Comparative Transcriptome Profiling Reveals Key MicroRNAs and Regulatory Mechanisms for Aluminum Tolerance in Olive
Abstract
1. Introduction
2. Results
2.1. Genome-Wide Identification of Small RNAs in Two Olive Genotypes
2.2. Identification of Conserved miRNAs and Novel miRNAs
2.3. Genotypic Differences in miRNA Expression Profiles in Response to Al Stress
2.4. Functional Characterization of Key miRNAs and Their Target Genes
3. Discussion
3.1. miRNA–mRNA Pairs Mediate Al Tolerance by Transcriptional Regulation and Hormone Signaling
3.2. miRNA–mRNA Pairs Mediate Al Tolerance by Regulation of Transportation and Metabolism
4. Materials and Methods
4.1. Plant Materials and Treatments
4.2. RNA Isolation, Library Construction and High-Throughput Sequencing
4.3. Identification and Expression Analysis of sRNAs in Olive
4.4. Target Gene Prediction and Functional Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhang, Q.Y.; Cao, Z.; Sun, X.D.; Zuang, C.C.; Huang, W.Y.; Li, Y.F. Aluminum trichloride Induces hypertension and disturbs the function of erythrocyte membrane in male rats. Biol. Trace Elem. Res. 2015, 171, 1–8. [Google Scholar] [CrossRef]
- Liu, W.X.; Feng, X.; Chen, Z.H.; Zhang, G.P.; Wu, F.B. Transient silencing of an expansion HvEXPA1 inhibits root cell elongation and reduces Al accumulation in root cell wall of Tibetan wild barley. Environ. Exp. Bot. 2019, 165, 120–128. [Google Scholar] [CrossRef]
- Liu, W.X.; Feng, X.; Cao, F.B.; Wu, D.Z.; Zhang, G.P.; Vincze, E.; Wu, F.B. An ATP binding cassette transporter HvABCB25 confers aluminum detoxification in wild barley. J. Hazard. Mater. 2021, 401, 123371. [Google Scholar] [CrossRef]
- Wang, Y.; Li, R.; Li, D.; Jia, X.; Zhou, D.; Li, J.; Lyi, S.M.; Hou, S.; Huang, Y.; Kochian, L.V.; et al. NIP1; 2 is a plasma membrane-localized transporter mediating aluminum uptake, translocation, and tolerance in Arabidopsis. Proc. Natl. Acad. Sci. USA 2017, 114, 5047–5052. [Google Scholar] [CrossRef] [PubMed]
- Delhaize, E.; Ryan, P.R.; Hebb, D.M.; Yamamoto, Y.; Sasaki, T.; Matsumoto, H. Engineering high-level aluminum tolerance in barley with the ALMT1 gene. Proc. Natl. Acad. Sci. USA. 2004, 101, 15249–15254. [Google Scholar] [CrossRef] [PubMed]
- Larsen, P.B.; Geisler, M.J.; Jones, C.A.; Williams, K.M.; Cancel, J.D. ALS3 encodes a phloem-localized ABC transporter-like protein that is required for aluminum tolerance in Arabidopsis. Plant J. 2005, 41, 353–363. [Google Scholar] [CrossRef]
- Yokosho, K.; Yamaji, N.; Ma, J.F. An Al-inducible MATE gene is involved in external detoxification of Al in rice. Plant J. 2011, 68, 1061–1069. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.J.; Meng, X.W.; Dobrovolskaya, O.B.; Orlov, Y.L.; Chen, M. Non-coding RNAs and their roles in stress response in plants. Genom. Proteom. Bioinform. 2017, 15, 301–312. [Google Scholar] [CrossRef] [PubMed]
- Song, X.W.; Li, Y.; Cao, X.F.; Qi, Y.J. MicroRNAs and their regulatory roles in plant–environment interactions. Annu. Rev. Plant Biol. 2019, 70, 489–525. [Google Scholar] [CrossRef]
- Zhang, B.H.; Unver, T. A critical and speculative review on microRNA technology in crop improvement, current challenges and future directions. Plant Sci. 2018, 274, 193–200. [Google Scholar] [CrossRef]
- Chen, L.; Wang, T.Z.; Zhao, M.G.; Tian, Q.Y.; Zhang, W.H. Identification of aluminum-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing. Planta 2012, 235, 375–386. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.C.; Lu, G.H.; Tang, C.Y.; Ji, Y.J.; Tan, G.S.; Hu, D.Q.; Cheng, J.; Wang, G.H.; Qi, J.L.; Yang, Y.H. Identification and comparative analysis of aluminum-induced microRNAs conferring plant tolerance to aluminum stress in soybean. Biol. Plant. 2018, 62, 97–108. [Google Scholar] [CrossRef]
- Marin, E.; Jouannet, V.; Herz, A.; Lokerse, A.S.; Weijers, D.; Vaucheret, H.; Nussaume, L.; Crespi, M.D.; Maizel, A. miR390, Arabidopsis TAS3 tasiRNAs, and their AUXIN RESPONSE FACTOR targets define an autoregulatory network quantitatively regulating lateral root growth. Plant Cell 2010, 22, 1104–1117. [Google Scholar] [CrossRef]
- Bai, B.; Bian, H.; Zeng, Z.; Hou, N.; Shi, B.; Wang, J.; Zhu, M.; Han, N. MiR393-mediated auxin signaling regulation is involved in root elongation inhibition in response to toxic aluminum stress in barley. Plant Cell Physiol. 2017, 58, 426–439. [Google Scholar] [CrossRef]
- Feng, X.; Liu, W.X.; Dai, H.X.; Qiu, Y.; Zhang, G.P.; Chen, Z.H.; Wu, F.B. HvHOX9, a novel homeobox leucine zipper transcription factor, positively regulates aluminum tolerance in Tibetan wild barley. J. Exp. Bot. 2020, 71, 6057–6073. [Google Scholar] [CrossRef]
- Amira, Z.; Sahar, N.; Amira, Z.; Houda, H.; Ameni, K.; Lotfi, A. Phytochemical profile, cytotoxic, antioxidant, and allelopathic potentials of aqueous leaf extracts of Olea europaea. Food Sci. Nutr. 2020, 8, 4805–4813. [Google Scholar]
- Qiu, C.W.; Liu, L.; Feng, X.; Hao, P.F.; He, X.Y.; Cao, F.B.; Wu, F.B. Genome-wide identification and characterization of drought stress responsive microRNAs in Tibetan wild barley. Int. J. Mol. Sci. 2020, 21, 2795. [Google Scholar] [CrossRef]
- Srivastava, S.; Suprasanna, P. MicroRNAs: Tiny, powerful players of metal stress responses in plants. Plant Physiol. Biochem. 2021, 166, 928–938. [Google Scholar] [CrossRef]
- Chen, C.; Zhang, K.X.; Khurshid, M.; Li, J.B.; He, M.; Georgiev, M.I.; Zhang, X.Q.; Zhou, M.L. MYB transcription repressors regulate plant secondary metabolism. CRC. Crit. Rev. Plant Sci. 2019, 38, 159–170. [Google Scholar] [CrossRef]
- Zeng, Q.Y.; Yang, C.Y.; Ma, Q.B.; Li, X.P.; Dong, W.W.; Nian, H. Identification of wild soybean miRNAs and their target genes responsive to aluminum stress. BMC Plant Biol. 2012, 12, 182. [Google Scholar] [CrossRef]
- Wu, Q.; Tao, Y.; Huang, J.; Liu, Y.S.; Yang, X.Z.; Jing, H.K.; Shen, R.F.; Zhu, X.F. The MYB transcription factor MYB103 acts upstream of TRICHOME BIREFRINGENCE-LIKE27 in regulating aluminum sensitivity by modulating the O-acetylation level of cell wall xyloglucan in Arabidopsis thaliana. Plant J. 2022, 111, 529–545. [Google Scholar] [CrossRef] [PubMed]
- Su, L.T.; Lv, A.M.; Wen, W.W.; Fan, N.N.; Li, J.J.; Gao, L.; Zhou, P.; An, Y. MsMYB741 is involved in alfalfa resistance to aluminum stress by regulating flavonoid biosynthesis. Plant J. 2022, 112, 756–771. [Google Scholar] [CrossRef] [PubMed]
- Boualem, A.; Laporte, P.; Jovanovic, M.; Laffont, C.; Plet, J.; Combier, J.P.; Niebel, A.; Crespi, M.; Frugier, F. MicroRNA166 controls root and nodule development in Medicago truncatula. Plant J. 2008, 54, 876–887. [Google Scholar] [CrossRef]
- Liu, Y.; Xu, J.M.; Guo, S.Y.; Yuan, X.Z.; Zhao, S.; Tian, H.Y.; Dai, S.J.; Kong, X.P.; Ding, Z.J. AtHB7/12 regulate root growth in response to aluminum stress. Int. J. Mol. Sci. 2020, 21, 4080. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.Q.; Marillonnet, S.; Tissier, A. The scarecrow-like transcription factor SlSCL3 regulates volatile terpene biosynthesis and glandular trichome size in tomato (Solanum lycopersicum). Plant J. 2021, 107, 1102–1118. [Google Scholar] [CrossRef] [PubMed]
- Mendoza-Soto, A.B.; Naya, L.; Leija, A.; Hernández, G. Responses of symbiotic nitrogen-fixing common bean to aluminum toxicity and delineation of nodule responsive microRNAs. Front. Plant Sci. 2015, 6, 587. [Google Scholar] [CrossRef]
- Wang, J.W.; Wang, L.J.; Mao, Y.B.; Cai, W.J.; Xue, H.W.; Chen, X.Y. Control of root cap formation by microRNA-targeted auxin response factors in Arabidopsis. Plant Cell 2005, 17, 2204–2216. [Google Scholar] [CrossRef]
- Okushima, Y.; Fukaki, H.; Onoda, M.; Theologis, A.; Tasaka, M. ARF7 and ARF19 regulate lateral root formation via direct activation of LBD/ASL genes in Arabidopsis. Plant Cell 2007, 19, 118–130. [Google Scholar] [CrossRef]
- Gutierrez, L.; Bussell, J.D.; Pacurar, D.; Schwambach, J.; Pacurar, M.; Bellini, C. Phenotypic plasticity of adventitious rooting in Arabidopsis is controlled by complex regulation of Auxin response factor transcripts and microRNA abundance. Plant Cell 2009, 21, 3119–3132. [Google Scholar] [CrossRef]
- Zanetti, M.E.; Ripodas, C.; Niebel, A. Plant NF-Y transcription factors: Key players in plant-microbe interactions, root development and adaptation to stress. Biochim Biophys Acta. 2017, 1860, 645–654. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhang, Y.; Wang, X.; Han, X.; An, Y.; Lin, S.; Shen, C.; Wen, J.; Liu, C.; Yin, W.; et al. Root-specific NF-Y family transcription factor, PdNF-YB21, positively regulates root growth and drought resistance by abscisic acid-mediated indoylacetic acid transport in Populus. New Phytol. 2020, 227, 407–442. [Google Scholar] [CrossRef] [PubMed]
- Manimaran, P.; Venkata Reddy, S.; Moin, M.; Raghurami Reddy, M.; Yugandhar, P.; Mohanraj, S.S.; Balachandran, S.M.; Kirti, P.B. Activation-tagging in indica rice identifies novel transcription factor subunit, NF-YC13 associated with salt tolerance. Sci. Rep. 2017, 7, 9341. [Google Scholar] [CrossRef] [PubMed]
- Sato, H.; Mizoi, J.; Tanaka, H.; Maruyama, K.; Qin, F.; Osakabe, Y.; Morimoto, K.; Ohori, T.; Kusakabe, K.; Nagata, M.; et al. Arabidopsis DPB3-1, a DREB2A interactor, specifically enhances heat stress-induced gene expression by forming a heat stress-specific transcriptional complex with NF-Y Subunits. Plant Cell 2015, 26, 4954–4973. [Google Scholar] [CrossRef] [PubMed]
- Luan, M.; Xu, M.; Lu, Y.; Zhang, L.; Fan, Y.; Wang, L. Expression of zma-miR169 miRNAs and their target ZmNF-YA genes in response to abiotic stress in maize leaves. Gene 2015, 555, 178–185. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Hu, X.L.; Zhu, M.Y.; Wei, L. Transcription factors NF-YA2 and NF-YA10 regulate leaf growth via auxin signaling in Arabidopsis. Sci. Rep. 2017, 7, 1395. [Google Scholar] [CrossRef]
- Huang, C.F.; Yamaji, N.; Mitani, N.; Yano, M.; Nagamura, Y.; Ma, J.F. A bacterial-type ABC transporter is involved in aluminum tolerance in rice. Plant Cell 2009, 21, 655–667. [Google Scholar] [CrossRef]
- Huang, C.F.; Yamaji, N.; Chen, Z.C.; Ma, J.F. A tonoplast-localized half-size ABC transporter is required for internal detoxification of aluminum in rice. Plant J. 2012, 69, 857–867. [Google Scholar] [CrossRef]
- Maser, P.; Thomine, S.; Schroeder, J.I.; Ward, J.M.; Hirschi, K.; Sze, H.; Talke, I.N.; Amtmann, A.; Maathuis, F.J.M.; Sanders, D.; et al. Phylogenetic Relationships within Cation Transporter Families of Arabidopsis. Plant Physiol. 2001, 126, 1646–1667. [Google Scholar] [CrossRef]
- Armbruster, U.; Carrillo, L.R.; Venema, K.; Pavlovic, L.; Schmidtmann, E.; Kornfeld, A.; Jahns, P.; Berry, J.A.; Kramer, D.M.; Jonikas, M.C. Ion antiport accelerates photosynthetic acclimation in fluctuating light environments. Nat. Commun. 2014, 5, 5439. [Google Scholar] [CrossRef]
- Kunz, H.H.; Gierth, M.; Herdean, A.; Satoh-Cruz, M.; Kramer, D.M.; Spetea, C.; Schroeder, J.I. Plastidial transporters KEA1, -2, and -3 are essential for chloroplast osmoregulation, integrity, and pH regulation in Arabidopsis. Proc. Natl. Acad. Sci. USA 2014, 111, 7480–7485. [Google Scholar] [CrossRef]
- Turlapati, P.V.; Kim, K.W.; Davin, L.B.; Lewis, N.G. The laccase multigene family in Arabidopsis thaliana: Towards addressing the mystery of their gene function(s). Planta 2011, 233, 439–470. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.C.; Yu, Y.; Wang, C.Y.; Li, Z.Y.; Liu, Q.; Xu, J.; Liao, J.Y.; Wang, X.J.; Qu, L.H.; Chen, F.; et al. Overexpression of microRNA OsmiR397 improves rice yield by increasing grain size and promoting panicle branching. Nat. Biotechnol. 2013, 31, 848–852. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.Y.; Zhang, S.C.; Yu, Y.; Luo, Y.C.; Liu, Q.; Ju, C.L.; Zhang, Y.C.; Qu, L.H.; Lucas, W.J.; Wang, X.J.; et al. MiR397b regulates both lignin content and seed number in Arabidopsis via modulating a laccase involved in lignin biosynthesis. Plant Biotechnol. J. 2014, 12, 1132–1142. [Google Scholar] [CrossRef] [PubMed]
- Niu, E.; Gao, S.; Yu, X.M.; Soleimani, A.; Zhu, S.L. Comprehensive evaluation of the response to aluminum stress in olive tree (Olea europaea L.). Front. Plant Sci. 2022, 13, 2634. [Google Scholar] [CrossRef]
- Mortazavi, A.; Williams, B.a.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef] [PubMed]
- Tang, C.; Xie, Y.M.; Guo, M.; Yan, W. AASRA: An anchor alignment-based small RNA annotation pipeline. Biol. Reprod. 2021, 105, 267–277. [Google Scholar] [CrossRef]
- Nawrocki, E.P.; Eddy, S.R. Infernal 1.1: 100-fold faster RNA homology searches. Bioinformatics 2013, 29, 2933–2935. [Google Scholar] [CrossRef]
- Evers, M.; Huttner, M.; Dueck, A.; Meister, G.; Engelmann, J.C. miRA: Adaptable novel miRNA identification in plants using small RNA sequencing data. BMC Bioinform. 2015, 16, 370. [Google Scholar] [CrossRef]
- ′t Hoen, P.A.; Ariyurek, Y.; Thygesen, H.H.; Vreugdenhil, E.; Vossen, R.H.; de Menezes, R.X.; Boer, J.M.; van Ommen, G.-J.B.; den Dunnen, J.T. Deep sequencing-based expression analysis shows major advances in robustness, resolution and inter-lab portability over five microarray platforms. Nucleic Acids Res. 2008, 36, 21. [Google Scholar] [CrossRef]
- Wang, L.K.; Feng, Z.X.; Wang, X.; Wang, X.; Wang, X.W.; Zhang, X.G. DEGseq: An R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics 2010, 26, 136–138. [Google Scholar] [CrossRef]
- Wu, H.J.; Ma, Y.K.; Chen, T.; Wang, M.; Wang, X.J. PsRobot: A web-based plant small RNA meta-analysis toolbox. Nucleic Acids Res. 2012, 40, 22–28. [Google Scholar] [CrossRef] [PubMed]
- Boyle, E.I.; Weng, S.; Gollub, J.; Jin, H.; Botstein, D.; Cherry, J.M.; Sherlock, G. GO: TermFinder-open source software for accessing Gene Ontology information and finding significantly enriched Gene Ontology terms associated with a list of genes. Bioinformatics 2004, 20, 3710–3715. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, D480–D484. [Google Scholar] [CrossRef] [PubMed]
miRNA ID | Sequence | Fold Change | Target Gene | Annotation | |
---|---|---|---|---|---|
ZL | FS | ||||
miR160 | UGGCAUACAGGGAGCCAGGCA | −4.6 | 2.7 | XM_022996383.1 | Probable methyltransferase PMT5 isoform X3 [S. indicum] |
miR166 | UCGGACCAGGCUUCAUUCCCCC | −1.4 | 1.4 | XM_022988900.1 | Homeobox-leucine zipper protein ATHB-15 [S. indicum] |
miR3711 | UGGCGCUAGAAGGAGGGCCU | −2.1 | 1.3 | XM_023029508.1 | Zinc finger protein BRUTUS-like At1g18910 isoform X1 [S. indicum] |
miR166m_2 | CGGACCAGGCUUCAUUCCCC | −2.5 | 1.4 | XM_022988900.1 | Homeobox-leucine zipper protein ATHB-15 [S. indicum] |
miR397-5p_1 | AUUGAGUGCAGCGUUGAUGA | −2.5 | 3.4 | XM_023032806.1 | Laccase-7-like [N.a tomentosiformis] |
miR394a_1 | UUGGCAUUCUGUCCACCUCC | −2.5 | 1.4 | XM_023028746.1 | ABC transporter D family member 1 [S. indicum] |
miR169b-5p | CAGCCAAGGAUGACUUGCCGG | −2.8 | 1.3 | XM_022986682.1 | Nuclear transcription factor Y subunit A-10 [S. indicum] |
miR396a-3p_4 | GUUCAAUAAAGCUGUGGGAA | −5.3 | 1 | XM_023010161.1 | Rho GTPase-activating protein 3 [S. indicum] |
miR167d-5p | UGAAGCUGCCAGCAUGAUCUG | −1.2 | 0.8 | XM_023009656.1 | K+ efflux antiporter 6 isoform X1 [S. indicum] |
miR160a-5p | UGCCUGGCUCCCUGUAUGCCA | −3.7 | 0.4 | XM_022990902.1 | Auxin response factor 18 [S. indicum] |
miR160g_1 | UGCCUGGCUCCUUGUAUGCCA | −2.4 | 0.7 | XM_022986017.1 | Auxin response factor 18-like [S. pennellii] |
miR319a-3p | UUGGACUGAAGGGAGCUCCC | −2.7 | 0.2 | XM_023020858.1 | Transcription factor MYB33-like [P. avium] |
XM_023031930.1 | Transcription factor GAMYB-like [S. indicum] | ||||
miR2111-5p | UAAUCUGCAUCCUGAGGUCUA | −2.4 | −0.7 | XM_022985946.1 | Unnamed protein product [C. canephora] |
novel_mir141 | AGGGAGUUUGGCUGGGGCGGCA | −1.1 | 0.9 | XM_023012233.1 | Uncharacterized protein LOC105165878 [S. indicum] |
miR156a | UGACAGAAGAGAGUGAGCACA | 0.5 | 1.1 | XM_022986496.1 | Squamosa promoter-binding-like protein 9 [S. indicum] |
miR319_1 | UUGGACUGAAGGGAGCUCC | −0.8 | 1.1 | XM_023020858.1 | Transcription factor MYB33-like [P. avium] |
XM_023031930.1 | Transcription factor GAMYB-like [S. indicum] | ||||
miR171b-3p | UUGAGCCGUGCCAAUAUCAC | −0.3 | 6.3 | XM_022990202.1 | Scarecrow-like protein 22 isoform X1 [S. indicum] |
XM_023012724.1 | Probable E3 ubiquitin ligase SUD1 [S. indicum] | ||||
miR166e-3p | CUCGGACCAGGCUUCAUUCCC | 0.8 | 1.4 | XM_022988900.1 | Homeobox-leucine zipper protein ATHB-15 [S. indicum] |
miR399j_2 | UGCCAAAGGAGAGUUGCCCUA | 0.6 | 1.2 | XM_022991328.1 | Mitochondrial-processing peptidase subunit alpha-like [S. indicum] |
miR399a_6 | UGCCAAAGGAGAAUUGCCCUG | 1.0 | 3.0 | XM_023034395.1 | Dehydration-responsive element-binding protein 2A-like [N. attenuata] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, Y.; Cao, F.; Xie, L.; Wu, F.; Zhu, S.; Qiu, C. Comparative Transcriptome Profiling Reveals Key MicroRNAs and Regulatory Mechanisms for Aluminum Tolerance in Olive. Plants 2023, 12, 978. https://doi.org/10.3390/plants12050978
Wu Y, Cao F, Xie L, Wu F, Zhu S, Qiu C. Comparative Transcriptome Profiling Reveals Key MicroRNAs and Regulatory Mechanisms for Aluminum Tolerance in Olive. Plants. 2023; 12(5):978. https://doi.org/10.3390/plants12050978
Chicago/Turabian StyleWu, Yi, Fangbin Cao, Lupeng Xie, Feibo Wu, Shenlong Zhu, and Chengwei Qiu. 2023. "Comparative Transcriptome Profiling Reveals Key MicroRNAs and Regulatory Mechanisms for Aluminum Tolerance in Olive" Plants 12, no. 5: 978. https://doi.org/10.3390/plants12050978
APA StyleWu, Y., Cao, F., Xie, L., Wu, F., Zhu, S., & Qiu, C. (2023). Comparative Transcriptome Profiling Reveals Key MicroRNAs and Regulatory Mechanisms for Aluminum Tolerance in Olive. Plants, 12(5), 978. https://doi.org/10.3390/plants12050978