Genomic Sequence of Canadian Chenopodium berlandieri: A North American Wild Relative of Quinoa
Abstract
1. Introduction
1.1. Wild Crop Relatives of Quinoa
1.2. Historical Cultivation of C. berlandieri
1.3. Adaptation of C. berlandieri in Canada
1.4. Utility of C. berlandieri Genome Sequencing
1.5. Field Identification of C. berlandieri
1.6. Study Objectives
2. Results
2.1. Collections
2.2. Barcoding
2.2.1. rbcL Barcoding
2.2.2. matK Barcoding
2.3. Genome Sequencing and Assembly
2.3.1. Total Sequence Obtained
2.3.2. k-mer Analysis
2.3.3. Genome Assembly Using Platanus
2.3.4. Genome Assembly Using Abyss
2.3.5. Repetitive Sequence Content of Platanus Assembly
2.3.6. BUSCO Analysis of Genome Completion
2.3.7. Heterozygosity Analysis of Platanus Assembly
2.3.8. Genomic Variation versus Other Tetraploid Chenopodium Genomes
2.4. Organelle Genome Assembly
2.4.1. Chloroplast Genome
2.4.2. Mitochondrion Genome
2.5. Comparative Genomics of Agriculturally Relevant Genes
2.5.1. SOS1
2.5.2. HAIKU Pathway Genes
2.5.3. TTG2
3. Discussion
3.1. Discrimination of Chenopodium Species
3.2. Genome Sequencing and Assembly of a Canadian C. berlandieri Accession
3.3. Analysis of Genes Involved in Agricultural Traits
3.3.1. SOS1
3.3.2. TTG2
3.3.3. Utility of Genomic Comparisons
4. Materials and Methods
4.1. Plant Collection and Germination
4.2. DNA Purification
4.3. Primer Design, PCR, and Sanger Sequencing
4.4. Genomic Sequencing
4.5. Informatics
4.5.1. PCR-Sanger Sequencing
4.5.2. Whole Genome Sequencing and Assembly
4.5.3. Variant Calling
4.5.4. Gene Models and Comparisons between Chenopodium Species
4.5.5. Visualization of Sequence Alignments and Graphic Outputs
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bazile, D.; Pulvento, C.; Verniau, A.; Al-Nusairi, M.S.; Ba, D.; Breidy, J.; Hassan, L.; Mohammed, M.I.; Mambetov, O.; Otambekova, M.; et al. Worldwide Evaluations of Quinoa: Preliminary Results from Post International Year of Quinoa FAO Projects in Nine Countries. Front. Plant Sci. 2016, 7, 850. [Google Scholar] [CrossRef] [PubMed]
- Bohra, A.; Kilian, B.; Sivasankar, S.; Caccamo, M.; Mba, C.; McCouch, S.R.; Varshney, R.K. Reap the crop wild relatives for breeding future crops. Trends Biotechnol. 2022, 40, 412–431. [Google Scholar] [CrossRef] [PubMed]
- Dempewolf, H.; Baute, G.; Anderson, J.; Kilian, B.; Smith, C.; Guarino, L. Past and future uses of wild relatives in crop breeding. Crop Sci. 2017, 57, 1070–1082. [Google Scholar] [CrossRef]
- Jarvis, D.E.; Ho, Y.S.; Lightfoot, D.J.; Schmockel, S.M.; Li, B.; Borm, T.J.; Ohyanagi, H.; Mineta, K.; Michell, C.T.; Saber, N.; et al. The genome of Chenopodium quinoa. Nature 2017, 542, 307–312. [Google Scholar] [CrossRef]
- Smith, B.D. Chenopodium as a prehistoric domesticate in eastern north america: Evidence from russell cave, alabama. Science 1984, 226, 165–167. [Google Scholar] [CrossRef]
- Smith, B.D. Eastern North America as an independent center of plant domestication. Proc. Natl. Acad. Sci. USA 2006, 103, 12223–12228. [Google Scholar] [CrossRef]
- Smith, B.D.; Yarnell, R.A. Initial formation of an indigenous crop complex in eastern North America at 3800 B.P. Proc. Natl. Acad. Sci. USA 2009, 106, 6561–6566. [Google Scholar] [CrossRef]
- Halwas, S.; Worley, A.C. Incorporating Chenopodium berlandieri into a Seasonal Subsistence Pattern: Implications of Biological Traits for Cultural Choices. J. Ethnobiol. 2019, 39, 510–529. [Google Scholar] [CrossRef]
- Subedi, M.; Neff, E.; Davis, T.M. Developing Chenopodium ficifolium as a potential B genome diploid model system for genetic characterization and improvement of allotetraploid quinoa (Chenopodium quinoa). BMC Plant Biol. 2021, 21, 490. [Google Scholar] [CrossRef]
- Maughan, P.J. Amaranthaceae genomic resources—BYU. In Proceedings of the 2nd International Quinoa Research Symposium, Seattle, WA, USA, 17–19 August 2020. [Google Scholar]
- Bassett, I.J.; Crompton, C.W. The genus Chenopodium in Canada. Can. J. Bot. 1982, 60, 586–610. [Google Scholar] [CrossRef]
- Bassett, I.J.; Crompton, C.W. The biology of Canadian weeds: 32 Chenopodium album L. Can. J. Plant Sci. 1982, 58, 1061–1072. [Google Scholar] [CrossRef]
- Jellen, E.N. Genetic resources and breeding of goosefoots (including quinoa). In Proceedings of the 2nd International Quinoa Research Symposium, Seattle, WA, USA, 17–19 August 2020. [Google Scholar]
- Jellen, E.N.; Jarvis, D.E.; Hunt, S.P.; Mangelsen, H.H.; Maughan, P.J. New seed collections of North American pitseed goosefoot (Chenopodium berlandieri) and efforts to identify its diploid ancestors through whole-genome sequencing. Int. J. Agric. Nat. Resour. 2019, 46, 187–196. [Google Scholar] [CrossRef]
- Mandak, B.; Krak, K.; Vit, P.; Lomonosova, M.N.; Belyayev, A.; Habibi, F.; Wang, L.; Douda, J.; Storchova, H. Hybridization and polyploidization within the Chenopodium album aggregate analysed by means of cytological and molecular markers. Mol. Phylogenet. Evol. 2018, 129, 189–201. [Google Scholar] [CrossRef]
- Zhang, T.; Gu, M.; Liu, Y.; Lv, Y.; Zhou, L.; Lu, H.; Liang, S.; Bao, H.; Zhao, H. Development of novel InDel markers and genetic diversity in Chenopodium quinoa through whole-genome re-sequencing. BMC Genom. 2017, 18, 685. [Google Scholar] [CrossRef] [PubMed]
- Fuentes-Bazan, S.; Mansion, G.; Borsch, T. Towards a species level tree of the globally diverse genus Chenopodium (Chenopodiaceae). Mol. Phylogenet. Evol. 2012, 62, 359–374. [Google Scholar] [CrossRef]
- Devi, R.J.; Chrungoo, N.K. Evolutionary divergence in Chenopodium and validation of SNPs in chloroplast rbcL and matk genes by allele-specific PCR for development of Chenopodium quinoa specific markers. Crop J. 2017, 5, 32. [Google Scholar] [CrossRef][Green Version]
- Halwas, S.J. Domesticating Chenopodium: Applying Genetic Techniques and Archaeological Data to Understanding Pre-Contact Plant Use in Southern Manitoba (AD1000–1500); University of Manitoba: Winnipeg, MB, Canada, 2017. [Google Scholar]
- Yao, P.C.; Gao, H.Y.; Wei, Y.N.; Zhang, J.H.; Chen, X.Y.; Li, H.Q. Evaluating sampling strategy for DNA barcoding study of coastal and inland halo-tolerant Poaceae and Chenopodiaceae: A case study for increased sample size. PLoS ONE 2017, 12, e0185311. [Google Scholar] [CrossRef]
- Muller, K.; Borsch, T. Phylogenetics of Amaranthaceae based on matK/trnK sequence data: Evidence from parsimony, likelihood, and Bayesian analysis. Ann. Mo. Bot. Gard. 2005, 92, 66–102. [Google Scholar]
- Hong, S.Y.; Cheon, K.S.; Yoo, K.O.; Lee, H.O.; Cho, K.S.; Suh, J.T.; Kim, S.J.; Nam, J.H.; Sohn, H.B.; Kim, Y.H. Complete Chloroplast Genome Sequences and Comparative Analysis of Chenopodium quinoa and C. album. Front. Plant Sci. 2017, 8, 1696. [Google Scholar] [CrossRef]
- Costion, C.; Ford, A.; Cross, H.; Crayn, D.; Harrington, M.; Lowe, A. Plant DNA barcodes can accurately estimate species richness in poorly known floras. PLoS ONE 2011, 6, e26841. [Google Scholar] [CrossRef]
- Kress, W.J.; Erickson, D.L.; Jones, F.A.; Swenson, N.G.; Perez, R.; Sanjur, O.; Bermingham, E. Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proc. Natl. Acad. Sci. USA 2009, 106, 18621–18626. [Google Scholar] [CrossRef] [PubMed]
- Hollingsworth, P.M.; Graham, S.W.; Little, D.P. Choosing and using a plant DNA barcode. PLoS ONE 2011, 6, e19254. [Google Scholar] [CrossRef] [PubMed]
- Cuenoud, P.; Savolainen, V.; Chatrou, L.W.; Powell, M.; Grayer, R.J.; Chase, M.W. Molecular phylogenetics of Caryophyllales based on nuclear 18S rDNA and plastid rbcL, atpB, and matK DNA sequences. Am. J. Bot. 2002, 89, 132–144. [Google Scholar] [CrossRef] [PubMed]
- Luo, X.; Chen, S.; Zhang, Y. PlantRep: A database of plant repetitive elements. Plant Cell Rep. 2022, 41, 1163–1166. [Google Scholar] [CrossRef] [PubMed]
- Walsh, B.M.; Adhikary, D.; Maughan, P.J.; Emshwiller, E.; Jellen, E.N. Chenopodium polyploidy inferences from Salt Overly Sensitive 1 (SOS1) data. Am. J. Bot. 2015, 102, 533–543. [Google Scholar] [CrossRef]
- Ji, H.; Pardo, J.M.; Batelli, G.; Van Oosten, M.J.; Bressan, R.A.; Li, X. The Salt Overly Sensitive (SOS) pathway: Established and emerging roles. Mol. Plant 2013, 6, 275–286. [Google Scholar] [CrossRef]
- Kotula, L.; Garcia Caparros, P.; Zorb, C.; Colmer, T.D.; Flowers, T.J. Improving crop salt tolerance using transgenic approaches: An update and physiological analysis. Plant Cell Environ. 2020, 43, 2932–2956. [Google Scholar] [CrossRef]
- Maughan, P.J.; Turner, T.B.; Coleman, C.E.; Elzinga, D.B.; Jellen, E.N.; Morales, J.A.; Udall, J.A.; Fairbanks, D.J.; Bonifacio, A. Characterization of Salt Overly Sensitive 1 (SOS1) gene homoeologs in quinoa (Chenopodium quinoa Willd.). Genome 2009, 52, 647–657. [Google Scholar] [CrossRef]
- Garcia, D.; Saingery, V.; Chambrier, P.; Mayer, U.; Jurgens, G.; Berger, F. Arabidopsis haiku mutants reveal new controls of seed size by endosperm. Plant Physiol. 2003, 131, 1661–1670. [Google Scholar] [CrossRef]
- Orozco-Arroyo, G.; Paolo, D.; Ezquer, I.; Colombo, L. Networks controlling seed size in Arabidopsis. Plant Reprod. 2015, 28, 17–32. [Google Scholar] [CrossRef]
- Luo, M.; Dennis, E.S.; Berger, F.; Peacock, W.J.; Chaudhury, A. MINISEED3 (MINI3), a WRKY family gene, and HAIKU2 (IKU2), a leucine-rich repeat (LRR) KINASE gene, are regulators of seed size in Arabidopsis. Proc. Natl. Acad. Sci. USA 2005, 102, 17531–17536. [Google Scholar] [CrossRef] [PubMed]
- Johnson, C.S.; Kolevski, B.; Smyth, D.R. TRANSPARENT TESTA GLABRA2, a trichome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor. Plant Cell 2002, 14, 1359–1375. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Gong, X.; Zhang, B.; Liang, Z.; Wong, C.E.; See, B.Y.H.; Yu, H. TOP1alpha, UPF1 and TTG2 regulate seed size in a parental dosage-dependent manner. PLoS Biol. 2020, 18, e3000930. [Google Scholar] [CrossRef] [PubMed]
- Garcia, D.; Fitz Gerald, J.N.; Berger, F. Maternal control of integument cell elongation and zygotic control of endosperm growth are coordinated to determine seed size in Arabidopsis. Plant Cell 2005, 17, 52–60. [Google Scholar] [CrossRef]
- Li, H.; Lv, Q.; Deng, J.; Huang, J.; Cai, F.; Liang, C.; Chen, Q.; Wang, Y.; Zhu, L.; Zhang, X.; et al. Transcriptome Analysis Reveals Key Seed-Development Genes in Common Buckwheat (Fagopyrum esculentum). Int. J. Mol. Sci. 2019, 20, 4303. [Google Scholar] [CrossRef]
- Mangelson, H.; Jarvis, D.E.; Mollinedo, P.; Rollano-Penaloza, O.M.; Palma-Encinas, V.D.; Gomez-Pando, L.R.; Jellen, E.N.; Maughan, P.J. The genome of Chenopodium pallidicaule: An emerging Andean super grain. Appl. Plant Sci. 2019, 7, e11300. [Google Scholar] [CrossRef]
- Eulgem, T.; Rushton, P.J.; Robatzek, S.; Somssich, I.E. The WRKY superfamily of plant transcription factors. Trends Plant Sci. 2000, 5, 199–206. [Google Scholar] [CrossRef]
- King, B.L.; Maughan, P.J. DNA Barcoding in Chenopodium. 2013. Available online: http://jur.byu.edu/?p=4083 (accessed on 6 January 2023).
- Neff, E. Developing a Molecular Pipeline to Identify Chenopodium Species in New England; University of New Hampshire: Durham, NH, USA, 2017. [Google Scholar]
- Chrungoo, N.K.; Jashmi Devi, R.; Goel, S.; Das, K. Deciphering species relationships and evolution in Chenopodium through sequence variations in nuclear internal transcribed spacer region and amplified fragment-length polymorphism in nuclear DNA. J. Genet. 2019, 98, 37. [Google Scholar] [CrossRef]
- Sattler, M.C.; Carvalho, C.R.; Clarindo, W.R. The polyploidy and its key role in plant breeding. Planta 2016, 243, 281–296. [Google Scholar] [CrossRef]
- Gul, Z.; Tang, Z.H.; Arif, M.; Ye, Z. An Insight into Abiotic Stress and Influx Tolerance Mechanisms in Plants to Cope in Saline Environments. Biology 2022, 11, 597. [Google Scholar] [CrossRef]
- Gonzalez, A.; Brown, M.; Hatlestad, G.; Akhavan, N.; Smith, T.; Hembd, A.; Moore, J.; Montes, D.; Mosley, T.; Resendez, J.; et al. TTG2 controls the developmental regulation of seed coat tannins in Arabidopsis by regulating vacuolar transport steps in the proanthocyanidin pathway. Dev. Biol. 2016, 419, 54–63. [Google Scholar] [CrossRef] [PubMed]
- Hassani-Pak, K.; Castellote, M.; Esch, M.; Hindle, M.; Lysenko, A.; Taubert, J.; Rawlings, C. Developing integrated crop knowledge networks to advance candidate gene discovery. Appl. Transl. Genom. 2016, 11, 18–26. [Google Scholar] [CrossRef] [PubMed]
- Simon, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. 2010. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 6 January 2023).
- Kokot, M.; Dlugosz, M.; Deorowicz, S. KMC 3: Counting and manipulating k-mer statistics. Bioinformatics 2017, 33, 2759–2761. [Google Scholar] [CrossRef] [PubMed]
- Vurture, G.W.; Sedlazeck, F.J.; Nattestad, M.; Underwood, C.J.; Fang, H.; Gurtowski, J.; Schatz, M.C. GenomeScope: Fast reference-free genome profiling from short reads. Bioinformatics 2017, 33, 2202–2204. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Kajitani, R.; Toshimoto, K.; Noguchi, H.; Toyoda, A.; Ogura, Y.; Okuno, M.; Yabana, M.; Harada, M.; Nagayasu, E.; Maruyama, H.; et al. Efficient de novo assembly of highly heterozygous genomes from whole-genome shotgun short reads. Genome Res. 2014, 24, 1384–1395. [Google Scholar] [CrossRef]
- Jackman, S.D.; Vandervalk, B.P.; Mohamadi, H.; Chu, J.; Yeo, S.; Hammond, S.A.; Jahesh, G.; Khan, H.; Coombe, L.; Warren, R.L.; et al. ABySS 2.0: Resource-efficient assembly of large genomes using a Bloom filter. Genome Res. 2017, 27, 768–777. [Google Scholar] [CrossRef]
- Gurevich, A.; Saveliev, V.; Vyahhi, N.; Tesler, G. QUAST: Quality assessment tool for genome assemblies. Bioinformatics 2013, 29, 1072–1075. [Google Scholar] [CrossRef]
- Simao, F.A.; Waterhouse, R.M.; Ioannidis, P.; Kriventseva, E.V.; Zdobnov, E.M. BUSCO: Assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics 2015, 31, 3210–3212. [Google Scholar] [CrossRef]
- Smit, A.F.A.; Hubley, R.; Green, P. RepeatMasker Open-4.0. 2015. Available online: http://www.repeatmasker.org (accessed on 6 January 2023).
- Tarasov, A.; Vilella, A.J.; Cuppen, E.; Nijman, I.J.; Prins, P. Sambamba: Fast processing of NGS alignment formats. Bioinformatics 2015, 31, 2032–2034. [Google Scholar] [CrossRef]
- Li, H. Exploring single-sample SNP and INDEL calling with whole-genome de novo assembly. Bioinformatics 2012, 28, 1838–1844. [Google Scholar] [CrossRef] [PubMed]
- Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M.; et al. Twelve years of SAMtools and BCFtools. Gigascience 2021, 10, giab008. [Google Scholar] [CrossRef]
- Lefouili, M.; Nam, K. The evaluation of Bcftools mpileup and GATK HaplotypeCaller for variant calling in non-human species. Sci. Rep. 2022, 12, 11331. [Google Scholar] [CrossRef] [PubMed]
- Neph, S.; Kuehn, M.S.; Reynolds, A.P.; Haugen, E.; Thurman, R.E.; Johnson, A.K.; Rynes, E.; Maurano, M.T.; Vierstra, J.; Thomas, S.; et al. BEDOPS: High-performance genomic feature operations. Bioinformatics 2012, 28, 1919–1920. [Google Scholar] [CrossRef] [PubMed]
- Quinlan, A.R.; Hall, I.M. BEDTools: A flexible suite of utilities for comparing genomic features. Bioinformatics 2010, 26, 841–842. [Google Scholar] [CrossRef] [PubMed]
- Kapustin, Y.; Souvorov, A.; Tatusova, T.; Lipman, D. Splign: Algorithms for computing spliced alignments with identification of paralogs. Biol. Direct 2008, 3, 20. [Google Scholar] [CrossRef]
- Florea, L.; Hartzell, G.; Zhang, Z.; Rubin, G.M.; Miller, W. A computer program for aligning a cDNA sequence with a genomic DNA sequence. Genome Res. 1998, 8, 967–974. [Google Scholar] [CrossRef]
- Wu, T.D.; Watanabe, C.K. GMAP: A genomic mapping and alignment program for mRNA and EST sequences. Bioinformatics 2005, 21, 1859–1875. [Google Scholar] [CrossRef]
- Robinson, J.T.; Thorvaldsdottir, H.; Winckler, W.; Guttman, M.; Lander, E.S.; Getz, G.; Mesirov, J.P. Integrative genomics viewer. Nat. Biotechnol. 2011, 29, 24–26. [Google Scholar] [CrossRef]
- Cabanettes, F.; Klopp, C. D-GENIES: Dot plot large genomes in an interactive, efficient and simple way. PeerJ 2018, 6, e4958. [Google Scholar] [CrossRef]
- Maughan, P.J.; Chaney, L.; Lightfoot, D.J.; Cox, B.J.; Tester, M.; Jellen, E.N.; Jarvis, D.E. Mitochondrial and chloroplast genomes provide insights into the evolutionary origins of quinoa (Chenopodium quinoa Willd.). Sci. Rep. 2019, 9, 185. [Google Scholar] [CrossRef] [PubMed]
Property | Min | Max |
---|---|---|
Heterozygosity | 0.0590213% | 0.0666777% |
Genome Haploid Length | 1,041,758,722 bp | 1,044,841,788 bp |
Genome Repeat Length | 204,619,403 bp | 205,224,971 bp |
Genome Unique Length | 837,139,319 bp | 839,616,817 bp |
Model Fit | 96.9115% | 99.3631% |
Read Error Rate | 0.0154969% | 0.0154969% |
Minimum Scaffold Length | Number of Scaffolds | Number of Contigs | Total Scaffold Length | Total Contig Length | Scaffold Contig Coverage |
---|---|---|---|---|---|
All | 2,574,694 | 2,606,797 | 1,242,701,758 | 1,241,539,883 | 99.91% |
50 bp | 2,574,694 | 2,606,797 | 1,242,701,758 | 1,241,539,883 | 99.91% |
100 bp | 2,574,694 | 2,606,797 | 1,242,701,758 | 1,241,539,883 | 99.91% |
250 bp | 318,491 | 350,594 | 991,976,458 | 990,814,583 | 99.88% |
500 bp | 225,542 | 257,463 | 958,701,073 | 957,548,972 | 99.88% |
1 KB | 150,725 | 181,935 | 905,768,428 | 904,653,031 | 99.88% |
2.5 KB | 86,640 | 115,773 | 805,392,537 | 804,378,182 | 99.87% |
5 KB | 53,877 | 79,681 | 688,614,217 | 687,732,632 | 99.87% |
10 KB | 26,945 | 46,328 | 496,895,973 | 496,241,228 | 99.87% |
25 KB | 4592 | 11,168 | 156,852,731 | 156,634,629 | 99.86% |
50 KB | 304 | 1088 | 18,154,363 | 18,128,771 | 99.86% |
100 KB | 2 | 11 | 229,032 | 228,698 | 99.85% |
Type of Element | Number of Elements in Class | Total Sequence Length of Elements in Class | Percentage of Genome in Class |
---|---|---|---|
Retroelements | 1,633,307 | 451,748,765 bp | 36.35% |
SINEs: | 3097 | 322,078 bp | 0.03% |
Penelope | 379 | 162,757 bp | 0.01% |
LINEs: | 50,776 | 19,027,981 bp | 1.53% |
CRE/SLACS | 2499 | 879,877 bp | 0.07% |
L2/CR1/Rex | 6935 | 628,484 bp | 0.05% |
R1/LOA/Jockey | 2472 | 710,340 bp | 0.06% |
R2/R4/NeSL | 5246 | 1,337,187 bp | 0.11% |
RTE/Bov-B | 6705 | 1,395,665 bp | 0.11% |
L1/CIN4 | 23,615 | 13,263,676 bp | 1.07% |
LTR elements: | 579,434 | 432,398,706 bp | 34.80% |
BEL/Pao | 0 | 0 bp | 0.00% |
Ty1/Copia | 352,751 | 94,725,050 bp | 7.62% |
Gypsy/DIRS1 | 1,218,402 | 336,023,692 bp | 27.04% |
Retroviral | 2547 | 964,904 bp | 0.08% |
DNA transposons | 299,635 | 60,725,696 bp | 4.89% |
hobo-Activator | 76,873 | 15,027,731 bp | 1.21% |
Tc1-IS630-Pogo | 46,962 | 8,490,986 bp | 0.68% |
En-Spm | 0 | 0 bp | 0.00% |
MuDR-IS905 | 0 | 0 bp | 0.00% |
PiggyBac | 0 | 0 bp | 0.00% |
Tourist/Harbinger | 12,861 | 87,074 bp | 0.21% |
Other (Mirage, P-element, Transib) | 0 | 0 bp | 0.00% |
Rolling-circles | 1407 | 327,768 bp | 0.03% |
Unclassified: | 1,299,035 | 248,765,564 bp | 20.02% |
Total interspersed repeats: | 761,240,025 bp | 61.26% | |
Small RNA: | 3827 | 561,483 bp | 0.05% |
Satellites: | 12,272 | 2,115,469 bp | 0.17% |
Simple repeats: | 316,588 | 14,181,697 bp | 1.14% |
Low complexity: | 58,004 | 3,046,351 bp | 0.25% |
Number of Genes | Gene Status |
---|---|
1859 | Complete BUSCOs (C) |
645 | Complete and single-copy BUSCOs (S) |
1214 | Complete and duplicated BUSCOs (D) |
181 | Fragmented BUSCOs (F) |
286 | Missing BUSCOs (M) |
2326 | Total BUSCO groups searched |
Primer | Gene | Strand | Sequence (5′-3′) | Tm (°C) |
---|---|---|---|---|
rbcLM1-F | rbcL | Forward | CGGTATCCAAGTTGAGAGAG | 55 |
rbcLM1-R | rbcL | Reverse | TAAATACCACGACTTCGGTC | 55 |
matK390-F | matK | Forward | CGATCTATTCATTCAATATTTC | 49 |
matK3FKIM-R | matK | Reverse | CGTACAGTACTTTTGTGTTTACGAG | 58 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Samuels, M.E.; Lapointe, C.; Halwas, S.; Worley, A.C. Genomic Sequence of Canadian Chenopodium berlandieri: A North American Wild Relative of Quinoa. Plants 2023, 12, 467. https://doi.org/10.3390/plants12030467
Samuels ME, Lapointe C, Halwas S, Worley AC. Genomic Sequence of Canadian Chenopodium berlandieri: A North American Wild Relative of Quinoa. Plants. 2023; 12(3):467. https://doi.org/10.3390/plants12030467
Chicago/Turabian StyleSamuels, Mark E., Cassandra Lapointe, Sara Halwas, and Anne C. Worley. 2023. "Genomic Sequence of Canadian Chenopodium berlandieri: A North American Wild Relative of Quinoa" Plants 12, no. 3: 467. https://doi.org/10.3390/plants12030467
APA StyleSamuels, M. E., Lapointe, C., Halwas, S., & Worley, A. C. (2023). Genomic Sequence of Canadian Chenopodium berlandieri: A North American Wild Relative of Quinoa. Plants, 12(3), 467. https://doi.org/10.3390/plants12030467