum sp. sequences (S. lycopersicum; S. pennellii, XM_015212230.2 and S. tuberosum, XM_006341465.2). The relative expression was calculated according to the Pfaffl method [80], using non-treated explants as a control for each timepoint.

4.4. Rooting and Acclimatization

Tamarillo shoots regenerated from leaf explants with at least 1 cm were in vitro rooted in hormone-free MS medium supplemented with sucrose (0.07 M, Duchefa), plant agar (0.7%, w/v, Duchefa) and pH adjusted to 5.7 before autoclaving at 121 °C for 20 min. After 1 month, rooting percentage ((number of shoots with roots/number of initial shoots) × 100) for each treatment was analyzed.
Plants were acclimatized in a walk-in chamber (FitoClima 10000 HP, Aralab) under 16 h photoperiod at 40 μmol m−2 s−1, 25 °C and 70% humidity. Briefly, plant roots were carefully washed to remove agar debris and placed on covered containers (70 cm³) with Siro Royal substrate (SIRO, Mira, Portugal). The cover was removed after 2 weeks, and after 1 month, the plants were transferred to individual containers (500 cm3) and the acclimatization percentage ((number of survival plants/number of initial plants) × 100) was analyzed. Plant height was evaluated after 1- and 3-months ex vitro. At the end of 3 months, dry matter percentage ((dry weight/fresh weight) × 100) was also assessed. For this purpose, 3-months acclimatized plants were carefully washed, weighted, and dried for 48 h at 70 °C.

4.5. Statistical Analysis

All data are presented as mean ± SEM and statistical analysis was performed using GraphPad Prism 9. The differences between treatments were analyzed using one-way ANOVA, followed by a Tukey’s multiple comparison test. For gene expression analysis, differences of each treatment relative to the control were analyzed by the Student’s t test.

5. Conclusions

In conclusion, our findings indicate that ethylene plays a crucial role in DNSO in ta-marillo. When ethylene action is inhibited, both the formation of organogenic callus and the regeneration of shoot-buds are reduced. These results suggest the possibility of a cyto-kinin-ethylene-auxin crosstalk that promotes callus formation and subsequent shoot re-generation. The upregulation of ERF061 suggests that ethylene can affect shoot regeneration through stress-response signaling. Additionally, the upregulation of PIN1 by ethylene supports previous reports and implies that ethylene may enhance shoot regeneration by affecting auxin distribution prior to shoot development. To enhance our comprehension of the molecular mechanisms driving the impact of ethylene on regeneration, it would be valuable to investigate the distribution and quantification of auxins, alongside other regeneration-related genes. Overall, this first approach of the ethylene effect on in vitro regeneration of tamarillo sheds light on the possible molecular mechanisms involved in the induced shoot regeneration of woody species.

Author Contributions

Conceptualization, M.N., S.C. and J.C.; methodology, M.N., S.C. and J.C.; validation, M.N., S.C. and J.C.; formal analysis, M.N.; investigation, M.N.; resources, S.C. and J.C.; data curation, M.N. and S.C.; writing—original draft preparation, M.N.; writing—review and editing, M.N., S.C. and J.C.; visualization, M.N., S.C. and J.C.; supervision, S.C. and J.C.; funding acquisition, S.C. and J.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was carried out at the R&D Unit Centre for Functional Ecology—Science for People and the Planet (UIDB/04004/2020), financed by FCT/MCTES through national funds (PIDDAC). This work was made in the scope of P2020|COMPETE grant number PTDC/BAA-AGR/32265/2017, project BP4BP – Tamarillo breeding: better plants for better products. European Regional Development Fund (ERDF), through the COMPETE 2020—Operational Programme for Competitiveness, and Internationalization; Portuguese national funds via FCT—Fundaçaão para a Ciência e a Tecnologia, I.P. SFRH/BD/123702/2016, UIDB/04539/2020 and UIDP/04539/2020. The Foundation for Science and Technology (Portugal) supported Mariana Neves’s PhD fellowship (2020.05137.BD).

Data Availability Statement

The original contributions presented in the study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Dubois, M.; Van den Broeck, L.; Inze, D. The pivotal role of ethylene in plant growth. Trends Plant. Sci. 2018, 23, 311–323. [Google Scholar] [CrossRef] [PubMed]
  2. Ruzicka, K.; Ljung, K.; Vanneste, S.; Podhorska, R.; Beeckman, T.; Friml, J.; Benkova, E. Ethylene regulates root growth through effects on auxin biosynthesis and transport-dependent auxin distribution. Plant Cell 2007, 19, 2197–2212. [Google Scholar] [CrossRef] [PubMed]
  3. Lewis, D.R.; Negi, S.; Sukumar, P.; Muday, G.K. Ethylene inhibits lateral root development, increases IAA transport and expression of PIN3 and PIN7 auxin efflux carriers. Development 2011, 138, 3485–3495. [Google Scholar] [CrossRef] [PubMed]
  4. Feng, Y.; Xu, P.; Li, B.; Li, P.; Wen, X.; An, F.; Gong, Y.; Xin, Y.; Zhu, Z.; Wang, Y.; et al. Ethylene promotes root hair growth through coordinated EIN3/EIL1 and RHD6/RSL1 activity in Arabidopsis. Proc. Natl. Acad. Sci. USA 2017, 114, 13834–13839. [Google Scholar] [CrossRef] [PubMed]
  5. Qiu, Y.; Tao, R.; Feng, Y.; Xiao, Z.; Zhang, D.; Peng, Y.; Wen, X.; Wang, Y.; Guo, H. EIN3 and RSL4 interfere with an MYB-bHLH-WD40 complex to mediate ethylene-induced ectopic root hair formation in Arabidopsis. Proc. Natl. Acad. Sci. USA 2021, 118, e2110004118. [Google Scholar] [CrossRef]
  6. Chen, H.; Bullock, D.A., Jr.; Alonso, J.M.; Stepanova, A.N. To fight or to grow: The balancing role of ethylene in plant abiotic stress responses. Plants 2022, 11, 33. [Google Scholar] [CrossRef]
  7. Jasrotia, S.; Jastoria, R. Role of ethylene in combating biotic stress. In Ethylene in Plant Biology, 1st ed.; Volume, 1, Singh, S., Husain, T., Singh, V.P., Tripathi, D.K., Prasad, S.M., Dubey, N.K., Eds.; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2022; pp. 388–397. [Google Scholar]
  8. Fatma, M.; Asgher, M.; Iqbal, N.; Rasheed, F.; Sehar, Z.; Sofo, A.; Khan, N.A. Ethylene signaling under stressful environments: Analyzing collaborative knowledge. Plants 2022, 11, 2211. [Google Scholar] [CrossRef]
  9. Duclercq, J.; Sangwan-Norreel, B.; Catterou, M.; Sangwan, R.S. De novo shoot organogenesis: From art to science. Trends Plant Sci. 2011, 16, 597–606. [Google Scholar] [CrossRef]
  10. Ikeuchi, M.; Ogawa, Y.; Iwase, A.; Sugimoto, K. Plant regeneration: Cellular origins and molecular mechanisms. Development 2016, 143, 1442–1451. [Google Scholar] [CrossRef]
  11. Shin, J.; Bae, S.; Seo, P.J. De novo shoot organogenesis during plant regeneration. J. Exp. Bot. 2020, 71, 63–72. [Google Scholar] [CrossRef]
  12. Ikeuchi, M.; Favero, D.S.; Sakamoto, Y.; Iwase, A.; Coleman, D.; Rymen, B.; Sugimoto, K. Molecular mechanisms of plant regeneration. Annu. Rev. Plant. Biol. 2019, 70, 3.1–3.30. [Google Scholar] [CrossRef] [PubMed]
  13. Ikeuchi, M.; Iwase, A.; Rymen, B.; Lambolez, A.; Kojima, M.; Takebayashi, Y.; Heyman, J.; Watanabe, S.; Seo, M.; De Veylder, L.; et al. Wounding triggers callus formation via dynamic hormonal and transcriptional changes. Plant Physiol. 2017, 175, 1158–1174. [Google Scholar] [CrossRef] [PubMed]
  14. Boller, T.; Kende, H. Regulation of wound ethylene synthesis in plants. Nature 1980, 286, 259–260. [Google Scholar] [CrossRef]
  15. Chae, H.S.; Faure, F.; Kieber, J.J. The eto1, eto2, and eto3 mutations and cytokinin treatment increase ethylene biosynthesis in Arabidopsis by increasing the stability of ACS protein. Plant Cell 2003, 15, 545–559. [Google Scholar] [CrossRef]
  16. Hansen, M.; Chae, H.S.; Kieber, J.J. Regulation of ACS protein stability by cytokinin and brassinosteroid. Plant J. 2009, 57, 606–614. [Google Scholar] [CrossRef]
  17. Tsuchisaka, A.; Theologis, A. Unique and overlapping expression patterns among the Arabidopsis 1-amino-cyclopropane-1-carboxylate synthase gene family members. Plant. Physiol. 2004, 136, 2982–3000. [Google Scholar] [CrossRef]
  18. Sang, Y.L.; Cheng, Z.J.; Zhang, X.S. Plant stem cells and de novo organogenesis. New Phytol. 2018, 218, 1334–1339. [Google Scholar] [CrossRef]
  19. Xu, L.; Huang, H. Genetic and epigenetic controls of plant regeneration. Curr. Top. Dev. Biol. 2014, 108, 1–33. [Google Scholar] [CrossRef]
  20. Neves, M.; Correia, S.; Cavaleiro, C.; Canhoto, J. Modulation of organogenesis and somatic embryogenesis by ethylene: An overview. Plants 2021, 10, 1208. [Google Scholar] [CrossRef]
  21. Amor, M.B.; Guis, M.; Latché, A.; Bouzayen, M.; Pech, J.C.; Roustan, J.P. Expression of an antisense 1-aminocyclopropane-1-carboxylate oxidase gene stimulates shoot regeneration in Cucumis melo. Plant Cell Rep. 1998, 17, 586–589. [Google Scholar] [CrossRef]
  22. Roustan, J.-P.; Latche, A.; Fallot, J. Enhancement of shoot regeneration from cotyledons of Cucumis melo by AgNO3, an inhibitor of ethylene action. J. Plant Physiol. 1992, 140, 485–488. [Google Scholar] [CrossRef]
  23. Paa, E.-C.; Chi, G.-L. De novo shoot morphogenesis and plant growth of mustard (Brassica juncea) in vitro in relation to ethylene. Physiol. Plant. 1993, 88, 467–474. [Google Scholar] [CrossRef]
  24. Paladi, R.K.; Rai, A.N.; Penna, S. Silver nitrate modulates organogenesis in Brassica juncea (L.) through differential antioxidant defense and hormonal gene expression. Sci. Hortic. 2017, 226, 261–267. [Google Scholar] [CrossRef]
  25. Trujillo-Moya, C.; Gisbert, C. The influence of ethylene and ethylene modulators on shoot organogenesis in tomato. Plant Cell Tissue Organ. Cult. 2012, 111, 41–48. [Google Scholar] [CrossRef]
  26. Chatfield, S.P.; Raizada, M.N. Ethylene and shoot regeneration: hookless1 modulates de novo shoot organogenesis in Arabidopsis thaliana. Plant Cell Rep. 2008, 27, 655–666. [Google Scholar] [CrossRef] [PubMed]
  27. Zheng, Q.; Zheng, Y.; Perry, S.E. AGAMOUS-Like15 promotes somatic embryogenesis in Arabidopsis and soybean in part by the control of ethylene biosynthesis and response. Plant Physiol. 2013, 161, 2113–2127. [Google Scholar] [CrossRef] [PubMed]
  28. Xie, Z.; Nolan, T.M.; Jiang, H.; Yin, Y. AP2/ERF transcription factor regulatory networks in hormone and abiotic stress responses in Arabidopsis. Front Plant Sci. 2019, 10, 228. [Google Scholar] [CrossRef]
  29. Muller, M.; Munne-Bosch, S. Ethylene response factors: A key regulatory hub in hormone and stress signaling. Plant Physiol. 2015, 169, 32–41. [Google Scholar] [CrossRef]
  30. Mantiri, F.R.; Kurdyukov, S.; Lohar, D.P.; Sharopova, N.; Saeed, N.A.; Wang, X.D.; Vandenbosch, K.A.; Rose, R.J. The transcription factor MtSERF1 of the ERF subfamily identified by transcriptional profiling is required for somatic embryogenesis induced by auxin plus cytokinin in Medicago truncatula. Plant Physiol. 2008, 146, 1622–1636. [Google Scholar] [CrossRef]
  31. Murillo-Gómez, P.A.; Hoyos, R.S.; Chavarriaga, P. Organogenesis in-vitro using three tissues types of tree tomato [Solanum betaceum (Cav.)]. Agron. Colomb. 2017, 35, 5–11. [Google Scholar] [CrossRef]
  32. Obando, M.; Jordan, M. Regenerative responses of Cyphomandra betacea (Cav.) sendt. (tamarillo) cultivated in vitro. Acta Hortic. 2001, 560, 429–432. [Google Scholar] [CrossRef]
  33. Puga, A.P. Desenvolvimento de Biorreatores para a Propagação de Solanum Betaceum Cav. Master’s Thesis, University of Coimbra, Coimbra, Portugal, 2019. [Google Scholar]
  34. Santos, A.L. Estudos de Organogénese em Cyphomandra betacea (Cav.) Sendt. Master’s Thesis, University of Porto, Porto, Portugal, 2012. [Google Scholar]
  35. Canhoto, J.; Lopes, M.; Cruz, G. Protocol of somatic embryogenesis: Tamarillo (Cyphomandra betacea (Cav.) Sendt). In Protocols for Somatic Embryogenesis in Woody Plants; Jain, S., Gupta, P., Eds.; Springer: Cham, Switzerland, 2005; Volume 77, pp. 379–389. [Google Scholar]
  36. Correia, S.; Canhoto, J.M. Somatic embryogenesis of tamarillo (Solanum betaceum Cav.). In Step Wise Protocols for Somatic Embryogenesis of Important Woody Plants; Jain, S., Gupta, P., Eds.; Springer: Cham, Switzerland, 2018; Volume 85, pp. 171–179. [Google Scholar]
  37. Correia, S.; Lopes, M.L.; Canhoto, J.M. Somatic embryogenesis induction system for cloning an adult Cyphomandra betacea (Cav.) Sendt. (tamarillo). Trees 2011, 25, 1009–1020. [Google Scholar] [CrossRef]
  38. Corredoira, E.; Merkle, S.A.; Martínez, M.T.; Toribio, M.; Canhoto, J.M.; Correia, S.I.; Ballester, A.; Vieitez, A.M. Non-zygotic embryogenesis in hardwood species. Crit Rev. Plant Sci. 2019, 38, 29–97. [Google Scholar] [CrossRef]
  39. Vincent, C.; Munné-Bosch, S. Ethylene in the regulation of major biotechnological processes. In The Plant Hormone Ethylene—Stress Acclimation and Agricultural Applications, 1st ed.; Khan, N.A., Ferrante, A., Munné-Bosch, S., Eds.; Academic Press: Cambridge, MA, USA, 2023; Volume 1, pp. 89–105. [Google Scholar]
  40. Dimasi-Theriou, K.; Economou, A.S.; Sfakiotakis, E.M. Promotion of petunia (Petunia hybrida L.) regeneration in vitro by ethylene. Plant Cell Tissue Organ. Cult. 1993, 32, 219–225. [Google Scholar] [CrossRef]
  41. Long, Y.; Yang, Y.; Pan, G.; Shen, Y. New isights into tissue culture plant-regeneration mechanisms. Front Plant. Sci. 2022, 13, 926752. [Google Scholar] [CrossRef] [PubMed]
  42. Shin, J.; Seo, P.J. Varying auxin levels induce distinct pluripotent states in callus cells. Front Plant Sci. 2018, 9, 1653. [Google Scholar] [CrossRef]
  43. Zhai, N.; Xu, L. Pluripotency acquisition in the middle cell layer of callus is required for organ regeneration. Nat. Plants 2021, 7, 1453–1460. [Google Scholar] [CrossRef]
  44. O’Donnell, P.J.; Calvert, C.; Atzorn, R.; Wasternack, C.; Leyser, H.M.O.; Bowles, D.J. Ethylene as a signal mediating the wound response of tomato plants. Science 1996, 274, 1914–1917. [Google Scholar] [CrossRef]
  45. Suttle, J.C. Cytokinin-induced ethylene biosynthesis in nonsenescing cotton leaves. Plant Physiol. 1986, 82, 930–935. [Google Scholar] [CrossRef]
  46. Hyodo, H.; Tanaka, K.; Suzuki, T. Wound-induced ethylene synthesis and its involvement in enzyme induction in mesocarp tissue of Cucurbita maxima. Postharvest Biol. Technol. 1991, 1, 127–136. [Google Scholar] [CrossRef]
  47. Ke, D.; Saltveit, M.E.J. Wound-induced ethylene production, phenolic metabolism and susceptibility to russet spotting in iceberg lettuce. Physiol. Plant. 1989, 76, 412–418. [Google Scholar] [CrossRef]
  48. Watanabe, T.; Seo, S.; Sakai, S. Wound-induced expression of a gene for 1-aminocyclopropane-1-carboxylate synthase and ethylene production are regulated by both reactive oxygen species and jasmonic acid in Cucurbita maxima. Plant Physiol. Biochem. 2001, 39, 121–127. [Google Scholar] [CrossRef]
  49. Li, W.; Nishiyama, R.; Watanabe, Y.; Van Ha, C.; Kojima, M.; An, P.; Tian, L.; Tian, C.; Sakakibara, H.; Tran, L.-S.P. Effects of overproduced ethylene on the contents of other phytohormones and expression of their key biosynthetic genes. Plant Physiol. Biochem. 2018, 128, 170–177. [Google Scholar] [CrossRef] [PubMed]
  50. Salman-Minkov, A.; Levi, A.; Wolf, S.; Trebitsh, T. ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin. Plant Cell Physiol. 2008, 49, 740–750. [Google Scholar] [CrossRef] [PubMed]
  51. Swarup, R.; Perry, P.; Hagenbeek, D.; Van Der Straeten, D.; Beemster, G.T.; Sandberg, G.; Bhalerao, R.; Ljung, K.; Bennett, M.J. Ethylene upregulates auxin biosynthesis in Arabidopsis seedlings to enhance inhibition of root cell elongation. Plant Cell 2007, 19, 2186–2196. [Google Scholar] [CrossRef] [PubMed]
  52. Shi, X.; Gupta, S.; Lindquist, I.E.; Cameron, C.T.; Mudge, J.; Rashotte, A.M. Transcriptome analysis of cytokinin response in tomato leaves. PLoS ONE 2013, 8, e55090. [Google Scholar] [CrossRef]
  53. Shin, S.Y.; Choi, Y.; Kim, S.-G.; Park, S.-J.; Park, J.-S.; Moon, K.-B.; Kim, H.-S.; Jeon, J.H.; Cho, H.S.; Lee, H.-J. Submergence promotes auxin-induced callus formation through ethylene-mediated post-transcriptional control of auxin receptors. Mol. Plant 2022, 15, 1947–1961. [Google Scholar] [CrossRef]
  54. Lardon, R.; Wijnker, E.; Keurentjes, J.; Geelen, D. The genetic framework of shoot regeneration in Arabidopsis comprises master regulators and conditional fine-tuning factors. Commun. Biol. 2020, 3, 549. [Google Scholar] [CrossRef]
  55. Iwase, A.; Kondo, Y.; Laohavisit, A.; Takebayashi, A.; Ikeuchi, M.; Matsuoka, K.; Asahina, M.; Mitsuda, N.; Shirasu, K.; Fukuda, H.; et al. WIND transcription factors orchestrate wound-induced callus formation, vascular reconnection and defense response in Arabidopsis. New Phytol. 2021, 232, 734–752. [Google Scholar] [CrossRef]
  56. Iwase, A.; Mita, K.; Nonaka, S.; Ikeuchi, M.; Koizuka, C.; Ohnuma, M.; Ezura, H.; Imamura, J.; Sugimoto, K. WIND1-based acquisition of regeneration competency in Arabidopsis and rapeseed. J. Plant Res. 2015, 128, 389–397. [Google Scholar] [CrossRef]
  57. Amrhein, N.; Wenker, D. Novel inhibitors of ethylene production in higher plants. Plant Cell Physiol. 1979, 20, 1635–1642. [Google Scholar] [CrossRef]
  58. Yu, Y.B.; Yang, S.F. Auxin-induced ethylene production and its inhibition by aminoethoxyvinyiglycine and cobalt ion. Plant Physiol. 1979, 64, 1074–1077. [Google Scholar] [CrossRef] [PubMed]
  59. Binder, B.M.; Rodriguez, F.I.; Bleecker, A.B.; Patterson, S.E. The effects of Group 11 transition metals, including gold, on ethylene binding to the ETR1 receptor and growth of Arabidopsis thaliana. FEBS Lett. 2007, 581, 5105–5109. [Google Scholar] [CrossRef]
  60. Wang, C.; Li, W.; Chen, F.; Cheng, Y.; Huang, X.; Zou, B.; Wang, Y.; Xu, W.; Qu, S. Genome-wide identification and characterization of members of the ACS gene family in Cucurbita maxima and their transcriptional responses to the specific treatments. Int. J. Mol. Sci. 2022, 23, 8476. [Google Scholar] [CrossRef] [PubMed]
  61. He, J.; Feng, Y.; Cheng, Y.; Guan, J. Effects of preharvest aminoethoxyvinylglycine (AVG) treatment on fruit ripening, core browning and related gene expression in ‘Huangguan’ pear (Pyrus bretschneideri Rehd.). Horticulturae 2023, 9, 179. [Google Scholar] [CrossRef]
  62. Yuan, H.; Yue, P.; Bu, H.; Han, D.; Wang, A. Genome-wide analysis of ACO and ACS genes in pear (Pyrus ussuriensis). Vitr. Cell. Dev. Biol. Plant 2019, 56, 193–199. [Google Scholar] [CrossRef]
  63. Wang, Z.; Yadav, V.; Yan, X.; Cheng, D.; Wei, C.; Zhang, X. Systematic genome-wide analysis of the ethylene-responsive ACS gene family: Contributions to sex form differentiation and development in melon and watermelon. Gene 2021, 805, 145910. [Google Scholar] [CrossRef]
  64. Jones, M.L. Ethylene biosynthetic genes are differentially regulated by ethylene and ACC in carnation styles. Plant Growth Regul. 2002, 40, 129–138. [Google Scholar] [CrossRef]
  65. Coppola, M.; Diretto, G.; Digilio, M.C.; Woo, S.L.; Giuliano, G.; Molisso, D.; Pennacchio, F.; Lorito, M.; Rao, R. Transcriptome and metabolome reprogramming in tomato plants by Trichoderma harzianum strain T22 primes and enhances defense responses against aphids. Front Physiol. 2019, 10, 745. [Google Scholar] [CrossRef]
  66. Chahel, A.A.; Yousaf, Z.; Zeng, S.; Li, Y.; Ying, W. Growth and physiological alterations related to root-specific gene function of LrERF061-OE in Glycyrrhiza uralensis Fisch. hairy root clones under cadmium stress. Plant Cell Tissue Organ Cult. 2019, 140, 115–127. [Google Scholar] [CrossRef]
  67. Choi, H.R.; Baek, M.W.; Jeong, C.S.; Tilahun, S. Comparative transcriptome analysis of softening and ripening-related genes in kiwifruit cultivars treated with ethylene. Curr. Issues Mol. Biol. 2022, 44, 2593–2613. [Google Scholar] [CrossRef] [PubMed]
  68. Yang, X.; Chen, L.; Yang, Y.; Guo, X.; Chen, G.; Xiong, X.; Dong, D.; Li, G. Transcriptome analysis reveals that exogenous ethylene activates immune and defense responses in a high late blight resistant potato genotype. Sci. Rep. 2020, 10, 21294. [Google Scholar] [CrossRef] [PubMed]
  69. Zhu, P.; Chen, Y.; Zhang, J.; Wu, F.; Wang, X.; Pan, T.; Wei, Q.; Hao, Y.; Chen, X.; Jiang, C.; et al. Identification, classification, and characterization of AP2/ERF superfamily genes in Masson pine (Pinus massoniana Lamb.). Sci. Rep. 2021, 11, 5441. [Google Scholar] [CrossRef] [PubMed]
  70. Jiang, Q.; Wang, Z.; Hu, G.; Yao, X. Genome-wide identification and characterization of AP2/ERF gene superfamily during flower development in Actinidia eriantha. BMC Genom. 2022, 23, 650. [Google Scholar] [CrossRef] [PubMed]
  71. Gordon, S.P.; Heisler, M.G.; Reddy, G.V.; Ohno, C.; Das, P.; Meyerowitz, E.M. Pattern formation during de novo assembly of the Arabidopsis shoot meristem. Development 2007, 134, 3539–3548. [Google Scholar] [CrossRef] [PubMed]
  72. González, A.; Arigita, L.; Majada, J.; Sánchez Tamés, R. Ethylene involvement in in vitro organogenesis and plant growth of Populus tremula L. Plant Growth Regul. 1997, 22, 1–6. [Google Scholar] [CrossRef]
  73. Žiauka, J.; Kuusienė, S.; Šilininkas, M. Fast growing aspens in the development of a plant micropropagation system based on plant-produced ethylene action. Biomass Bioenergy 2013, 53, 20–28. [Google Scholar] [CrossRef]
  74. Iqbal, N.; Khan, N.A.; Ferrante, A.; Trivellini, A.; Francini, A.; Khan, M.I.R. Ethylene role in plant growth, development and senescence: Interaction with other phytohormones. Front. Plant Sci. 2017, 8, 475. [Google Scholar] [CrossRef]
  75. Lyu, J.; Wu, Y.; Jin, X.; Tang, Z.; Liao, W.; Dawuda, M.M.; Hu, L.; Xie, J.; Yu, J.; Calderon-Urrea, A. Proteomic analysis reveals key proteins involved in ethylene-induced adventitious root development in cucumber (Cucumis sativus L.). PeerJ 2021, 9, e10887. [Google Scholar] [CrossRef]
  76. Negi, S.; Sukumar, P.; Liu, X.; Cohen, J.D.; Muday, G.K. Genetic dissection of the role of ethylene in regulating auxin-dependent lateral and adventitious root formation in tomato. Plant J. 2010, 61, 3–15. [Google Scholar] [CrossRef]
  77. Qi, X.; Li, Q.; Ma, X.; Qian, C.; Wang, H.; Ren, N.; Shen, C.; Huang, S.; Xu, X.; Xu, Q.; et al. Waterlogging-induced adventitious root formation in cucumber is regulated by ethylene and auxin through reactive oxygen species signalling. Plant Cell Environ. 2019, 42, 1458–1470. [Google Scholar] [CrossRef] [PubMed]
  78. Murashige, T.; Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
  79. Cordeiro, D.; Rito, M.; Borges, F.; Canhoto, J.; Correia, S. Selection and validation of reference genes for qPCR analysis of miRNAs and their targets during somatic embryogenesis in tamarillo (Solanum betaceum Cav.). Plant Cell Tissue Organ. Cult. 2020, 143, 109–120. [Google Scholar] [CrossRef]
  80. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, E45. [Google Scholar] [CrossRef] [PubMed]
Plants 12 01854 g001 550
Figure 1. Ethylene availability enhances shoot-bud regeneration from leaf explants in tamarillo. (a) Schematic representation of the compounds used in this study and their role in ethylene biosynthesis, signaling and perception. (b) A schematic overview of the experimental set-up for shoot regeneration. Regeneration was induced from leaf explants in the dark, in the presence of 10 µM of each different modulator (AgNO3, AVG, ACC and ETH). After 3 weeks of culture, the explants were transferred to a 16 h photoperiod. At the end of the 8th week of culture, regeneration percentage and the number of buds and shoots induced were analyzed. (c) Bud and shoot regeneration after 8 weeks of culture in the different treatments. i–x: scale bars, 1 mm. xi: scale bar, 1 cm. (d) Explants after 3 (top) and 8 (bottom) weeks of culture. Scale bars, 1 cm.
Figure 1. Ethylene availability enhances shoot-bud regeneration from leaf explants in tamarillo. (a) Schematic representation of the compounds used in this study and their role in ethylene biosynthesis, signaling and perception. (b) A schematic overview of the experimental set-up for shoot regeneration. Regeneration was induced from leaf explants in the dark, in the presence of 10 µM of each different modulator (AgNO3, AVG, ACC and ETH). After 3 weeks of culture, the explants were transferred to a 16 h photoperiod. At the end of the 8th week of culture, regeneration percentage and the number of buds and shoots induced were analyzed. (c) Bud and shoot regeneration after 8 weeks of culture in the different treatments. i–x: scale bars, 1 mm. xi: scale bar, 1 cm. (d) Explants after 3 (top) and 8 (bottom) weeks of culture. Scale bars, 1 cm.
Plants 12 01854 g001
Plants 12 01854 g002 550
Figure 2. Effect of the different modulators on gene expression of ACS1, ACO1, ERF061 and PIN1 at two selected culture timepoints. (a) A schematic overview of the experimental set-up for the analysis of gene expression. Samples from control, AgNO3, AVG, ACC and ETH conditions were collected at the 3rd and 8th week of culture. Only explant sites with regeneration responses were collected, as shown by the dashed lines. (b–e) Fold-relative gene expression compared to each control condition (represented as zero with dashed line). Data are represented as mean ± SEM (n = 3). Asterisks indicate statistically significant differences between treatments and control (Student’s t test, * p < 0.05, ** p < 0.01 and *** p < 0.001).
Figure 2. Effect of the different modulators on gene expression of ACS1, ACO1, ERF061 and PIN1 at two selected culture timepoints. (a) A schematic overview of the experimental set-up for the analysis of gene expression. Samples from control, AgNO3, AVG, ACC and ETH conditions were collected at the 3rd and 8th week of culture. Only explant sites with regeneration responses were collected, as shown by the dashed lines. (b–e) Fold-relative gene expression compared to each control condition (represented as zero with dashed line). Data are represented as mean ± SEM (n = 3). Asterisks indicate statistically significant differences between treatments and control (Student’s t test, * p < 0.05, ** p < 0.01 and *** p < 0.001).
Plants 12 01854 g002
Plants 12 01854 g003 550
Figure 3. Rooting and acclimatization of regenerated shoots induced in each treatment. (a) A schematic overview of the experimental set-up for rooting and acclimatization assays. Shoots were in vitro rooted in hormone-free MS medium (sucrose, 3%, w/v) without modulators. After 1 month of culture, shoots were analyzed and rooted plants were acclimatized. (b) Shoots regenerated from each condition after 1 month in hormone-free MS medium. Scale bars, 1 cm. (c) Rooting percentage and morphological parameters after 1 month in hormone-free MS medium. (d) Acclimatization percentage and physiological parameters after 1- and 3-months ex vitro. (e) Acclimatized plants regenerated from control, ACC and ETH conditions after 1 month ex vitro. Scale bars, 5 cm. (f) Acclimatized plants after 3 months ex vitro. Scale bars, 5 cm. For rooting rate, in vitro parameters and acclimatization rate, data are represented as mean ± SEM of three biological replicates (n = 3, N = 6 shoots or plants per replicate). For ex vitro parameters, data are represented as mean ± SEM (n = 6 plants per condition). Letters indicate statistically significant differences between treatments (one-way ANOVA with Tukey multiple comparison test, p < 0.05).
Figure 3. Rooting and acclimatization of regenerated shoots induced in each treatment. (a) A schematic overview of the experimental set-up for rooting and acclimatization assays. Shoots were in vitro rooted in hormone-free MS medium (sucrose, 3%, w/v) without modulators. After 1 month of culture, shoots were analyzed and rooted plants were acclimatized. (b) Shoots regenerated from each condition after 1 month in hormone-free MS medium. Scale bars, 1 cm. (c) Rooting percentage and morphological parameters after 1 month in hormone-free MS medium. (d) Acclimatization percentage and physiological parameters after 1- and 3-months ex vitro. (e) Acclimatized plants regenerated from control, ACC and ETH conditions after 1 month ex vitro. Scale bars, 5 cm. (f) Acclimatized plants after 3 months ex vitro. Scale bars, 5 cm. For rooting rate, in vitro parameters and acclimatization rate, data are represented as mean ± SEM of three biological replicates (n = 3, N = 6 shoots or plants per replicate). For ex vitro parameters, data are represented as mean ± SEM (n = 6 plants per condition). Letters indicate statistically significant differences between treatments (one-way ANOVA with Tukey multiple comparison test, p < 0.05).
Plants 12 01854 g003
Table
Table 1. Effect of ethylene modulators on regeneration percentage and number of buds and shoots per explant after 8 weeks.
Table 1. Effect of ethylene modulators on regeneration percentage and number of buds and shoots per explant after 8 weeks.
TreatmentRegeneration Percentage (%)No of Buds and Shoots
per Explant		Observations
Control73.61 ± 6.05 a12.21 ± 1.19 bPresence of well-developed and elongated shoots with fully opened leaves.
AgNO365.28 ± 6.05 a6.36 ± 1.18 cShoots not completely developed nor elongated. Some leaves were fully open but presented abnormal shape.
AVG48.61 ± 1.39 a6.40 ± 1.16 cShoots neither developed nor elongated. Some leaves were fully opened.
ACC66.67 ± 6.37 a 19.09 ± 1.03 aPresence of well-developed and elongated shoots with fully opened leaves.
ETH58.33 ± 6.37 a18.00 ± 1.29 aPresence of well-developed and elongated shoots with fully opened leaves.
For regeneration percentage data are represented as mean ± SEM of three biological replicates (n = 3, N = 24 explants per replicate). For number of buds and shoots data are represented as mean ± SEM of three replicates (n = 3, 15 < N < 20 explants analyzed per replicate for control, 13 < N < 18 for AgNO3, 11 < N < 12 for AVG, 13 < N < 18 for ACC, 12 < N < 17 for ETH). Letters indicate statistically significant differences between treatments (one-way ANOVA with Tukey multiple comparison test, p < 0.05).
Table
Table 2. Primer pairs used for gene expression analysis.
Table 2. Primer pairs used for gene expression analysis.
GeneForward PrimerReverse Primer
ACO1GCTAACTCTTGGAGCTGGCAGCCACTACTCTGTGTGCAGT
ACSTCCACAGTGAATCCCATTTTGATGGCTTAGCTTTGTTCTTTGTTGT
ACTCCATGTTCCCGGGTATTGCTGTGCTGAGGGAAGCCAAGAT
ERF061TCTTCGCGATCCAAGCAAGTACCACCACCAACCAAAGAAGA
FeSODTCACCATCGACGTTTGGGAGGACTGCTTCCCATGACACCA
PIN1ACCAAGGATCATAGCATGTGGACTTGTGGTAGAGCTGCCTGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Neves, M.; Correia, S.; Canhoto, J. Ethylene Inhibition Reduces De Novo Shoot Organogenesis and Subsequent Plant Development from Leaf Explants of Solanum betaceum Cav. Plants 2023, 12, 1854. https://doi.org/10.3390/plants12091854

AMA Style

Neves M, Correia S, Canhoto J. Ethylene Inhibition Reduces De Novo Shoot Organogenesis and Subsequent Plant Development from Leaf Explants of Solanum betaceum Cav. Plants. 2023; 12(9):1854. https://doi.org/10.3390/plants12091854

Chicago/Turabian Style

Neves, Mariana, Sandra Correia, and Jorge Canhoto. 2023. "Ethylene Inhibition Reduces De Novo Shoot Organogenesis and Subsequent Plant Development from Leaf Explants of Solanum betaceum Cav." Plants 12, no. 9: 1854. https://doi.org/10.3390/plants12091854

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop