Characterization of Pre-Breeding Wheat (Triticum aestivum L.) Germplasm for Stripe Rust Resistance Using Field Phenotyping and Genotyping
Abstract
:1. Introduction
2. Results
2.1. Evaluation of Stripe Rust Resistance
2.2. Field Evaluation
2.3. Greenhouse Evaluation
2.4. Marker Based Analysis
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Experimental Design
4.2. Field Evaluation of Yellow Rust Resistance
- 0% = Immune.
- 5 to 10% of intensity = resistant.
- 10 to 29% of intensity= moderately resistant.
- 30 to 59% of intensity = moderately susceptible.
- 60% or more of intensity= susceptible.
Calculation of AuDPC
4.3. Seedling Stage Evaluation of Yellow Rust under Epiphytotic Conditions in the Greenhouse
4.4. Molecular Characterization of Presence/Absence Polymorphism in Yr5, Yr10, Yr15 and Yr17
4.5. Statistical Analyses
- Yij = observation of ith individual (g = 1 − i) in jth replication (r = 1 − k);
- μ = general mean;
- gi = effect of the ith genotype;
- rj = effect of jth replication;
- eij = random error related with ijth observations.
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Roychowdhury, R.; Zilberman, O.; Chandrasekhar, K.; Curzon, A.Y.; Nashef, K.; Abbo, S.; Slafer, G.A.; Bonfil, D.J.; Ben-David, R. Pre-anthesis spike growth dynamics and its association to yield components among elite bread wheat cultivars (Triticum aestivum L. spp.) under Mediterranean climate. Field Crops Res. 2023, 298, 108948. [Google Scholar] [CrossRef]
- Li, Y.; Roychowdhury, R.; Govta, L.; Jaiwar, S.; Wei, Z.Z.; Shams, I.; Fahima, T. Intracellular Reactive Oxygen Species-Aided Localized Cell Death Contributing to Immune Responses against Wheat Powdery Mildew Pathogen. Phytopathology 2023, 113, 884–892. [Google Scholar] [CrossRef] [PubMed]
- Erenstein, O.; Jaleta, M.; Mottaleb, K.A.; Sonder, K.; Donovan, J.; Braun, H.J. Global Trends in Wheat Production, Consumption and Trade. In Wheat Improvement; Reynolds, M.P., Braun, H.J., Eds.; Springer: Cham, Switzerland, 2022. [Google Scholar] [CrossRef]
- Roychowdhury, R. Crop Improvement in the Era of Climate Change; IK International Publish: New Delhi, India, 2014. [Google Scholar]
- Anonymous. Available online: https://pib.gov.in/PressReleasePage.aspx?PRID=1927272 (accessed on 2 September 2023).
- Khan, G.H.; Shikari, A.B.; Wani, S.H.; Vaishnavi, R. Variability parameters in wheat—A review. Int. J. Pure Appl. Biosci. 2017, 5, 651–662. [Google Scholar] [CrossRef]
- Roychowdhury, R.; Choudhury, S.; Hasanuzzaman, M.; Srivastava, S. (Eds.) Sustainable Agriculture in the Era of Climate Change; Springer: Berlin/Heidelberg, Germany, 2020. [Google Scholar]
- Roychowdhury, R.; Das, S.P.; Gupta, A.; Parihar, P.; Chandrasekhar, K.; Sarker, U.; Kumar, A.; Ramrao, D.P.; Sudhakar, C. Multi-Omics Pipeline and Omics-Integration Approach to Decipher Plant’s Abiotic Stress Tolerance Responses. Genes 2023, 14, 1281. [Google Scholar] [CrossRef] [PubMed]
- Hussain, B.; Akpınar, B.A.; Alaux, M.; Algharib, A.M.; Sehgal, D.; Ali, Z.; Aradottir, G.I.; Batley, J.; Bellec, A.; Bentley, A.R.; et al. Capturing wheat phenotypes at the genome level. Front. Plant Sci. 2022, 13, 851079. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wei, Z.-Z.; Sela, H.; Govta, L.; Klymiuk, V.; Roychowdhury, R.; Chawla, H.S.; Ens, J.; Wiebe, K.; Bocharova, V.; et al. Dissection of a rapidly evolving wheat resistance gene cluster by long-read genome sequencing accelerated the cloning of Pm69. Plant Commun. 2023, 4, 100646. [Google Scholar] [CrossRef] [PubMed]
- Beddow, J.M.; Parday, P.G.; Chal Yuan, H.; Terrance, M.; Kriticos-Darren, J.; Braun-Hans, J.; Park, R.F.; Cuddy, W.S.; Yonow, T. Research investment implications of shifts in the global geography of wheat stripe rust. Nat. Plants 2015, 1, 1000–1038. [Google Scholar] [CrossRef] [PubMed]
- Wellings, C.R. Puccinia striiformis in Australia: A review of the incursion evolution adaptation of stripe rust in the period 2007–2014. Aust. J. Agric. Res. 2015, 58, 567–575. [Google Scholar] [CrossRef]
- Ali, S.; Algaba, J.R.; Sorensen, C.K.; Hansen, J.G.; Lassen, P.; Nazari, K.; Hodson, D.P.; Justesen, A.F.; Hovmoller, M.S. Yellow rust epidemics worldwide were caused by the pathogen races from divergent genetic lineages. Front. Plant Sci. 2017, 8, 1057. [Google Scholar] [CrossRef]
- Zheng, X.; Zhou, J.; Zhang, M.; Tan, W.; Ma, C.; Tian, R.; Yan, Q.; Li, X.; Xia, C.; Kang, K.; et al. Transfer of Durable Stripe Rust Resistance Gene Yr39 into Four Chinese Elite Wheat Cultivars Using Marker-Assisted Selection. Agronomy 2022, 12, 1791. [Google Scholar] [CrossRef]
- Chen, W.; Wellcro, S.C.; Chen, X.; Kang, Z.; Liu, T. Wheat stripe (yellow) rust caused by Puccinia striiformis f. sp. tritici. Mol. Plant Pathol. 2014, 15, 433–446. [Google Scholar] [CrossRef] [PubMed]
- Murray, G.M.; Ellison, P.J.; Watson, A.; Cullis, B.R. The relationship between wheat yield and stripe rust as affected by length of epidemic and temperature at the grain development stage of crop growth. Plant Pathol. 1994, 43, 397–405. [Google Scholar] [CrossRef]
- Singh, R.P.; Singh, P.K.; Rutkoski, J.; Hodson, D.P.; He, X.; Jørgensen, L.N.; Hovmøller, M.S.; Huerta-Espino, J. Disease impact on wheat yield potential and prospects of genetic control. Annu. Rev. Phytopathol. 2016, 54, 303–322. [Google Scholar] [CrossRef] [PubMed]
- El Messoadi, K.; El Hanafi, S.; Gataa, Z.E.; Kehel, Z.; Bouhouch, Y.; Tadesse, W. Genome wide association study for stripe rust resistance in spring bread wheat (Triticum aestivum L.). J. Plant Pathol. 2022, 104, 1049–1059. [Google Scholar] [CrossRef]
- Singh, R.P.; William, H.M.; Huerta-Espino, J.; Rosewarne, G. Wheat rust in Asia: Meeting the challenges with old and new technologies, in new directions for a diverse planet. In Proceedings of the 4th International Crop Science Congress, Brisbane, Australia, 26 September–1 October 2004. [Google Scholar]
- Khan, M.A.; Wani Shafiq, A.; Kamaludin Prashar, M.; Bhardwaj, S.C. Occurrence of wheat stripe rust in Kashmir. Plant Dis. Res. 2009, 24, 54–55. [Google Scholar]
- Zhu, Z.; Cao, Q.; Han, D.; Wu, J.; Wu, L.; Tong, J.; Hao, Y. Molecular characterization and validation of adult-plant stripe rust resistance gene Yr86 in Chinese wheat cultivar Zhongmai 895. Theor. Appl. Genet. 2023, 136, 142. [Google Scholar] [CrossRef]
- Mohammad, W.H.; Jaspal, K.; Ritu, B.; Sandeep, S.; Puja, S.; Achla, S.; Rohtas, S.; Jyoti, K. Stripe rust resistance gene(s) postulation in wheat germplasm with the help of diferentials and tagged molecular markers. Sci. Rep. 2023, 13, 9007. [Google Scholar]
- Kokhmetova, A.; Rsaliyev, A.; Malysheva, A.; Atishova, M.; Kumarbayeva, M.; Keishilov, Z. Identification of Stripe Rust Resistance Genes in Common Wheat Cultivars and Breeding Lines from Kazakhstan. Plants 2021, 10, 2303. [Google Scholar] [CrossRef]
- Chen, X.; Kang, Z. Stripe Rust; Springer Science+Business Media: Berlin, Germany, 2017. [Google Scholar]
- Bhardwaj, S.C.; Singh, G.P.; Gangwar, O.P.; Prasad, P.; Kumar, S. Status of Wheat Rust Research and Progress in Rust Management-Indian Context. Agronomy 2019, 9, 892. [Google Scholar] [CrossRef]
- Saini, R.G.; Kaur, M.; Singh, B.; Sharma, S.; Nanda, G.S.; Nayar, S.K.; Gupta, A.K.; Nagarajan, S. Genes Lr48 and Lr49 for hypersensitive adult plant leaf rust resistance in wheat (Triticum aestivum L.). Euphytica 2002, 124, 365–370. [Google Scholar] [CrossRef]
- Srinivas, K.; Singh, V.K.; Srinivas, B.; Sameriya, K.K.; Kumar, U.; Gangwar, O.P.; Kumar, S.; Prasad, L.; Singh, G.P. Documentation of multi-pathotype durable resistance in exotic wheat genotypes to deadly stripe and leaf rust diseases. Cereal Res. Commun. 2023, 1–13. [Google Scholar] [CrossRef]
- Iqbal, A.; Khan, M.R.; Khan, I.M.; Shernawab, J.A.; Imtiyaz, M.; Ali, S. Molecular field-based characterization of yellow rust resistance in exotic wheat germplasm. Pak. J. Agric. 2020, 57, 1457–1467. [Google Scholar]
- Srinivas, K.; Singh, V.K.; Sameriya, K.K.; Gangwar, O.P.; Kumar, S.; Prasad, L.; Singh, G.P. Multi-environment phenotyping to identify broad-based, stable resistance in wheat germplasms against leaf and stripe rust diseases. Cereal Res. Commun. 2023, 1–14. [Google Scholar] [CrossRef]
- Ali, S.; Shah, S.J.A.; Khalil, I.H.; Raman, H.; Maqbool, K.; Ullah, W. Partial resistance to yellow rust in introduced winter wheat germplasm at the north of Pakistan. Aust. J. Crop Sci. 2009, 3, 37–43. [Google Scholar]
- Sthapit, J.; Newcomb, M.; Bonman, J.M.; Chen, X.; See, D.R. Genetic diversity for stripe rust resistance in wheat landraces and identification of accessions with resistance to stem rust and stripe rust. Crop Sci. 2014, 54, 2131–2139. [Google Scholar] [CrossRef]
- Li, Q.; Wang, B.; Chao, K.; Guo, J. Molecular Detection of Stripe Rust Resistance Gene(s) in 115 Wheat Cultivars (lines) from the Yellow and Huai River Valley Wheat Region. J. Phytopathol. 2016, 164, 11–12. [Google Scholar] [CrossRef]
- Tabassum, S. Evaluation of advance wheat lines for slow yellow rusting (Puccinia striiformis f. sp. tritici). J. Agric. Sci. 2011, 3, 239–249. [Google Scholar] [CrossRef]
- Mateen, A.; Khan Aslam, M. Identification of yellow rust virulence pattern on wheat germplasm in relation to environment conditions in Faisalabad. Glob. J. Biol. Agric. 2014, 4, 2224–3208. [Google Scholar]
- Hassan, A.; Akram, M.U.; Hussain, M.A.; Bashir, M.A.; Mostafa, Y.S.; Alamri, S.A.; Hashem, M. Screening of different wheat genotypes against leaf rust and role of environmental factors affecting disease development. J. King Saud Univ. Sci. 2022, 34, 101991. [Google Scholar] [CrossRef]
- Chen, X.; Soria, M.A.; Yan, G.; Sun, J.; Dubcovsky, J. Development of Sequence Tagged Site and Cleaved Amplified Polymorphic Sequence Markers for Wheat Stripe Rust Resistance Gene Yr5. Crop Sci. 2003, 43, 2058–2064. [Google Scholar] [CrossRef]
- Zhou, X.L.; Han, D.J.; Chen, X.M.; Gou, H.L.; Guo, S.J. Characterization and molecular mapping of stripe rust resistance gene Yr61 in winter wheat cultivar Pindong 34. Theor. Appl. Genet. 2014, 127, 935–945. [Google Scholar] [CrossRef] [PubMed]
- Sharma, S.; Bhat, P.R.; Ehdaie, B.; Close, T.J.; Lukaszewski, A.J.; Waines, J.G. Integrated genetic map and genetic analysis of a region associated with root traits on the short arm of rye chromosome 1 in bread wheat. Theor. Appl. Genet. 2009, 119, 783–793. [Google Scholar] [CrossRef] [PubMed]
- Elkot, M.; Mohammed, H.; Abd, E.-A. Molecular Identification of Some Stem Rust and Yellow Rust Resistance Genes in Egyptian Wheat and Some Exotic Genotypes. Ass. J. Agric. Sci. 2016, 47, 124–135. [Google Scholar]
- Bariana, S.; Brown, G.N.; Ahmed, N.U.; Khatkar, S.; Conner, R.L.; Wellings, C.R. Characterization of Triticum vavilovii derived stripe rust resistance using genetic, cytogenetic and molecular analyses and its marker-assisted selection. Theor. Appl. Genet. 2002, 104, 315–320. [Google Scholar] [CrossRef] [PubMed]
- Mukhtar, S.; Khan, M.A.; Paddar, B.A.; Anjum, A.; Zaffar, G.; Mir, S.A.; Naseer, S.; Bhat, M.A.; Kamaludin. Molecular characterization of wheat germplasm for stripe resistance genes (Yr5, Yr10, Yr15 and Yr18) and identification of candidate lines for stripe rust breeding in Kashmir. Indian J. Biotechnol. 2015, 14, 241–248. [Google Scholar]
- Chatrath, R.; Mishra, B.; Ortiz Ferrara, G.; Singh, S.K.; Joshi, A.K. Challenges to wheat production in South Asia. Euphytica 2007, 157, 447–456. [Google Scholar] [CrossRef]
- Murphy, L.R.; Santra, D.; Kidwell, K.; Yan, G.P.; Chen, X.M.; Garland Campbell, K.A. Linkage maps of wheat stripe rust resistance genes Yr5 and Yr15 for use in marker-assisted selection. Crop Sci. 2009, 49, 1786–1790. [Google Scholar] [CrossRef]
- Maia, N. Obtention des blestendresresistants au pietin-verse par croisementsinterspecifiquesbles × Aegilops. C. R. Acad. Agric. 1967, 53, 149–154. [Google Scholar]
- Helguera, A.; Khan, I.A.; Kolmer, J.; Liajavetzky, D.; Qi, L.Z.; Dubcovsky, J. PCR assays for the Lr37-Yr17-Sr38 cluster of rust genes and their use to develop isogenic hard red spring wheat lines. Crop Sci. 2003, 43, 1839–1847. [Google Scholar] [CrossRef]
- Dyck, P.L.; Lukow, O.M. The genetic analysis of two inter specific sources of leaf rust resistance and their effect on the quality of common wheat. Can. J. Plant Sci. 1988, 68, 633–639. [Google Scholar] [CrossRef]
- Mallick, N.; Jha, S.K.; Agarwal, P.; Mall, A.; Kumar, S.; Choudhary, M.K.; Bansal, S.; Saharan, M.S.; Sharma, J.B.; Vinod. Marker-Assisted Improvement of Bread Wheat Variety HD2967 for Leaf and Stripe Rust Resistance. Plants 2022, 11, 1152. [Google Scholar] [CrossRef]
- Prasad, P.; Gangwar, O.P.; Lata, C.; Adhikari, S.; Kumar, S.; Bhardwaj, S.C. Mehtaensis: Six-Monthly Newsletter. ICAR-Indian; Institute of Wheat and Barley Research, Regional Station: Shimla, India, 2022; Volume 42, pp. 1–41. [Google Scholar]
- Stubbs, R.W.; Prescott, J.M.; Suari, E.E.; Dubin, H.J. Cereal Disease Methodology Manual; Centro International de Maize by Trig (CIMMVT): Mexico City, Mexico, 1986. [Google Scholar]
- Peterson, R.F.; Campbell, A.B.; Hannah, A.E. A diagrammatic scale for estimating rust intensity on leaves and stems of cereals. Can. J. Res. 1948, 60, 496–500. [Google Scholar] [CrossRef]
- Kumar, S.; Singroha, G.; Bhardwaj, S.C.; Bala, R.; Saharan, M.S.; Gupta, V.; Khan, A.; Mahapatra, S.; Sivasamy, M.; Rana, V.; et al. Multienvironmental evaluation of wheat (Triticum aestivum L.) germplasm identifies donors with multiple fungal disease resistance. Genet. Resour. Crop Evol. 2019, 66, 797–808. [Google Scholar] [CrossRef]
- Stakman, E.C.; Stewart, D.M.; Loegering, W.Q. Identification of Physiologic Races of Puccinia Graminis var. tritici. United States Department of Agriculture, Agricultural Research Service: Washington, DC, USA, 1962; pp. 1–53. [Google Scholar]
- Saghai-Maroof, M.A.; Soliman, K.M.; Jorgensen, R.A.; Allard, R.W. Ribosomal DNA spacer length polymorphisms in barley: Mendelian inheritance, chromosomal location and population dynamics. Proc. Natl. Acad. Sci. USA 1984, 81, 8014–8018. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Ma, J.; Zhou, R.; Wang, X.; Jia, J. Molecular Tagging of the Yellow Rust Resistance Gene Yr10 in Common Wheat, P.I. 178383 (Triticum aestivum L.); Kluwar Academic Publishers: London, UK, 2002; Volume 124, pp. 71–73. [Google Scholar]
Source of Variation | d.f. | Disease Severity | AUDPC |
---|---|---|---|
Blocks (eliminating treatments) | 6 | 21.97 *** | 12,732.45 ** |
Treatments (ignoring blocks) | 191 | 909.80 *** | 218,729.73 ** |
Treatments (eliminating blocks) | 191 | 851.05 *** | 203,064.18 ** |
Checks | 5 | 6728.99 *** | 1,620,622.46 ** |
Varieties | 185 | 690.75 *** | 163,947.62 ** |
Check vs. variety (C vs. V) | 1 | 12,337.633 ** | 3,343,956.32 * |
Critical difference @ 5% level of significance Comparison Type | Dis. Intensity | AuDPC | |
Between two controls mean | 1.05 | 38.98 | |
Between two varieties in same block | 2.80 | 103.11 | |
Between two varieties not in same block | 3.01 | 111.37 | |
Between variety and control | 2.30 | 84.19 |
Genotype | FRI (2020–2021) | AuDPC (2020–2021) | FRI (2021–2022) | AuDPC (2021–2022) | Reaction Type |
---|---|---|---|---|---|
KWB-7 | 5R | 42.0 | 5R | 54.0 | R |
KWB-8 | 5R | 35 | 0I | 0.0 | R |
KWB-28 | 5R | 42.0 | 5R | 49.0 | R |
KWB-29 | 5R | 28.0 | 5R | 49.0 | R |
KWB-43 | 5R | 6.0 | 0I | 0.0 | R |
KWB-54 | 5R | 84.0 | 5R | 35.0 | R |
KWB-87 | 5R | 49.0 | 5R | 28.0 | R |
KWB-91 | 5R | 35 | 0I | 0.0 | R |
KWB-95 | 5R | 77.0 | 0I | 0.0 | R |
KWB-112 | 5R | 30.8 | 5R | 18.0 | R |
KWB-113 | 5R | 30.8 | 5R | 28.0 | R |
KWB-114 | 5R | 30.8 | 5R | 30.8 | R |
KWB-115 | 5R | 77.0 | 0I | 0.0 | R |
KWB-118 | 5R | 30.5 | 5R | 14.0 | R |
KWB-126 | 5R | 32.0 | 0I | 0.0 | R |
KWB-129 | 5R | 35.0 | 0I | 0.0 | R |
KWB-132 | 5R | 35.0 | 0I | 0.0 | R |
KWB-137 | 5R | 48.7 | 5R | 21.0 | R |
KWB-138 | 5R | 60.2 | 0I | 0.0 | R |
KWB-140 | 5R | 77.0 | 0I | 0.0 | R |
KWB-143 | 5R | 35.0 | 5R | 21.0 | R |
KWB-147 | 5R | 35.0 | 0I | 0.0 | R |
Avocet-Yr5 | 5R | 21.0 | 0I | 0.0 | R |
Avocet-Yr10 | 5R | 21.0 | 0I | 0.0 | R |
Avocet-Yr15 | 5R | 21.0 | 0I | 0.0 | R |
DWB-187 | 5R | 42.0 | 0I | 0.0 | R |
Genotype | 7S0 | 238S119 | 110S119 | 110S84 | 47S119 (T) | 46S119 |
---|---|---|---|---|---|---|
KWB-8 | R | R | R | R | R | R |
KWB-43 | R | R | R | R | R | R |
KWB-64 | R | R | R | R | R | R |
KWB-91 | R | R | R | R | R | R |
KWB-95 | R | R | R | R | R | R |
KWB-115 | R | R | R | R | R | R |
KWB-126 | R | R | R | R | R | R |
KWB-129 | R | R | R | R | R | R |
KWB-132 | R | R | R | R | R | R |
KWB-138 | R | R | R | R | R | R |
KWB-140 | R | R | R | R | R | R |
KWB-147 | R | R | R | R | R | R |
Sl. No | Genotype | Yr Gene/s Present | Greenhouse Screening | Field Screening |
---|---|---|---|---|
1 | KWB-8 | Yr10, Yr15, Yr17 | Resistant against all six races | Resistant |
2 | KWB-43 | Yr10, Yr5, Yr17 | Resistant against all six races | Resistant |
3 | KWB-64 | Yr10, Yr15, Yr17 | Resistant against all six races | Resistant |
4 | KWB-91 | Yr10, Yr15, Yr17 | Resistant against all six races | Resistant |
5 | KWB-95 | Yr10, Yr5, Yr17 | Resistant against all six races | Resistant |
6 | KWB-115 | Yr10, Yr15, Yr17 | Resistant against all six races | Resistant |
7 | KWB-126 | Yr10, Yr15, Yr17 | Resistant against all six races | Resistant |
8 | KWB-129 | Yr5, Yr15, Yr17 | Resistant against all six races | Resistant |
9 | KWB-132 | Yr10, Yr5, Yr17 | Resistant against all six races | Resistant |
10 | KWB-138 | Yr10, Yr15, Yr17 | Resistant against all six races | Resistant |
11 | KWB-140 | Yr5, Yr10, Yr15 | Resistant against all six races | Resistant |
12 | KWB-147 | Yr5, Yr10, Yr15 | Resistant against all six races | Resistant |
Type of Marker | Annealing Temperature | Primer Sequence R (5′ to 3′) | Primer Sequence F (5′ to 3′) | Primer Name | Chr. No | Gene | Ref. |
---|---|---|---|---|---|---|---|
STS | 45 °C | GCAAGTTTTCTCCCTAT | GTACAATTCACCTAGAT | STS-7/8 | 2B-L | Yr5 | [32] |
SSR | 52 °C | GATATAGTGGCAGCAGGATACG | GCAGACCTGTGTCATTGGTC | XPSP3000 | 1B-S | Yr10 | [54] |
SSR | 52 °C | GCGGGGGCGAAACATACACATAAAAACA | GTACAATTCACCTAGAGT | X-barc8 | 1B-S | Yr15 | [38] |
SSR | 65 °C | TGCAGCTACAGCAGTATGTACACAAAA | AGGGGCTACTGACCAAGGCT | VENTRIUP, LN2 | 2A-S | Yr17 | [40] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ul Islam, B.; Mir, S.; Dar, M.S.; Khan, G.H.; Shikari, A.B.; Sofi, N.u.R.; Mohiddin, F.; Ahangar, M.A.; Jehangir, I.A.; Kumar, S.; et al. Characterization of Pre-Breeding Wheat (Triticum aestivum L.) Germplasm for Stripe Rust Resistance Using Field Phenotyping and Genotyping. Plants 2023, 12, 3239. https://doi.org/10.3390/plants12183239
Ul Islam B, Mir S, Dar MS, Khan GH, Shikari AB, Sofi NuR, Mohiddin F, Ahangar MA, Jehangir IA, Kumar S, et al. Characterization of Pre-Breeding Wheat (Triticum aestivum L.) Germplasm for Stripe Rust Resistance Using Field Phenotyping and Genotyping. Plants. 2023; 12(18):3239. https://doi.org/10.3390/plants12183239
Chicago/Turabian StyleUl Islam, Basharat, Saba Mir, Mohammad Saleem Dar, Gazala H. Khan, Asif B. Shikari, Najeeb ul Rehman Sofi, Fayaz Mohiddin, Mohammad Ashraf Ahangar, Intikhab Aalum Jehangir, Satish Kumar, and et al. 2023. "Characterization of Pre-Breeding Wheat (Triticum aestivum L.) Germplasm for Stripe Rust Resistance Using Field Phenotyping and Genotyping" Plants 12, no. 18: 3239. https://doi.org/10.3390/plants12183239
APA StyleUl Islam, B., Mir, S., Dar, M. S., Khan, G. H., Shikari, A. B., Sofi, N. u. R., Mohiddin, F., Ahangar, M. A., Jehangir, I. A., Kumar, S., Singh, G., & Wani, S. H. (2023). Characterization of Pre-Breeding Wheat (Triticum aestivum L.) Germplasm for Stripe Rust Resistance Using Field Phenotyping and Genotyping. Plants, 12(18), 3239. https://doi.org/10.3390/plants12183239