The Protective Effect of Exogenous Ascorbic Acid on Photosystem Inhibition of Tomato Seedlings Induced by Salt Stress
Abstract
:1. Introduction
2. Results
2.1. PSI and PSII Activity Levels
2.2. The Allocation of Absorbed Light Engery between PSI and PSII
2.3. PSII Electron Flux Distributions
2.4. CEF-PSI Analyses
2.5. ROS Metabolism and Oxidative Damage Analyses
2.6. GSH Content and the GSH/GSSG Ratio
2.7. Antioxidant Enzyme Gene Expression and Activity Levels
3. Materials and Methods
3.1. Plant Materials and Treatment Conditions
3.2. Chlorophyll Fluorescence Parameters and P700 Redox State
3.3. Absorbed Light Energy Allocation Analyses
3.4. LEF and CEF Electron Flux Transport Rate Calculations
3.5. ROS Generation and Lipid-Peroxidation-Related Analyses
3.6. Antioxidant Metabolite Analyses
3.7. Antioxidant Enzyme Activity Assays
3.8. qPCR
3.9. Statistical Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hossain, M.S.; Alam, M.U.; Rahman, A.; Hasanuzzaman, M.; Nahar, K.; Mahmud, J.A.; Fujita, M. Use of iso-osmotic solution to understand salt stress responses in lentil (Lens culinaris Medik.). S. Afr. J. Bot. 2017, 113, 346–354. [Google Scholar] [CrossRef]
- Bailey-Serres, J.; Parker, J.E.; Ainsworth, E.A.; Oldroyd, G.E.D.; Schroeder, J.I. Genetic strategies for improving crop yields. Nature 2019, 575, 109–118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.; Huang, R. Modulation of ethylene and ascorbic acid on reactive oxygen species scavenging in plant salt response. Front. Plant Sci. 2019, 10, 319. [Google Scholar] [CrossRef] [Green Version]
- Mushtaq, Z.; Faizan, S.; Gulzar, B. Salt stress, its impacts on plants and the strategies plants are employing against it: A review. J. Appl. Biol. Biotechnol. 2020, 8, 81–91. [Google Scholar] [CrossRef]
- Wada, M. Chloroplast movement. Plant Sci. 2013, 9, 177–182. [Google Scholar] [CrossRef]
- Allen, J.F. Plastoquinone redox control of chloroplast thylakoid protein phosphorylation and distribution of excitation energy between photosystems: Discovery, background, implications. Photosynth. Res. 2002, 73, 139. [Google Scholar] [CrossRef]
- Chen, H.X.; An, S.Z.; Li, W.J.; Gao, H.Y.; Zou, Q. Enhancement of the mehler-peroxidase reaction in salt-stressed Rumex K-1 leaves. J. Integr. Plant Biol. 2004, 46, 811–818. [Google Scholar]
- Pinnola, A.; Bassi, R. Molecular mechanisms involved in plant photoprotection. Biochem. Soc. Trans. 2018, 46, 467–482. [Google Scholar] [CrossRef]
- Huang, W.; Fu, P.L.; Jiang, Y.J.; Zhang, J.L.; Zhang, S.B.; Hu, H.; Cao, K.F. Differences in the responses of photosystem I and photosystem II of three tree species Cleistanthus sumatranus, Celtis philippensis and Pistacia weinmannifolia exposed to a prolonged drought in a tropical limestone forest. Tree Physiol. 2013, 33, 211–220. [Google Scholar] [CrossRef]
- Huang, W.; Yang, Y.J.; Hu, H.; Cao, K.F.; Zhang, S.B. Sustained diurnal stimulation of cyclic electron flow in two tropical tree species Erythrophleum guineense and Khaya ivorensis. Front. Plant Sci. 2016, 7, 1068. [Google Scholar] [CrossRef] [Green Version]
- Yi, X.P.; Zhang, Y.L.; Yao, H.S.; Zhang, X.J.; Luo, H.H.; Gou, L.; Zhang, W.F. Alternative electron sinks are crucial for conferring photoprotection in field-grown cotton under water deficit during flowering and boll setting stages. Funct. Plant Biol. 2014, 41, 737–747. [Google Scholar] [CrossRef]
- Smirnoff, N. Ascorbate biosynthesis and function in photoprotection. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2000, 355, 1455–1464. [Google Scholar] [CrossRef] [PubMed]
- Yabuta, Y.; Motoki, T.; Yoshimura, K.; Takeda, T.; Ishikawa, T.; Shigeoka, S. Thylakoid membrane-bound ascorbate peroxidase is a limiting factor of antioxidative systems under photo-oxidative stress. Plant J. 2002, 32, 915–925. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.; Liu, Y.; Tong, J.; Ding, J.; Wang, R.; Peng, C.; Xiao, L. Reduced grain chalkiness and its possible physiological mechanism in transgenic rice overexpressing L-GalLDH. Crop. J. 2015, 3, 125–134. [Google Scholar] [CrossRef] [Green Version]
- Yu, L.; Liu, Y.; Lu, L.; Zhang, Q.; Chen, Y.; Zhou, L.; Chen, H.; Peng, C. Ascorbic acid deficiency leads to increased grain chalkiness in transgenic rice for suppressed of L-GalLDH. J. Plant Physiol. 2017, 211, 13–26. [Google Scholar] [CrossRef]
- Khazaei, Z.; Estaji, A. Effect of foliar application of ascorbic acid on sweet pepper (Capsicum annuum) plants under drought stress. Acta Physiol. Plant. 2020, 42, 118. [Google Scholar] [CrossRef]
- Alayafi, A.A.M. Exogenous ascorbic acid induces systemic heat stress tolerance in tomato seedlings: Transcriptional regulation mechanism. Environ. Sci. Pollut. Res. 2020, 27, 19186–19199. [Google Scholar] [CrossRef]
- Elkelish, A.; Qari, S.H.; Mazrou, Y.S.A.; Abdelaal, K.A.A.; Hafez, Y.M.; Abu-Elsaoud, A.M.; EI-Saber Batiha, G.; EI-Esawi, M.A.; EI Nahhas, N. Exogenous ascorbic acid induced chilling tolerance in tomato plants through modulating metabolism, osmolytes, antioxidants, and transcriptional regulation of catalase and heat shock proteins. Plants 2020, 9, 431. [Google Scholar] [CrossRef] [Green Version]
- Sharma, R.; Bhardwaj, R.; Thukral, A. Oxidative stress mitigation and initiation of antioxidant and osmoprotectant responses mediated by ascorbic acid in Brassica juncea L. subjected to copper (II) stress. Ecotoxicol. Environ. Saf. 2019, 182, 109436. [Google Scholar] [CrossRef]
- Niu, J.; Chen, Z.; Yu, S.; Wang, Q. Ascorbic acid regulates nitrogen, energy, and gas exchange metabolisms of alfalfa in response to high-nitrate stress. Environ. Sci. Pollut. Res. 2022, 29, 24085–24097. [Google Scholar] [CrossRef] [PubMed]
- Billah, M.; Rohman, M.M.; Hossain, N.; Shalim Uddin, M. Exogenous ascorbic acid improved tolerance in maize (Zea mays L.) by increasing antioxidant activity under salinity stress. Afr. J. Agric. Res. 2017, 12, 1437–1446. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.; Zhou, Y.; Cong, Y.; Zhu, P.; Xing, J.; Cui, J.; Xu, W.; Shi, Q.; Diao, M.; Liu, H.Y. Ascorbic acid-induced photosynthetic adaptability of processing tomatoes to salt stress probed by fast OJIP fluorescence rise. Front. Plant Sci. 2021, 12, 1650. [Google Scholar] [CrossRef] [PubMed]
- Terashima, I.; Funayama, S.; Sonoike, K. The site of photoinhibition in leaves of Cucumis sativus L. at low temperatures is photosystem I., not photosystem II. Planta 1994, 193, 300–306. [Google Scholar] [CrossRef]
- Yang, X.; Li, Y.; Chen, H.; Huang, J.; Zhang, Y.; Qi, M.; Liu, Y.; Li, T. Photosynthetic Response Mechanism of Soil Salinity-Induced Cross-Tolerance to Subsequent Drought Stress in Tomato Plants. Plants 2020, 9, 363. [Google Scholar] [CrossRef] [Green Version]
- Barták, M.; Gloser, J.; Hájek, J. Visualized photosynthetic characteristics of the lichen Xanthoria elegans related to daily courses of light, temperature and hydration: A field study from Galindez Island, maritime Antarctica. Lichenologist 2005, 37, 433–443. [Google Scholar] [CrossRef]
- Demmig-Adams, B.; Adams, W.W., III; Barker, D.H.; Logan, B.A.; Bowling, D.R.; Verhoeven, A.S. Using chlorophyll fluorescence to assess the fraction of absorbed light allocated to thermal dissipation of excess excitation. Physiol. Plant. 1996, 98, 253–264. [Google Scholar] [CrossRef]
- Miyake, C.; Yokota, A. Determination of the rate of photoreduction of O2 in the water-water cycle in watermelon leaves and enhancement of the rate by limitation of photosynthesis. Plant Cell Physiol. 2000, 41, 335–343. [Google Scholar] [CrossRef] [Green Version]
- Sharkey, T.D.; Bernacchi, C.J.; Farquhar, G.D.; Singsaas, E.L. Fitting photosynthetic carbon dioxide response curves for C(3) leaves. Plant Cell Environ. 2007, 30, 1035–1040. [Google Scholar] [CrossRef] [PubMed]
- Krall, J.P.; Edwards, G.E. Relationship between photosystem II activity and CO2 fixation in leaves. Physiol. Plant. 1992, 86, 180–187. [Google Scholar] [CrossRef]
- Lu, T.; Yu, H.; Li, Q.; Chai, L.; Jiang, W. Improving plant growth and alleviating photosynthetic inhibition and oxidative stress from low-light stress with exogenous GR24 in tomato (Solanum lycopersicum L.) seedlings. Front. Plant Sci. 2019, 10, 490. [Google Scholar] [CrossRef]
- Hodges, D.M.; DeLong, J.M.; Forney, C.F.; Prange, R.K. Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 1999, 207, 604–611. [Google Scholar] [CrossRef]
- Yu, C.W.; Murphy, T.M.; Lin, C.H. Hydrogen peroxide-induced chilling tolerance in mung beans mediated through ABA-independent glutathione accumulation. Funct. Plant Biol. 2003, 30, 955–963. [Google Scholar] [CrossRef] [PubMed]
- Elstner, E.F.; Heupel, A. Inhibition of nitrite formation from hydroxylammoniumchloride: A simple assay for superoxide dismutase. Anal. Biochem. 1976, 70, 616–620. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Zheng, J.; Zhang, X.; Hu, Q.; Qian, R. Salicylic acid alleviates the adverse effects of salt stress on dianthus superbus (Caryophyllaceae) by activating photosynthesis, protecting morphological structure, and enhancing the antioxidant system. Front. Plant Sci. 2017, 8, 600. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thordal-Christensen, H.; Zhang, Z.; Wei, Y.; Collinge, D.B. Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley—Powdery mildew interaction. Plant J. 1997, 11, 1187–1194. [Google Scholar] [CrossRef]
- Nagalakshmi, N.; Prasad, M.N.V. Responses of glutathione cycle enzymes and glutathione metabolism to copper stress in Scenedesmus bijugatus. Plant Sci. 2001, 160, 291–299. [Google Scholar] [CrossRef]
- El-Shabrawi, H.; Kumar, B.; Kaul, T.; Reddy, M.K.; Singla-Pareek, S.L.; Sopory, S.K. Redox homeostasis, antioxidant defense, and methylglyoxal detoxification as markers for salt tolerance in Pokkali rice. Protoplasma 2010, 245, 85–96. [Google Scholar] [CrossRef]
- Cakmak, I.; Strbac, D.; Marschner, H. Activities of hydrogen peroxide-scavenging enzymes in germinating wheat seeds. J. Exp. Bot. 1993, 44, 127–132. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Hossain, M.A.; Fujita, M. Nitric oxide modulates antioxidant defense and the methylglyoxal detoxification system and reduces salinity-induced damage of wheat seedlings. Plant Biotechnol. Rep. 2011, 5, 353. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar] [CrossRef]
- Hossain, M.A.; Nakano, Y.; Asada, K. Monodehydroascorbate reductase in spinach chloroplasts and its participation in regeneration of ascorbate for scavenging hydrogen peroxide. Plant Cell Physiol. 1984, 25, 385–395. [Google Scholar] [CrossRef]
- Costa, H.; Gallego, S.M.; Tomaro, M.L. Effect of UV-B radiation on antioxidant defense system in sunflower cotyledons. Plant Sci. 2002, 162, 939–945. [Google Scholar] [CrossRef]
- Allakhverdiev, S.I.; Sakamoto, A.; Nishiyama, Y.; Inaba, M.; Murata, N. Ionic and osmotic effects of NaCl-induced inactivation of photosystems I and II in Synechococcus sp. Plant Physiol. 2000, 123, 1047–1056. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Allakhverdiev, S.I.; Sakamoto, A.; Nishiyama, Y.; Murata, N. Inactivation of photosystems I and II in response to osmotic Stress in Synechococcus. Contribution of Water Channels1. Plant Physiol. 2000, 122, 1201–1208. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Allakhverdiev, S.I.; Murata, N. Salt stress inhibits photosystems II and I in cyanobacteria. Photosynth. Res. 2008, 98, 529–539. [Google Scholar] [CrossRef]
- Takahashi, S.; Murata, N. How do environmental stresses accelerate photoinhibition? Trends Plant Sci. 2008, 13, 178–182. [Google Scholar] [CrossRef]
- Huang, W.; Zhang, S.B.; Cao, K.F. The different effects of chilling stress under moderate light intensity on photosystem II compared with photosystem I and subsequent recovery in tropical tree species. Photosynth. Res. 2010, 103, 175–182. [Google Scholar] [CrossRef]
- Talaat, N.B. Effective microorganisms: An innovative tool for inducing common bean (Phaseolus vulgaris L.) salt-tolerance by regulating photosynthetic rate and endogenous phytohormones production. Sci. Hortic. 2019, 250, 254–265. [Google Scholar] [CrossRef]
- Jia, X.M.; Wang, H.; Svetla, S.; Zhu, Y.F.; Hu, Y.; Cheng, L.; Zhao, T.; Wang, Y.X. Comparative physiological responses and adaptive strategies of apple Malus halliana to salt, alkali and saline-alkali stress. Sci. Hortic. 2019, 245, 154–162. [Google Scholar] [CrossRef]
- Elshoky, H.A.; Yotsova, E.; Farghali, M.A.; Farroh, K.Y.; El-Sayed, K.; Elzorkany, H.E.; Rashkov, G.; Dobrikova, A.; Borisova, P.; Stefanov, M.; et al. Impact of foliar spray of zinc oxide nanoparticles on the photosynthesis of Pisum sativum L. under salt stress. Plant Physiol. Biochem. 2021, 167, 607–618. [Google Scholar] [CrossRef]
- Yang, D.Y.; Ma, N.N.; Zhuang, K.Y.; Zhu, S.B.; Liu, Z.M.; Yang, X.H. Overexpression of tomato SlGGP-LIKE gene improves tobacco tolerance to methyl viologen-mediated oxidative stress. J. Plant Physiol. 2017, 209, 31–41. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Meng, X.; Yang, D.; Ma, N.; Wang, G.; Meng, Q. Overexpression of tomato GDP-l-galactose phosphorylase gene in tobacco improves tolerance to chilling stress. Plant Cell Rep. 2014, 33, 1441–1451. [Google Scholar] [CrossRef]
- Arrigoni, O.; Gara, L.D.; Paciolla, C.; Evidente, A.; Pinto, M.C.D.; Liso, R. Lycorine: A powerful inhibitor of L-galactono-γ-lactone dehydrogenase activity. J. Plant Physiol. 1997, 150, 362–364. [Google Scholar] [CrossRef]
- Nishiyama, Y.; Murata, N. Revised scheme for the mechanism of photoinhibition and its application to enhance the abiotic stress tolerance of the photosynthetic machinery. Appl. Microbiol. Biotechnol. 2014, 98, 8777–8796. [Google Scholar] [CrossRef] [PubMed]
- Cheng, X.; Fang, T.; Zhao, E.; Zheng, B.; Huang, B.; An, Y.; Zhou, P. Protective roles of salicylic acid in maintaining integrity and functions of photosynthetic photosystems for alfalfa (Medicago sativa L.) tolerance to aluminum toxicity. Plant Physiol. Biochem. 2020, 155, 570–578. [Google Scholar] [CrossRef] [PubMed]
- Quaas, T.; Berteotti, S.; Ballottari, M.; Flieger, K.; Bassi, R.; Wilhelm, C.; Goss, R. Non-photochemical quenching and xanthophyll cycle activities in six green algal species suggest mechanistic differences in the process of excess energy dissipation. J. Plant Physiol. 2015, 172, 92–103. [Google Scholar] [CrossRef]
- Li, X.; Wang, S.; Chen, X.; Cong, Y.; Cui, J.; Shi, Q.; Liu, H.; Diao, M. The positive effects of exogenous sodium nitroprusside on the plant growth, photosystem II efficiency and Calvin cycle of tomato seedlings under salt stress. Sci. Hortic. 2022, 299, 111016. [Google Scholar] [CrossRef]
- Sonoike, K. Photoinhibition of photosystem I. Physiol Plant. 2011, 142, 56–64. [Google Scholar] [CrossRef] [PubMed]
- Rochaix, J.D. Regulation and dynamics of the light-harvesting system. Annu. Rev. Plant Biol. 2014, 65, 287–309. [Google Scholar] [CrossRef]
- Lu, T.; Shi, J.W.; Sun, Z.P.; Qi, M.F.; Liu, Y.F.; Li, T.L. Response of linear and cyclic electron flux to moderate high temperature and high light stress in tomato. J. Zhejiang Univ. Sci. B 2017, 18, 635–648. [Google Scholar] [CrossRef] [Green Version]
- Jiang, Y.P.; Huang, L.F.; Cheng, F.; Zhou, Y.H.; Xia, X.J.; Mao, W.H.; Shi, K.; Yu, J.Q. Brassinosteroids accelerate recovery of photosynthetic apparatus from cold stress by balancing the electron partitioning, carboxylation and redox homeostasis in cucumber. Physiol. Plant. 2013, 148, 133–145. [Google Scholar] [CrossRef]
- Kono, M.; Noguchi, K.; Terashima, I. Roles of the cyclic electron flow around PSI (CEF-PSI) and O₂-dependent alternative pathways in regulation of the photosynthetic electron flow in short-term fluctuating light in Arabidopsis thaliana. Plant Cell Physiol. 2014, 55, 990–1004. [Google Scholar] [CrossRef] [Green Version]
- Haupt-Herting, S.; Fock, H.P. Oxygen exchange in relation to carbon assimilation in water-stressed leaves during photosynthesis. Ann. Bot. 2002, 89, 851–859. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Y.H.; Yu, J.Q.; Huang, L.F.; Nogués, S. The relationship between CO2 assimilation, photosynthetic electron transport and water–water cycle in chill-exposed cucumber leaves under low light and subsequent recovery. Plant Cell Rep. 2004, 27, 1503–1514. [Google Scholar] [CrossRef]
- Zhao, H.; Ye, L.; Wang, Y.; Zhou, X.; Yang, J.; Wang, J.; Cao, K.; Zou, Z. Melatonin increases the chilling tolerance of chloroplast in cucumber seedlings by regulating photosynthetic electron flux and the ascorbate-glutathione cycle. Front. Plant Sci. 2016, 7, 1814. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Q.; Cai, M.; Lu, L.; Gao, H.; Peng, C. Effects of endogenous ascorbic acid on the distribution of photosynthetic electron flow in rice leaves. Crop Pasture Sci. 2019, 70, 849–857. [Google Scholar] [CrossRef]
- Wei, Y.; Chen, H.; Wang, L.; Zhao, Q.; Wang, D.; Zhang, T. Cold acclimation alleviates cold stress-induced PSII inhibition and oxidative damage in tobacco leaves. Plant Signal. Behav. 2022, 17, 2013638. [Google Scholar] [CrossRef] [PubMed]
- Tan, S.L.; Yang, Y.J.; Liu, T.; Zhang, S.B.; Huang, W. Responses of photosystem I compared with photosystem II to combination of heat stress and fluctuating light in tobacco leaves. Plant Sci. 2020, 292, 110371. [Google Scholar] [CrossRef]
- Luo, Y.; Xie, Y.; He, D.; Wang, W.; Yuan, S. Exogenous trehalose protects photosystem II by promoting cyclic electron flow under heat and drought stresses in winter wheat. Plant Biol. 2021, 23, 770–776. [Google Scholar] [CrossRef]
- Yi, X.P.; Zhang, Y.L.; Yao, H.S.; Han, J.M.; Chow, W.S.; Fan, D.Y.; Zhang, W.F. Changes in activities of both photosystems and the regulatory effect of cyclic electron flow in field-grown cotton (Gossypium hirsutum L) under water deficit. J. Plant Physiol. 2018, 220, 74–82. [Google Scholar] [CrossRef] [Green Version]
- Tikkanen, M.; Rantala, S.; Aro, E.M. Electron flow from PSII to PSI under high light is controlled by PGR5 but not by PSBS. Front. Plant Sci. 2015, 6, 521. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, Y.Y.; Li, H.J.; Zhao, C.F.; Xue, J.Q.; Zhang, R.H. Exogenous melatonin improves drought tolerance in maize seedlings by regulating photosynthesis and the ascorbate–glutathione cycle. Russ. J. Plant Physiol. 2020, 67, 809–821. [Google Scholar] [CrossRef]
- Asada, K. THE WATER-WATER CYCLE IN CHLOROPLASTS: Scavenging of active oxygens and dissipation of excess photons. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999, 50, 601–639. [Google Scholar] [CrossRef] [PubMed]
- Khalid, A.M.; Nasim, A.R. Salicylic acid-mediated alleviation of cadmium toxicity in maize leaves. Plant Sci. 2014, 2, 276–281. [Google Scholar] [CrossRef]
- Shan, C.; Zhang, S.; Ou, X. The roles of H2S and H2O2 in regulating AsA-GSH cycle in the leaves of wheat seedlings under drought stress. Protoplasma 2018, 255, 1257–1262. [Google Scholar] [CrossRef]
- Jiang, D.; Lu, B.; Liu, L.; Duan, W.; Chen, L.; Li, J.; Zhang, K.; Sun, H.; Zhang, Y.; Dong, H.; et al. Exogenous melatonin improves salt stress adaptation of cotton seedlings by regulating active oxygen metabolism. PeerJ 2020, 8, e10486. [Google Scholar] [CrossRef]
- Yao, M.; Ge, W.; Zhou, Q.; Zhou, X.; Luo, M.; Zhao, Y.; Wei, B.; Ji, S. Exogenous glutathione alleviates chilling injury in postharvest bell pepper by modulating the ascorbate-glutathione (AsA-GSH) cycle. Food Chem. 2021, 352, 129458. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Diao, M.; Cui, J.X.; Chen, X.J.; Wen, Z.L.; Zhang, J.W.; Liu, H.Y. Exogenous GSH protects tomatoes against salt stress by modulating photosystem II efficiency, absorbed light allocation and H2O2-scavenging system in chloroplasts. J. Integr. Agric. 2018, 17, 2257–2272. [Google Scholar] [CrossRef] [Green Version]
- Duan, M.; Ma, N.N.; Li, D.; Deng, Y.S.; Kong, F.Y.; Lv, W.; Meng, Q.W. Antisense-mediated suppression of tomato thylakoidal ascorbate peroxidase influences anti-oxidant network during chilling stress. Plant Physiol. Biochem. 2012, 58, 37–45. [Google Scholar] [CrossRef] [PubMed]
- Heyneke, E.; Luschin-Ebengreuth, N.; Krajcer, I.; Wolkinger, V.; Müller, M.; Zechmann, B. Dynamic compartment specific changes in glutathione and ascorbate levels in Arabidopsis plants exposed to different light intensities. BMC Plant Biol. 2013, 13, 104. [Google Scholar] [CrossRef] [Green Version]
- Foyer, C.H.; Kyndt, T.; Hancock, R.D. Vitamin C in plants: Novel concepts, new perspectives, and outstanding issues. Antioxid. Redox Signal. 2020, 32, 463–485. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Xu, Q.; Huang, B. Ascorbic acid mitigation of water stress-inhibition of root growth in association with oxidative defense in tall fescue (Festuca arundinacea Schreb.). Front. Plant Sci. 2015, 6, 807. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, K.; Zhang, M.; Zhu, H.; Huang, M.; Zhu, Q.; Tang, D.; Han, X.; Li, J.; Sun, J.; Fu, J. Ascorbic acid alleviates damage from heat stress in the photosystem II of tall fescue in both the photochemical and thermal phases. Front. Plant Sci. 2017, 8, 1373. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Z.; Li, Q.; Wu, W.; Guo, J.; Yang, Y. Cadmium stress tolerance in wheat seedlings induced by ascorbic acid was mediated by NO signaling pathways. Ecotoxicol. Environ. Saf. 2017, 135, 75–81. [Google Scholar] [CrossRef]
Parameter and Formula | Explanation |
---|---|
Fv/Fm | The maximal photochemical efficiency of PSII |
Pm | The maximal P700 changes |
NPQ = (Fm − Fm′)/Fm′ | Non-photochemical quenching coefficient |
qP = (Fm′ − Fs)/(Fm′ − Fo′) | Photochemical quenching coefficient |
1–qP = (F − Fo′)/(Fm′ − Fo′) | PSII excitation pressure |
Y(II) = (Fm′ − Fs)/ Fm′ | Effective quantum yield of PSII |
Y(NPQ) = (Fs/Fm′) − (Fs/Fm) | The quantum yield of regulated non-photochemical energy dissipation of PSII |
Y(NO) = Fs/Fm | The quantum yield of non-regulated energy dissipation of PSII |
Y(I) = 1 − Y(ND) − Y(NA) | The effective quantum yield of PSI |
Y(ND) = 1 − P700red | Fraction of over P700 that is oxidized in a given state |
Y(NA) = (Pm − Pm′)/Pm | Fraction of over P700 that cannot be oxidized in a given state |
D = (1 − Fv′/Fm′) × 100% | The fraction of photon energy absorbed in PSII antennae and dissipated via thermal energy in the antenna |
p = Fv′/Fm′ × qP × 100% | The fraction of photon energy absorbed in PSII antennae utilized for photosynthetic electron transport |
Ex = Fv′/Fm′ × (1 − qP) | The estimate of the fraction of excess excitation energy that is neither dissipated in the PSII antennae nor utilized for photochemistry |
Β = 1/(1 + f) and α = f/(1 + f) f = (Fm′ − Fs)/(Fm′ − Fo′) | β and α represent the photon activity distribution coefficients of PSII and PSI, and f represents the opening degree of PSII reaction center |
β/α – 1 = (1 – f)/f | The relative deviation from full balance (β/α − 1) between PSI and PSII |
Parameter and Formula | Explanation |
---|---|
Je(PSI) = Y(II) × PPFD × 0.84 × 0.5 | Electron transport rates through PSII. The value 0.5 corresponds to the assumption that excitation is equally distributed between PSI and PSII, while 0.84 corresponds to the general absorptivity of the leaves of C3 plants. |
Je(PSII) = Y(II) × PPFD × 0.84 × 0.5 | Electron transport rates through PSI. |
VC = (Pn + RP)/[1 − pO2/(2 × Sr × Cc)] | The rate of Rubisco carboxylation. Pn represents net CO2 assimilation rate; RP represents the rate of day respiration; pO2 represents the ambient partial pressure of O2; Sr represents CO2/O2 relative specificity of RuBisCO; and Cc represents the partial pressure of CO2 at the carboxylation site. |
VO = (VC × pO2)/(Sr × Cc) | The rate of Rubisco oxygenation. |
Je(PCR) = 4 × VC | The electron flux for the photosynthetic carbon reduction (PCR) cycle. |
Je(PCO) = 4 × VO | The electron fluxes associated with photorespiration (PCO) cycle. |
Ja = Je(PSII) − Je(PCR) − Je(PCO) | Alternative PSII electron flux not utilized by the PCR or PCO cycles. |
Ja(O2-dependent) = Ja(21%O2) − Ja(2%O2) | Alternative O2-dependent electron flux. |
Ja(O2-independent) = Ja(2%O2) | Alternative O2-independent electron flux. |
Je(CEF-PSI) = Je(PSI) − Je(PSII) | Electron transport rates through CEF around PSI. |
Y(CEF) = Y(II) − Y(I) | The quantum yield of CEF around PSI. |
Y(CEF)/Y(II) = [Y(I) − Y(II)]/Y(II) | The ratio of the quantum yield of CEF around PSI to the effective quantum yield of PSII. |
Gene Name | Primer | Sequence(5′ to 3′) |
---|---|---|
Actin (NM_001323002.1) | FORWARD | TGACTACGAGCAGGAACTTGAAACC |
REVERSE | AACGGAACCTCTCAGCACCAATG | |
SOD (M37151.1) | FORWARD | CGGGTGACCTGGGAAACATAGTG |
REVERSE | ACCACAAGTGCTCGTCCAACAAC | |
CAT (NM_001247898.1) | FORWARD | GCTCCCAGTTAATGCTCCCAAGTG |
REVERSE | CAAGAAGGAATCGGGTACTGCTCAG | |
POD (L13654.1) | FORWARD | GAGAGGTCTGTTCCAATCCGATGC |
REVERSE | TTCGTTGAGTGGTCCATCTACAAGC | |
APX (AY974805.1) | FORWARD | AATTGGCTGGTGTTGTTGCTGTTG |
REVERSE | GGTGGTTCTGGTTTGTCCTCTCTG | |
MDHAR (NM_001247084.2) | FORWARD | GGGTTCTTCTTGAAAGTGGGAGTCC |
REVERSE | GAGCCTCTTCAACCGACGATGC | |
DHAR (NM_001247893.2) | FORWARD | AAGAAGTGGAGTGTGCCTGAAAGC |
REVERSE | AGCCTTGGTTTTCTGGAACGACTC | |
GR (NM_001321393.1) | FORWARD | AGGTTGAATCTGGATGCTGTTGGTG |
REVERSE | AATGCTGGGTATATTGGTGCGTGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, X.; Han, H.; Cong, Y.; Li, X.; Zhang, W.; Wan, W.; Cui, J.; Xu, W.; Diao, M.; Liu, H. The Protective Effect of Exogenous Ascorbic Acid on Photosystem Inhibition of Tomato Seedlings Induced by Salt Stress. Plants 2023, 12, 1379. https://doi.org/10.3390/plants12061379
Chen X, Han H, Cong Y, Li X, Zhang W, Wan W, Cui J, Xu W, Diao M, Liu H. The Protective Effect of Exogenous Ascorbic Acid on Photosystem Inhibition of Tomato Seedlings Induced by Salt Stress. Plants. 2023; 12(6):1379. https://doi.org/10.3390/plants12061379
Chicago/Turabian StyleChen, Xianjun, Hongwei Han, Yundan Cong, Xuezhen Li, Wenbo Zhang, Wenliang Wan, Jinxia Cui, Wei Xu, Ming Diao, and Huiying Liu. 2023. "The Protective Effect of Exogenous Ascorbic Acid on Photosystem Inhibition of Tomato Seedlings Induced by Salt Stress" Plants 12, no. 6: 1379. https://doi.org/10.3390/plants12061379
APA StyleChen, X., Han, H., Cong, Y., Li, X., Zhang, W., Wan, W., Cui, J., Xu, W., Diao, M., & Liu, H. (2023). The Protective Effect of Exogenous Ascorbic Acid on Photosystem Inhibition of Tomato Seedlings Induced by Salt Stress. Plants, 12(6), 1379. https://doi.org/10.3390/plants12061379