Virus-Induced Gene Silencing in the Tea Plant (Camellia sinensis)
Abstract
:1. Introduction
2. Results
2.1. CsPDS Sequence Analysis
2.2. pTRV2-CsPDS Vector Construction
2.3. Silencing of CsPDS in the Tea Plant
2.4. Evaluation of the Silencing Effect on Photobleached Leaves
3. Materials and Methods
3.1. Plant Materials
3.2. CsPDS Cloning
3.3. Vector Construction
3.4. Agroinfiltration of Tea Plant Seedlings
3.5. Identification of Infected Plants
3.6. Quantification of Chlorophyll A/B
3.7. Quantitative Real-Time Reverse Transcription PCR (qRT-PCR)
3.8. Statistical Analysis
4. Discussion and Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Mondal, T.K.; Bhattacharya, A.; Laxmikumaran, M.; Singh Ahuja, P. Recent advances of tea (Camellia sinensis) biotechnology. Plant Cell Tissue Organ Cult. 2004, 76, 195–254. [Google Scholar]
- Drew, L. The growth of tea. Nature 2019, 566, S2–S4. [Google Scholar] [PubMed]
- Zhang, L.; Ho, C.T.; Zhou, J.; Santos, J.S.; Armstrong, L.; Granato, D. Chemistry and biological activities of processed Camellia sinensis teas: A comprehensive review. Compr. Rev. Food Sci. Food Saf. 2019, 18, 1474–1495. [Google Scholar]
- Nakayama, M.; Toda, M.; Okubo, S.; Shimamura, T. Inhibition of influenza virus infection by tea. Lett. Appl. Microbiol. 1990, 11, 38–40. [Google Scholar]
- Zhou, J.; Li, R.; Jia, Y.; Wang, Y.; Liu, J.; Panichayupakaranant, P.; Chen, H. Recent progress in natural anticancer agents discovery from tea (Camellia sinensis): A review. Recent Patents Anti-Cancer Drug Discov. 2022, 17, 343–357. [Google Scholar]
- Xia, E.; Zhang, H.; Sheng, J.; Li, K.; Zhang, Q.; Kim, C.; Zhang, Y.; Liu, Y.; Zhu, T.; Li, W.; et al. The tea tree genome provides insights into tea flavor and independent evolution of caffeine biosynthesis. Mol. Plant 2017, 10, 866–877. [Google Scholar]
- Wei, C.; Yang, H.; Wang, S.; Zhao, J.; Liu, C.; Gao, L.; Xia, E.; Lu, Y.; Tai, Y.; She, G.; et al. Draft genome sequence of Camellia sinensis var.sinensis provides insights into the evolution of the tea genome and tea quality. Proc. Natl. Acad. Sci. USA 2018, 115, E4151–E4158. [Google Scholar] [PubMed]
- Zhang, W.; Zhang, Y.; Qiu, H.; Guo, Y.; Wan, H.; Zhang, X.; Scossa, F.; Alseekh, S.; Zhang, Q.; Wang, P.; et al. Genome assembly of wild tea tree dasz reveals pedigree and selection history of tea varieties. Nat. Commun. 2020, 11, 3719. [Google Scholar]
- Xia, E.; Tong, W.; Hou, Y.; An, Y.; Chen, L.; Wu, Q.; Liu, Y.; Yu, J.; Li, F.; Li, R.; et al. The reference genome of tea plant and resequencing of 81 diverse accessions provide insights into its genome evolution and adaptation. Mol. Plant 2020, 13, 1013–1026. [Google Scholar]
- Schachtsiek, J.; Hussain, T.; Azzouhri, K.; Kayser, O.; Stehle, F. Virus-induced gene silencing (vigs) in Cannabis sativa L. Plant Methods 2019, 15, 157. [Google Scholar]
- Burch-Smith, T.M.; Anderson, J.C.; Martin, G.B.; Dinesh-Kumar, S.P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. Plant J. 2004, 39, 734–746. [Google Scholar] [CrossRef]
- Tang, Y.; Wang, F.; Zhao, J.; Xie, K.; Hong, Y.; Liu, Y. Virus-based microrna expression for gene functional analysis in plants. Plant Physiol. 2010, 153, 632–641. [Google Scholar] [CrossRef] [PubMed]
- Lu, R. Virus-induced gene silencing in plants. Methods 2003, 30, 296–303. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Sun, B.; Cai, W.; Zhou, X.; Mao, Y.; Chen, C.; Wei, J.; Cao, B.; Chen, C.; Chen, G.; et al. Natural variations in the myb transcription factor myb31 determine the evolution of extremely pungent peppers. New Phytol. 2019, 223, 922–938. [Google Scholar] [CrossRef]
- Li, X.; Zhang, J.; Wu, Z.; Lai, B.; Huang, X.; Qin, Y.; Wang, H.; Hu, G. Functional characterization of a glucosyltransferase gene, lcufgt1, involved in the formation of cyanidin glucoside in the pericarp of litchi chinensis. Physiol. Plant. 2016, 156, 139–149. [Google Scholar] [CrossRef]
- Gao, X.; Wheeler, T.; Li, Z.; Kenerley, C.M.; He, P.; Shan, L. Silencing ghndr1 and ghmkk2 compromises cotton resistance to verticillium wilt. Plant J. 2011, 66, 293–305. [Google Scholar] [CrossRef]
- Wang, Z.; Meng, D.; Wang, A.; Li, T.; Jiang, S.; Cong, P.; Li, T. The methylation of thepcmyb10 promoter is associated with green-skinned sport in max red bartlett pear. Plant Physiol. 2013, 162, 885–896. [Google Scholar] [CrossRef] [PubMed]
- Jia, H.F.; Guo, J.X.; Qin, L.; Shen, Y.Y. Virus-induced ppchlh gene silencing in peach leaves (Prunus persica). J. Hortic. Sci. Biotechnol. 2015, 85, 528–532. [Google Scholar] [CrossRef]
- Li, T.; Tan, D.; Liu, Z.; Jiang, Z.; Wei, Y.; Zhang, L.; Li, X.; Yuan, H.; Wang, A. Applemdacs6 regulates ethylene biosynthesis during fruit development involving ethylene-responsive factor. Plant Cell Physiol. 2015, 56, 1909–1917. [Google Scholar] [CrossRef]
- Xu, H.; Xu, L.; Yang, P.; Cao, Y.; Tang, Y.; He, G.; Yuan, S.; Lei, J.; Ming, J. Virus-induced Phytoene Desaturase (PDS) gene silencing using Tobacco Rattle Virus in Lilium × formolongi. Hortic. Plant J. 2019, 5, 31–38. [Google Scholar] [CrossRef]
- Zhou, Y.; Deng, Y.; Liu, D.; Wang, H.; Zhang, X.; Liu, T.; Wang, J.; Li, Y.; Ou, L.; Liu, F.; et al. Promoting virus-induced gene silencing of pepper genes by a heterologous viral silencing suppressor. Plant Biotechnol. J. 2021, 19, 2398–2400. [Google Scholar] [CrossRef] [PubMed]
- Kumagai, M.H.; Donson, J.; Della-Cioppa, G.; Harvey, D.; Hanley, K.; Grill, L.K. Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived rna. Proc. Natl. Acad. Sci. USA 1995, 92, 1679–1683. [Google Scholar] [CrossRef] [PubMed]
- Gosti, F.; Beaudoin, N.; Serizet, C.; Webb, A.A.R.; Vartanian, N.; Giraudat, J. Abi1 protein phosphatase 2c is a negative regulator of abscisic acid signaling. Plant Cell 1999, 11, 1897–1909. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Schiff, M.; Dinesh-Kumar, S.P. Virus-induced gene silencing in tomato. Plant J. 2002, 31, 777–786. [Google Scholar] [CrossRef]
- Peng-Fei, G.; Fei-Hu, X.; Ze-Yu, Z.; Kai-Qiang, H.; Kai, C.; Wen-Tao, W.; Jia-Zhi, D.; Lian-Feng, G. Research progress of plant vigs technology and its application in forestry science. Biotechnol. Bull. 2021, 37, 141–153. [Google Scholar]
- Qin, G.; Gu, H.; Ma, L.; Peng, Y.; Deng, X.W.; Chen, Z.; Qu, L. Disruption of phytoene desaturase gene results in albino and dwarf phenotypes in arabidopsis by impairing chlorophyll, carotenoid, and gibberellin biosynthesis. Cell Res. 2007, 17, 471–482. [Google Scholar] [CrossRef]
- Zeng, H.; Xie, Y.; Liu, G.; Wei, Y.; Hu, W.; Shi, H. Agrobacterium-mediated gene transient overexpression and tobacco rattle virus (trv)-based gene silencing in cassava. Int. J. Mol. Sci. 2019, 20, 3976. [Google Scholar] [CrossRef] [PubMed]
- Xia, E.H.; Li, F.D.; Tong, W.; Li, P.H.; Wu, Q.; Zhao, H.J.; Ge, R.H.; Li, R.P.; Li, Y.Y.; Zhang, Z.Z.; et al. Tea plant information archive: A comprehensive genomics and bioinformatics platform for tea plant. Plant Biotechnol. J. 2019, 17, 1938–1953. [Google Scholar] [CrossRef]
- Xu, P.; Zhang, Y.; Kang, L.; Roossinck, M.J.; Mysore, K.S. Computational estimation and experimental verification of off-target silencing during posttranscriptional gene silencing in plants. Plant Physiol. 2006, 142, 429–440. [Google Scholar] [CrossRef]
- Sun, B.; Zhou, X.; Chen, C.; Chen, C.; Chen, K.; Chen, M.; Liu, S.; Chen, G.; Cao, B.; Cao, F.; et al. Coexpression network analysis reveals an myb transcriptional activator involved in capsaicinoid biosynthesis in hot peppers. Hortic. Res. 2020, 7, 162. [Google Scholar] [CrossRef]
- Zhen, X.F.L.W. Comparisonon methods of chlorophyll extraction in Camellia sinensis. J. Tea Commun. 2016, 43, 37–40. [Google Scholar]
- Li, J.; Liu, S.; Chen, P.; Cai, J.; Tang, S.; Yang, W.; Cao, F.; Zheng, P.; Sun, B. Systematic analysis of the r2r3-myb family in Camellia sinensis: Evidence for galloylated catechins biosynthesis regulation. Front. Plant Sci. 2022, 12, 782220. [Google Scholar] [CrossRef] [PubMed]
- Hou, T.; Huang, M.; Liao, Y.; Lu, S.; Long, Z.; Yin, J.; Li, C. Virus-induced gene silencing (vigs) for functional analysis of genes involved in the regulation of anthocyanin biosynthesis in the perianth of phalaenopsis-type dendrobium hybrids. Sci. Hortic. 2023, 307, 111485. [Google Scholar] [CrossRef]
- Hong, M.; Chi, Z.; Wang, Y.; Tang, Y.; Deng, Q.; He, M.; Wang, R.; He, Y. Expression of a chromoplast-specific lycopene β-cyclase gene (cyc-b) is implicated in carotenoid accumulation and coloration in the loquat. Biomolecules 2019, 9, 874. [Google Scholar] [CrossRef]
- Ruiz, M.T.; Voinnet, O.; Baulcombe, D.C. Initiation and maintenance of virus-induced gene silencing. Plant Cell 1998, 10, 937–946. [Google Scholar] [CrossRef]
- Tuttle, J.R.; Idris, A.M.; Brown, J.K.; Haigler, C.H.; Robertson, D. Geminivirus-mediated gene silencing fromcotton leaf crumple virus is enhanced by low temperature in cotton. Plant Physiol. 2008, 148, 41–50. [Google Scholar] [CrossRef]
- Heyes, D.J.; Hunter, C.N. Making light work of enzyme catalysis: Protochlorophyllide oxidoreductase. Trends Biochem. Sci. 2005, 30, 642–649. [Google Scholar] [CrossRef]
- Li, G.; Li, Y.; Yao, X.; Lu, L. Establishment of a virus-induced gene-silencing (vigs) system in tea plant and its use in the functional analysis of cstcs1. Int. J. Mol. Sci. 2023, 24, 392. [Google Scholar] [CrossRef]
- Lange, M.; Yellina, A.L.; Orashakova, S.; Becker, A. Virus-induced gene silencing (vigs) in plants: An overview of target species and the virus-derived vector systems. In Virus-Induced Gene Silencing. Methods in Molecular Biology; Becker, A., Ed.; Humana Press: Totowa, NJ, USA, 2013; Volume 975, pp. 1–14. [Google Scholar]
- Senthil-Kumar, M.; Mysore, K.S. New dimensions for vigs in plant functional genomics. Trends Plant Sci. 2011, 16, 656–665. [Google Scholar] [CrossRef]
- Gao, X.; Britt, R.C., Jr.; Shan, L.; He, P. Agrobacterium-mediated virus-induced gene silencing assay in cotton. J. Vis. Exp. 2011, e2938. [Google Scholar]
- Ma, Q.; Sun, M.; Lu, J.; Liu, Y.; You, C.; Hao, Y. An apple cipk protein kinase targets a novel residue of areb transcription factor for aba-dependent phosphorylation. Plant Cell Environ. 2017, 40, 2207–2219. [Google Scholar] [CrossRef] [PubMed]
- Zhai, R.; Wang, Z.; Zhang, S.; Meng, G.; Song, L.; Wang, Z.; Li, P.; Ma, F.; Xu, L. Two myb transcription factors regulate flavonoid biosynthesis in pear fruit (Pyrus bretschneideri rehd.). J. Exp. Bot. 2016, 67, 1275–1284. [Google Scholar] [CrossRef] [PubMed]
- Deng, C.; Zhang, F.; Wang, J.; Li, Y.; Huang, H.; Dai, S. Tobacco rattle virus-induced phytoene desaturase (pds) silencing in centaurea cyanus. Hortic. Plant J. 2021, 7, 159–166. [Google Scholar] [CrossRef]
- Liu, E.; Page, J.E. Optimized cdna libraries for virus-induced gene silencing (vigs) using tobacco rattle virus. Plant Methods 2008, 4, 5. [Google Scholar] [CrossRef] [PubMed]
- Hao, M.; Hang, Q.; Shi, G. Application and prospect of virus-induced gene silencing in crop gene function research. J. Agric. Sci. Technol. 2022, 24, 1–13. [Google Scholar]
Description | Primer Name | Primer Sequence |
---|---|---|
Gene cloning | CsPDS | F: ATGTCTCAATTTGGACAAGTTTCC |
R: TTACACGACACTTGCCTCGGCCA | ||
Vector construction | pTRV2-CsPDS | F: agaaggcctccatggggatccGGAGTTCCTGTTATAAATGTTCACATATG |
R: tgtcttcgggacatgcccgggTCATCACTACATGAGATCCATTCCTC | ||
Positive clones’ detection | pTRV2 | F: TGAGGGAAAAGTAGAGAACG |
R: CCTATGGTAAGACAATGAGT | ||
TRV virus verification | pTRV1-CP | F: TTACAGGTTATTTGGGCTAG |
R: CCGGGTTCAATTCCTTATC | ||
TRV virus verification | pTRV2-CP | F: ATATTCCTGCGAATCCAAACAC |
R: GAA ACTCAAATGCTACCAACGA | ||
qRT-PCR analysis | qCsPDS | F: TACTTCCCGCCGTCCAGATAAAC |
R: AAGCCAGTCTCATACCAGTCTCCAT | ||
qRT-PCR analysis | qCsActin | F: GCCATATTTGATTGGAATGG |
R: GGTGCCACAACCTTGATCTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, W.; Chen, X.; Chen, J.; Zheng, P.; Liu, S.; Tan, X.; Sun, B. Virus-Induced Gene Silencing in the Tea Plant (Camellia sinensis). Plants 2023, 12, 3162. https://doi.org/10.3390/plants12173162
Yang W, Chen X, Chen J, Zheng P, Liu S, Tan X, Sun B. Virus-Induced Gene Silencing in the Tea Plant (Camellia sinensis). Plants. 2023; 12(17):3162. https://doi.org/10.3390/plants12173162
Chicago/Turabian StyleYang, Wei, Xianya Chen, Jiahao Chen, Peng Zheng, Shaoqun Liu, Xindong Tan, and Binmei Sun. 2023. "Virus-Induced Gene Silencing in the Tea Plant (Camellia sinensis)" Plants 12, no. 17: 3162. https://doi.org/10.3390/plants12173162
APA StyleYang, W., Chen, X., Chen, J., Zheng, P., Liu, S., Tan, X., & Sun, B. (2023). Virus-Induced Gene Silencing in the Tea Plant (Camellia sinensis). Plants, 12(17), 3162. https://doi.org/10.3390/plants12173162