Isolation of Methane Enriched Bacterial Communities and Application as Wheat Biofertilizer under Drought Conditions: An Environmental Contribution
Abstract
1. Introduction
2. Materials and Methods
2.1. Metabolic Water Output Simulations
2.2. Soil Samples
2.3. Enrichment of Methanotrophs from Soil Samples
2.4. Plant-Growth Condition and Bacterial Inoculation
2.5. Seed Inoculation and Plant Sampling
2.6. Extraction of Nucleic Acids, and Next-Generation Sequencing
2.7. Next-Generation Sequencing Postprocess
2.8. Plant-Growth-Promoting Traits
2.8.1. Phosphate Solubilization Assay
2.8.2. Plant Hormone Production
2.8.3. PCR for mxaF, pmoA, nifH, nirK, and gst Genes
2.9. Statistical Analysis
3. Results
3.1. CH4-Derived Metabolic Water Output
3.2. Enrichment Studies
3.3. Taxonomical Characterization of Methane-Enriched Bacteria
3.4. Plant-Growth-Promotion of the Methane-Enriched Communities
3.5. PGPR Traits of Nonmethanotrophic Isolates
3.6. Characterization of the Single-Carbon Metabolism in Methane-Enriched Cultures
3.7. Methane Preserves Soil Water-Holding Capacity
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Broecker, W.S. Climatic Change: Are We on the Brink of a Pronounced Global Warming? Science 1975, 189, 460–463. [Google Scholar] [CrossRef] [PubMed]
- Shindell, D.; Kuylenstierna, J.C.; Vignati, E.; van Dingenen, R.; Amann, M.; Klimont, Z.; Anenberg, S.C.; Muller, N.; Janssens-Maenhout, G.; Raes, F.; et al. Shindell Simultaneously Mitigating Near-Term Climate Change and Improving Human Health and Food Security. Science 2012, 335, 183–189. [Google Scholar] [CrossRef] [PubMed]
- Jackson, R.B.; Abernethy, S.; Canadell, J.G.; Cargnello, M.; Davis, S.J.; Féron, S.; Fuss, S.; Heyer, A.J.; Hong, C.; Jones, C.D.; et al. Atmospheric Methane Removal: A Research Agenda. Philos. Trans. R. Soc. A 2021, 379, 20200454. [Google Scholar] [CrossRef] [PubMed]
- Ocko, I.B.; Sun, T.; Shindell, D.; Oppenheimer, M.; Hristov, A.N.; Pacala, S.W.; Mauzerall, D.L.; Xu, Y.; Hamburg, S.P. Acting Rapidly to Deploy Readily Available Methane Mitigation Measures by Sector Can Immediately Slow Global Warming. Environ. Res. Lett. 2021, 16, 054042. [Google Scholar] [CrossRef]
- Yoon, S.; Carey, J.N.; Semrau, J.D. Feasibility of Atmospheric Methane Removal Using Methanotrophic Biotrickling Filters. Appl. Microbiol. Biotechnol. 2009, 83, 949–956. [Google Scholar] [CrossRef]
- Pascual, J.A.; Ros, M.; Martínez, J.; Carmona, F.; Bernabé, A.; Torres, R.; Lucena, T.; Aznar, R.; Arahal, D.R.; Fernández, F. Methylobacterium Symbioticum Sp. Nov., a New Species Isolated from Spores of Glomus Iranicum Var. Tenuihypharum. Curr. Microbiol. 2020, 77, 2031–2041. [Google Scholar] [CrossRef]
- Madhaiyan, M.; Poonguzhali, S.; Sa, T. Characterization of 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Containing Methylobacterium Oryzae and Interactions with Auxins and ACC Regulation of Ethylene in Canola (Brassica Campestris). Planta 2007, 226, 867–876. [Google Scholar] [CrossRef]
- Madhaiyan, M.; Poonguzhali, S.; Ryu, J.; Sa, T. Regulation of Ethylene Levels in Canola (Brassica Campestris) by 1-Aminocyclopropane-1-Carboxylate Deaminase-Containing Methylobacterium Fujisawaense. Planta 2006, 224, 268–278. [Google Scholar] [CrossRef]
- de Aquino, G.S.; Ventura, M.U.; Alexandrino, R.P.; Michelon, T.A.; de Araujo Pescador, P.G.; Nicio, T.T.; Watanabe, V.S.; Diniz, T.G.; de Oliveira, A.L.M.; Hata, F.T. Plant-Promoting Rhizobacteria Methylobacterium Komagatae Increases Crambe Yields, Root System and Plant Height. Ind. Crops Prod. 2018, 121, 277–281. [Google Scholar] [CrossRef]
- Shaffique, S.; Khan, M.A.; Imran, M.; Kang, S.-M.; Park, Y.-S.; Wani, S.H.; Lee, I.-J. Research Progress in the Field of Microbial Mitigation of Drought Stress in Plants. Front. Plant Sci. 2022, 13, 870626. [Google Scholar] [CrossRef]
- Manzanera, M. Dealing with Water Stress and Microbial Preservation. Environ. Microbiol. 2021, 23, 3351–3359. [Google Scholar] [CrossRef] [PubMed]
- Herrmann, L.; Lesueur, D. Challenges of Formulation and Quality of Biofertilizers for Successful Inoculation. Appl. Microbiol. Biotechnol. 2013, 97, 8859–8873. [Google Scholar] [CrossRef] [PubMed]
- Barros-Rodríguez, A.; Rangseekaew, P.; Lasudee, K.; Pathom-aree, W.; Manzanera, M. Impacts of Agriculture on the Environment and Soil Microbial Biodiversity. Plants 2021, 10, 2325. [Google Scholar] [CrossRef] [PubMed]
- Daryanto, S.; Wang, L.; Jacinthe, P.-A. Global Synthesis of Drought Effects on Maize and Wheat Production. PLoS ONE 2016, 11, e0156362. [Google Scholar] [CrossRef] [PubMed]
- Akberdin, I.R.; Collins, D.A.; Hamilton, R.; Oshchepkov, D.Y.; Shukla, A.K.; Nicora, C.D.; Nakayasu, E.S.; Adkins, J.N.; Kalyuzhnaya, M.G. Rare Earth Elements Alter Redox Balance in Methylomicrobium Alcaliphilum 20ZR. Front. Microbiol. 2018, 9, 2735. [Google Scholar] [CrossRef] [PubMed]
- Khmelenina, V.N.; Kalyuzhnaya, M.G.; Starostina, N.G.; Suzina, N.E.; Trotsenko, Y.A. Isolation and Characterization of Halotolerant Alkaliphilic Methanotrophic Bacteria from Tuva Soda Lakes. Curr. Microbiol. 1997, 35, 257–261. [Google Scholar] [CrossRef]
- Ojala, D.S.; Beck, D.A.C.; Kalyuzhnaya, M.G. Genetic Systems for Moderately Halo(Alkali)Philic Bacteria of the Genus Methylomicrobium. In Methods in Enzymology; Elsevier: Amsterdam, The Netherlands, 2011; Volume 495, pp. 99–118. ISBN 978-0-12-386905-0. [Google Scholar]
- Calvo, C.; Rodríguez-Calvo, A.; Robledo-Mahón, T.; Manzanera, M.; González-López, J.; Aranda, E.; Silva-Castro, G.A. Biostimulation of Crude Oil-Polluted Soils: Influence of Initial Physicochemical and Biological Characteristics of Soil. Int. J. Environ. Sci. Technol. 2019, 16, 4925–4934. [Google Scholar] [CrossRef]
- Rangseekaew, P.; Barros-Rodríguez, A.; Pathom-aree, W.; Manzanera, M. Deep-Sea Actinobacteria Mitigate Salinity Stress in Tomato Seedlings and Their Biosafety Testing. Plants 2021, 10, 1687. [Google Scholar] [CrossRef]
- Narváez-Reinaldo, J.J.; Barba, I.; González-López, J.; Tunnacliffe, A.; Manzanera, M. Rapid Method for Isolation of Desiccation-Tolerant Strains and Xeroprotectants. Appl. Environ. Microbiol. 2010, 76, 5254–5262. [Google Scholar] [CrossRef]
- Takahashi, S.; Tomita, J.; Nishioka, K.; Hisada, T.; Nishijima, M. Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing. PLoS ONE 2014, 9, e105592. [Google Scholar] [CrossRef]
- Schloss, P.D. Application of a Database-Independent Approach To Assess the Quality of Operational Taxonomic Unit Picking Methods. mSystems 2016, 1, e00027-16. [Google Scholar] [CrossRef] [PubMed]
- Unno, T. Bioinformatic Suggestions on MiSeq-Based Microbial Community Analysis. J. Microbiol. Biotechnol. 2015, 25, 765–770. [Google Scholar] [CrossRef] [PubMed]
- Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. VSEARCH: A Versatile Open Source Tool for Metagenomics. PeerJ 2016, 4, e2584. [Google Scholar] [CrossRef]
- Nierychlo, M.; Andersen, K.S.; Xu, Y.; Green, N.; Jiang, C.; Albertsen, M.; Dueholm, M.S.; Nielsen, P.H. MiDAS 3: An Ecosystem-Specific Reference Database, Taxonomy and Knowledge Platform for Activated Sludge and Anaerobic Digesters Reveals Species-Level Microbiome Composition of Activated Sludge. Water Res. 2020, 182, 115955. [Google Scholar] [CrossRef]
- Westcott, S.L.; Schloss, P.D. De Novo Clustering Methods Outperform Reference-Based Methods for Assigning 16S RRNA Gene Sequences to Operational Taxonomic Units. PeerJ 2015, 3, e1487. [Google Scholar] [CrossRef]
- Estrada-Bonilla, G.A.; Lopes, C.M.; Durrer, A.; Alves, P.R.L.; Passaglia, N.; Cardoso, E.J.B.N. Effect of Phosphate-Solubilizing Bacteria on Phosphorus Dynamics and the Bacterial Community during Composting of Sugarcane Industry Waste. Syst. Appl. Microbiol. 2017, 40, 308–313. [Google Scholar] [CrossRef] [PubMed]
- Vílchez, J.I.; García-Fontana, C.; Román-Naranjo, D.; González-López, J.; Manzanera, M. Plant Drought Tolerance Enhancement by Trehalose Production of Desiccation-Tolerant Microorganisms. Front. Microbiol. 2016, 7, 1577. [Google Scholar] [CrossRef] [PubMed]
- McDonald, I.R.; Kenna, E.M.; Murrell, J.C. Detection of Methanotrophic Bacteria in Environmental Samples with the PCR. Appl. Environ. Microbiol. 1995, 61, 116–121. [Google Scholar] [CrossRef]
- Costello, A.M.; Lidstrom, M.E. Molecular Characterization of Functional and Phylogenetic Genes from Natural Populations of Methanotrophs in Lake Sediments. Appl. Environ. Microbiol. 1999, 65, 5066–5074. [Google Scholar] [CrossRef]
- Poly, F.; Ranjard, L.; Nazaret, S.; Gourbière, F.; Monrozier, L.J. Comparison of NifH Gene Pools in Soils and Soil Microenvironments with Contrasting Properties. Appl. Environ. Microbiol. 2001, 67, 2255–2262. [Google Scholar] [CrossRef]
- Sessitsch, A.; Hardoim, P.; Döring, J.; Weilharter, A.; Krause, A.; Woyke, T.; Mitter, B.; Hauberg-Lotte, L.; Friedrich, F.; Rahalkar, M.; et al. Functional Characteristics of an Endophyte Community Colonizing Rice Roots as Revealed by Metagenomic Analysis. MPMI 2012, 25, 28–36. [Google Scholar] [CrossRef]
- Deng, Y.; Cui, X.; Dumont, M.G. Identification of Active Aerobic Methanotrophs in Plateau Wetlands Using DNA Stable Isotope Probing. FEMS Microbiol. Lett. 2016, 363, fnw168. [Google Scholar] [CrossRef] [PubMed]
- Striegl, R.G.; McConnaughey, T.A.; Thorstenson, D.C.; Weeks, E.P.; Woodward, J.C. Consumption of Atmospheric Methane by Desert Soils. Nature 1992, 71, 145–147. [Google Scholar] [CrossRef]
- Ahlström, A.; Raupach, M.R.; Schurgers, G.; Smith, B.; Jung, M.; Reichstein, M.; Canadell, J.G. The Dominant Role of Semi-Arid Ecosystems in the Trend and Variability of the Land CO2 Sink. Science 2015, 348, 895–899. [Google Scholar] [CrossRef] [PubMed]
- Gomez, O.A. Microbial Communities Involved in Methane Cycling in the Anza Borrego Desert Soil. Master’s Thesis, San Diego State University, San Diego, CA, USA, 2019. [Google Scholar]
- Iguchi, H.; Umeda, R.; Taga, H.; Oyama, T.; Yurimoto, H.; Sakai, Y. Community Composition and Methane Oxidation Activity of Methanotrophs Associated with Duckweeds in a Fresh Water Lake. J. Biosci. Bioeng. 2019, 128, 450–455. [Google Scholar] [CrossRef]
- Jeong, S.-Y.; Kim, T.G. Development of a Novel Methanotrophic Process with the Helper Micro-Organism Hyphomicrobium sp. NM3. J. Appl. Microbiol. 2019, 126, 534–544. [Google Scholar] [CrossRef]
- Singh, R.; Ryu, J.; Kim, S.W. Microbial Consortia Including Methanotrophs: Some Benefits of Living Together. J. Microbiol. 2019, 57, 939–952. [Google Scholar] [CrossRef]
- Iguchi, H.; Yurimoto, H.; Sakai, Y. Stimulation of Methanotrophic Growth in Cocultures by Cobalamin Excreted by Rhizobia. Appl. Environ. Microbiol. 2011, 77, 8509–8515. [Google Scholar] [CrossRef]
- Sy, A.; Timmers, A.C.J.; Knief, C.; Vorholt, J.A. Methylotrophic Metabolism Is Advantageous for Methylobacterium extorquens during Colonization of Medicago truncatula under Competitive Conditions. Appl. Environ. Microbiol. 2005, 71, 7245–7252. [Google Scholar] [CrossRef]
- Gourion, B.; Rossignol, M.; Vorholt, J.A. A Proteomic Study of Methylobacterium Extorquens Reveals a Response Regulator Essential for Epiphytic Growth. Proc. Natl. Acad. Sci. USA 2006, 103, 13186–13191. [Google Scholar] [CrossRef]
- Abanda-Nkpwatt, D.; Musch, M.; Tschiersch, J.; Boettner, M.; Schwab, W. Molecular Interaction between Methylobacterium Extorquens and Seedlings: Growth Promotion, Methanol Consumption, and Localization of the Methanol Emission Site. J. Exp. Bot. 2006, 57, 4025–4032. [Google Scholar] [CrossRef]
- Ivanova, E.G.; Doronina, N.V.; Trotsenko, Y.A. Aerobic Methylobacteria Are Capable of Synthesizing. Microbiology 2001, 70, 392–397. [Google Scholar] [CrossRef]
- Koenig, R.L.; Morris, R.O.; Polacco, J.C. TRNA Is the Source of Low-Level Trans-Zeatin Production in Methylobacterium spp. J. Bacteriol. 2002, 106, 6805. [Google Scholar] [CrossRef] [PubMed]
- Meena, K.K.; Kumar, M.; Kalyuzhnaya, M.G.; Yandigeri, M.S.; Singh, D.P.; Saxena, A.K.; Arora, D.K. Epiphytic Pink-Pigmented Methylotrophic Bacteria Enhance Germination and Seedling Growth of Wheat (Triticum Aestivum) by Producing Phytohormone. Antonie Van Leeuwenhoek 2012, 101, 777–786. [Google Scholar] [CrossRef] [PubMed]
- Freyermuth, S.K.; Long, R.L.G.; Mathur, S.; Holland, M.A.; Holtsford, T.P.; Stebbins, N.E.; Morris, R.O.; Polacco, J.C. Metabolic Aspects of Plant Interaction with Commensal Methylotrophs. In Microbial Growth on C1 Compounds; Lidstrom, M.E., Tabita, F.R., Eds.; Springer: Dordrecht, The Netherlands, 1996; pp. 277–284. ISBN 978-94-010-6580-1. [Google Scholar]
- Holland, M.A. Occam’s Razor Applied to Hormonology (Are Cytokinins Produced by Plants?). Plant Physiol. 1997, 115, 865–868. [Google Scholar] [CrossRef] [PubMed]
- Cervantes, S.E.; Graham, E.A.; Andrade, J.L. Light Microhabitats, Growth and Photosynthesis of an Epiphytic Bromeliad in a Tropical Dry Forest. Plant Ecol. 2005, 179, 107–118. [Google Scholar] [CrossRef]
- Taylor, S.C.; Dalton, H.; Dow, C.S. Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase and Carbon Assimilation in Methylococcus Capsulatus (Bath). Microbiology 1981, 122, 89–94. [Google Scholar] [CrossRef]
- Rasigraf, O.; Kool, D.M.; Jetten, M.S.M.; Sinninghe Damsté, J.S.; Ettwig, K.F. Autotrophic Carbon Dioxide Fixation via the Calvin-Benson-Bassham Cycle by the Denitrifying Methanotroph “Candidatus Methylomirabilis Oxyfera”. Appl. Environ. Microbiol. 2014, 80, 2451–2460. [Google Scholar] [CrossRef]
- Chen, Y.-C. Estimation of Greenhouse Gas Emissions from a Wastewater Treatment Plant Using Membrane Bioreactor Technology. Water Environ. Res. 2019, 91, 111–118. [Google Scholar] [CrossRef]
- Hernandez Elizabeth, M.E. Suelos De Humedales Como Sumideros De Carbono Y Fuentes De Metano Wetland Soils as Carbon Sinks and Sources of Methane. Terra Latinoam. 2009, 28, 139–147. [Google Scholar]
- Laing, C.G.; Shreeve, T.G.; Pearce, D.M.E. Methane Bubbles in Surface Peat Cores: In Situ Measurements: Methane Bubbles In Surface Peat Cores. Glob. Chang. Biol. 2008, 14, 916–924. [Google Scholar] [CrossRef]
- Solomon, S. (Ed.) Climate Change 2007: The Physical Science Basis: Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. In Intergovernmental Panel on Climate Change, Intergovernmental Panel on Climate Change; Cambridge University Press: Cambridge, UK; New York, NY, USA, 2007; ISBN 978-0-521-88009-1. [Google Scholar]



| Primers | Sequence 5′→3′ | Target Gene | Hybridization Temperature | Reference |
|---|---|---|---|---|
| F1003 | GCGGCACCAACTGGGGCTGGT | mxaF | 60 °C | [29] |
| R1561 | GGGAGCCCTCCATGCTGCCC | |||
| A189gc | GGNGACTGGGACTTCTGG | pmoA | 55 °C | [30] |
| mb661 | TGCGAYCCSAARGCBGACTC | |||
| polF | TGCGAYCCSAARGCBGACTC | nifH | 55 °C | [31] |
| polR | ATSGCCATCATYTCRCCGGA | |||
| Nirk-F-Brady 96 | GACGAGAAGGGCAATTTC | nirK | 58 °C | [32] |
| Nirk-R-Brady 96 | ACTTGCCTTCGACCTTGAA | |||
| Gst_f | CTGGAAGGCCAAGACCAAC | gst | 56 °C | [32] |
| Gst_r | ACCAGATCTTGACCGAGG |
| Water Content (%) | H2O:DCW (g/g) | Ex_H2O_e Flux # |
|---|---|---|
| 80% | 4:1 | −20.71 |
| 75% | 3:1 | −10.98 |
| 67% | 2:1 | −1.24 |
| 50% | 1:1 | 8.49 |
| Sample | Relative Abundance (%) | Taxonomy (Genus) | Confidence (%) |
|---|---|---|---|
| S1 | 47.3 14.7 5.65 4.61 4.37 2.77 2.62 2.10 1.80 1.62 1.46 1.40 1.26 1.12 0.9 | Methylophilaceae_ unclassified Methylophilaceae_ unclassified Chitinophagaceae_ unclassified Terrimonas Uncultured Fam. Chitinophagaceae Methylobacter Mesorhizobium Cytophagaceae Flavobacterium Rhizobiaceae_ unclassified Pseudomonas Bradyrhyzobium Devosia Mesorhizobium Comamonadaceae_ unclassified | 92 100 100 99 100 62 97 100 100 52 100 66 100 75 100 |
| S2 | 47.7 16.8 6.53 5.53 4.23 2.71 2 1.90 1.29 1.14 1.08 1.07 0.96 | Methylophilaceae_ unclassified Methylophilaceae_ unclassified Terrimonas Uncultured Fam. Chitinophagaceae Comamonadaceae_ unclassified Cytophagaceae Rhrizobiaceae_ unclassified Pseudoxanthomonas Dyadobacter Mesorhizobium Methylobacter Pseudoxantomonas Mesorhizobium | 92 100 99 100 100 100 52 100 100 97 62 100 75 |
| SC1 | 40.1 11.2 7.7 7.2 5.3 5.01 4.74 2.12 2.09 1.54 1.53 1.09 0.9 | Methylobacter Bacteria_ unclassified Uncultured Fam. Chitinophagaceae Terrimonas Flavobacterium Methylophilus Brevundimonas Pseudoxantomonas Mesorhizobium Flavobacterium Methylophilaceae_ unclassified Caulobacter Terrimonas | 62 97 100 99 100 100 100 100 75 100 92 76 97 |
| SC2 | 25.6 15.18 11.47 8.3 4.15 3.03 2.83 2.60 2.58 2.56 2.28 2.18 1.59 1.32 1.26 1.26 1.15 1.03 0.9 | Methylobacter Uncultured, Fam. Chitinophagaceae Terrimonas Pseudoxantomonas Rhrizobiaceae_ unclassified Terrimonas Mesorhizobium Bosea Mesorhizobium Acidovorax Methylophilus Bradyrhizobium Hypomicrobium Terrimonas Methylophilaceae_ unclassified Achromobacter Caulobacter Chitinophaga Dyadobacter | 62 100 99 100 52 98 75 100 97 95 100 66 100 97 92 98 76 100 100 |
| SP1 | 28.98 17.56 12.38 6.7 5.71 4.07 3.5 2.93 1.86 1.51 1.27 1.16 0.9 | Methylobacter Methylophilaceae_ unclassified Flavobacterium Methylococcaceae_ unclassified OPB56_ge Ferrovibrio Bacteria_ unclassified Opitutus Chitinophagaceae_ unclassified Methylophilaceae_ unclassified Terrimonas Stenotrophomonas Brevundimonas | 62 92 100 100 100 99 97 100 100 100 99 100 100 |
| SP2 | 25.4 20.9 14.15 5.77 5.29 3.69 3.28 2.89 2.57 2.2 1.34 1.34 1.30 1.27 1.1 1.06 | Methylophilaceae_ unclassified Methylophilaceae_ unclassified Uncultured Fam. Chitinophagaceae Bacteria_ unclassified Chitinophagaceae_ unclassified Methylobacter Rhizobiaceae_ unclassified Methylocistaceae_ unclassified Terrimonas Ferrovibrio Brevundimonas Acidovorax OPB35_soil_group Rhizobiaceae_ unclassified Pseudoxanthomonas Devosia | 92 100 100 97 100 62 52 100 99 99 100 95 100 52 100 100 |
| RP1 | 37 18.3 10.4 8.5 5.09 4.75 2.83 2.47 2.45 0.9 | Methylobacter Flavobacterium Terrimonas Bacteria_ unclassified Uncultured, Fam. Chitinophagaceae Prosthecobacter Ferrovibrio Methylophilus OPB56_ge OPB35_soil_group_ unclassified | 62 100 99 97 100 99 99 100 100 100 |
| RP2 | 30 8.9 5 3.8 2.5 2.37 2.32 2 1.83 1.6 1.28 1.22 1.18 | Methylocistaceae_ unclassified Methylocistaceae_ unclassified Chitinophagaceae_ unclassified Comamonadaceae_ unclassified Chitinophagaceae_ unclassified Bacteria_ unclassified Ferruginibacter Chitinophagaceae Opitutus Ferrovibrio Emticicia Chitinophagaceae_ unclassified Acidovorax | 100 92 100 99 100 97 98 92 100 99 100 100 95 |
| Strain | Ref. No. | Phosphate Solubilization (mm) | Indole Acetic Acid (ppb) | mxaF | pmoA | nifH | nirK | gst | Community of Origin |
|---|---|---|---|---|---|---|---|---|---|
| SWW | 1 | - | 76.88 | - | - | - | - | - | S2 |
| SYW | 2 | 18 | - | - | - | - | - | + | S2 |
| SY | 3 | 17 | - | - | - | - | - | + | S2 |
| SMA | 4 | - | 22.61 | - | - | - | - | + | S2 |
| SBW | 5 | - | 94.18 | + | - | - | - | + | S2 |
| SYO | 6 | 27 | - | - | - | - | - | + | S2 |
| SWB | 7 | 29 | - | - | - | - | - | - | S2 |
| SWO I | 8 | - | - | - | - | - | - | - | S2 |
| SBB | 9 | 30 | - | - | - | - | - | - | S2 |
| SWO II | 10 | - | - | - | - | - | - | - | S2 |
| YCR | 11 | 9 | 500.50 | + | - | - | + | - | SC2 |
| GCR | 12 | 36 | 147.55 | - | - | - | - | - | SC2 |
| CCR | 13 | - | 660.50 | NA | NA | NA | - | NA | SC2 |
| SRMP | 14 | 15 | 180.58 | - | - | - | - | - | SRM |
| SRMW | 15 | 11 | 36.31 | + | - | - | - | - | SRM |
| SRME | 16 | 12 | 191.79 | - | - | - | - | - | SRM |
| SI | 17 | 13 | 105.38 | + | - | - | - | - | S1 |
| SCI | 18 | 18 | 108.32 | + | - | - | - | - | SC1 |
| SCII | 19 | 19 | 113.51 | - | - | - | - | - | SC2 |
| SPI | 20 | 20 | 127.84 | + | - | - | - | - | SP1 |
| SPII | 21 | 17 | 105.52 | - | - | - | - | - | SP2 |
| RPI | 22 | 19 | 137.21 | + | - | - | - | - | RP1 |
| RPII | 23 | 15 | 212.72 | + | - | - | - | - | RP2 |
| P. putida KT2240 | 18 | 4720.13 | NT |
| Sample | Wet Vermiculite Weight (WVW) | Dry Vermiculite Weight (DVW) | Vermiculite Water Content (VWC = WVW − DVW) | Plant Fresh Weight (PFW) | Plant Dry Weight (PDW) | Plant Water Content (PWC = PFW − PDW) | Total Water Content (TWC = VWC + PWC) | Relative Humidity (%) |
|---|---|---|---|---|---|---|---|---|
| S1 | 33.94 | 17.5 | 16.44 | 0.75 | 0.37 | 0.38 | 16.82 | 36.57 |
| S2 | 33.87 | 17.1 | 16.77 | 1.87 | 0.51 | 1.36 | 18.13 | 39.42 |
| SC1 | 33.94 | 16.9 | 17.04 | 1.20 | 0.48 | 0.71 | 17.76 | 38.60 |
| SC2 | 36.98 | 17.7 | 19.28 | 1.77 | 0.52 | 1.25 | 20.53 | 44.63 |
| SP1 | 34.02 | 16.8 | 17.22 | 1.09 | 0.48 | 0.61 | 17.82 | 38.75 |
| SP2 | 47.72 | 17.3 | 30.42 | 1.61 | 0.50 | 1.11 | 31.53 | 68.55 |
| RP1 | 43.91 | 16.5 | 27.41 | 1.80 | 0.58 | 1.23 | 28.63 | 62.25 |
| RP2 | 49.21 | 17.4 | 31.81 | 2.00 | 0.56 | 1.45 | 33.26 | 72.30 |
| RP1-CH4 | 30.99 | 17 | 13.99 | 1.13 | 0.39 | 0.74 | 14.73 | 32.01 |
| MSM | 39.93 | 17.7 | 22.23 | 1.48 | 0.55 | 0.93 | 23.16 | 50.36 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barros-Rodríguez, A.; García-Gálvez, C.; Pacheco, P.; Kalyuzhnaya, M.G.; Manzanera, M. Isolation of Methane Enriched Bacterial Communities and Application as Wheat Biofertilizer under Drought Conditions: An Environmental Contribution. Plants 2023, 12, 2487. https://doi.org/10.3390/plants12132487
Barros-Rodríguez A, García-Gálvez C, Pacheco P, Kalyuzhnaya MG, Manzanera M. Isolation of Methane Enriched Bacterial Communities and Application as Wheat Biofertilizer under Drought Conditions: An Environmental Contribution. Plants. 2023; 12(13):2487. https://doi.org/10.3390/plants12132487
Chicago/Turabian StyleBarros-Rodríguez, Adoración, Carlos García-Gálvez, Pamela Pacheco, Marina G. Kalyuzhnaya, and Maximino Manzanera. 2023. "Isolation of Methane Enriched Bacterial Communities and Application as Wheat Biofertilizer under Drought Conditions: An Environmental Contribution" Plants 12, no. 13: 2487. https://doi.org/10.3390/plants12132487
APA StyleBarros-Rodríguez, A., García-Gálvez, C., Pacheco, P., Kalyuzhnaya, M. G., & Manzanera, M. (2023). Isolation of Methane Enriched Bacterial Communities and Application as Wheat Biofertilizer under Drought Conditions: An Environmental Contribution. Plants, 12(13), 2487. https://doi.org/10.3390/plants12132487

