Transcriptome-Wide Integrated Analysis of the PgGT25-04 Gene in Controlling Ginsenoside Biosynthesis in Panax ginseng
Abstract
1. Introduction
2. Results
2.1. Weighted Gene Co-Expression Network Analysis (WGCNA) of PgGT Genes
2.2. Identification of Genes Associated with Ginsenoside Biosynthesis
2.3. ABA Regulates the Expression of PgGT Genes
2.4. Sequence Characterization and Expression Pattern Analysis of PgGT25-04
2.5. Construction of the PgGT25-04 Gene Silencing Vector
2.6. Genetic Transformation of Ginseng Explants
2.7. Validation of Transgenic Hairy Root Monocots
2.8. Detection of Gene Expression and Ginsenoside Content in Positive Hairy Roots
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Databases
4.2. Weighted Gene Co-Expression Network Analysis (WGCNA) of PgGT Genes
4.3. Correlation Analysis between PgGT Gene Expression Level and Key Enzyme Gene Expression Level
4.4. Culture of ABA-Induced Ginseng Hairy Roots
4.5. RNA Extraction and Fluorescence Quantitative PCR
4.6. Sequence and Expression Analysis of Desired Gene
4.7. Synthesis of PgGT25-04 Gene Silencing Sequence and Construction of Vector
4.8. Genetic Transformation of Adventitious Root of Ginseng
4.9. Detection of Positive Materials
4.10. Extraction of Ginsenosides
4.11. Determination of Ginsenoside Using High-Performance Liquid Chromatography
4.12. Statistical Analysis of Data
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Latchman, D.S. Transcription factors: An overview. Int. J. Biochem. Cell Biol. 1997, 29, 1305–1312. [Google Scholar] [CrossRef] [PubMed]
- Song, L.; Li, W.; Chen, X. Transcription factor is not just a transcription factor. Trends Plant Sci. 2022, 27, 1087–1089. [Google Scholar] [CrossRef] [PubMed]
- Sakuma, Y.; Liu, Q.; Dubouzet, J.G.; Abe, H.; Shinozaki, K.; Yamaguchi-Shinozaki, K. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochem. Biophys. Res. Commun. 2002, 290, 998–1009. [Google Scholar] [CrossRef]
- Wang, Z.; Gong, M.; Liu, Y.; Xiong, S.; Wang, M.; Zhou, J.; Zhang, Y. Towards a better understanding of TF-DNA binding prediction from genomic features. Comput. Biol. Med. 2022, 149, 105993. [Google Scholar] [CrossRef]
- Luo, J.L.; Zhao, N.; Lu, C.M. Plant Trihelix transcription factors family. Yi Chuan 2012, 34, 1551–1560. (In Chinese) [Google Scholar] [CrossRef]
- Dubos, C.; Stracke, R.; Grotewold, E.; Weisshaar, B.; Martin, C.; Lepiniec, L. MYB transcription factors in Arabidopsis. Trends Plant Sci. 2010, 15, 573–581. [Google Scholar] [CrossRef] [PubMed]
- Chu, Y.; Xiao, S.; Su, H.; Liao, B.; Zhang, J.; Xu, J.; Chen, S. Genome-wide characterization and analysis of bHLH transcription factors in Panax ginseng. Acta Pharm. Sin. B. 2018, 8, 666–677. [Google Scholar] [CrossRef]
- Feng, K.; Hou, X.L.; Xing, G.M.; Liu, J.X.; Duan, A.Q.; Xu, Z.S.; Li, M.Y.; Zhuang, J.; Xiong, A.S. Advances in AP2/ERF super-family transcription factors in Plant. Crit. Rev. Biothchnol. 2020, 40, 750–776. [Google Scholar] [CrossRef]
- Waseem, M.; Nkurikiyimfura, O.; Niyitanga, S.; Jakada, B.H.; Shaheen, I.; Aslam, M.M. GRAS transcription factors emerging regulator in plants growth, development, and multiple stresses. Mol. Biol. Rep. 2022, 49, 9673–9685. [Google Scholar] [CrossRef]
- Oda-Yamamizo, C.; Mitsuda, N.; Sakamoto, S.; Ogawa, D.; Ohme-Takagi, M.; Ohmiya, A. The NAC transcription factor ANAC046 is a positive regulator of chlorophyll degradation and senescence in Arabidopsis leaves. Sci. Rep. 2016, 6, 23609. [Google Scholar] [CrossRef]
- Zhu, M.; Bin, J.; Ding, H.; Pan, D.; Tian, Q.; Yang, X.; Wang, L.; Yue, Y. Insights into the trihelix transcription factor responses to salt and other stresses in Osmanthus fragrans. BMC Genom. 2022, 23, 334. [Google Scholar] [CrossRef] [PubMed]
- Courbier, S.; Hartman, S. WRKYs work to limit root growth in response to shade. Plant Physiol. 2022, 188, 937–938. [Google Scholar] [CrossRef] [PubMed]
- Cheng, X.; Xiong, R.; Yan, H.; Gao, Y.; Liu, H.; Wu, M.; Xiang, Y. The trihelix family of transcription factors: Functional and evolutionary analysis in Moso bamboo (Phyllostachys edulis). BMC Plant Biol. 2019, 19, 154. [Google Scholar] [CrossRef] [PubMed]
- Kaplan-Levy, R.N.; Brewer, P.B.; Quon, T.; Smyth, D.R. The trihelix family of transcription factors—Light, stress and development. Trends Plant Sci. 2012, 17, 163–171. [Google Scholar] [CrossRef]
- Nagano, Y. Several features of the GT-factor trihelix domain resemble those of the Myb DNA-binding domain. Plant Physiol. 2000, 124, 491–494. [Google Scholar] [CrossRef]
- Xie, Z.M.; Zou, H.F.; Lei, G.; Wei, W.; Zhou, Q.Y.; Niu, C.F.; Liao, Y.; Tian, A.G.; Ma, B.; Zhang, W.K.; et al. Soybean Trihelix transcription factors GmGT-2A and GmGT-2B improve plant tolerance to abiotic stresses in transgenic Arabidopsis. PLoS ONE 2009, 4, e6898. [Google Scholar] [CrossRef]
- Shibata, M.; Favero, D.S.; Takebayashi, R.; Takebayashi, A.; Kawamura, A.; Rymen, B.; Hosokawa, Y.; Sugimoto, K. Trihelix transcription factors GTL1 and DF1 prevent aberrant root hair formation in an excess nutrient condition. New Phytol. 2022, 235, 1426–1441. [Google Scholar] [CrossRef]
- Yang, W.; Hu, J.; Behera, J.R.; Kilaru, A.; Yuan, Y.; Zhai, Y.; Xu, Y.; Xie, L.; Zhang, Y.; Zhang, Q.; et al. A tree peony Trihelix transcription factor PrASIL1 represses seed oil Accumulation. Front. Plant Sci. 2021, 12, 796181. [Google Scholar] [CrossRef]
- Yu, C.; Song, L.; Song, J.; Ouyang, B.; Guo, L.; Shang, L.; Wang, T.; Li, H.; Zhang, J.; Ye, Z. ShCIGT, a Trihelix family gene, mediates cold and drought tolerance by interacting with SnRK1 in tomato. Plant Sci. 2018, 270, 140–149. [Google Scholar] [CrossRef]
- Wang, X.H.; Li, Q.T.; Chen, H.W.; Zhang, W.K.; Ma, B.; Chen, S.Y.; Zhang, J.S. Trihelix transcription factor GT-4 mediates salt tolerance via interaction with TEM2 in Arabidopsis. BMC Plant Biol. 2014, 14, 339. [Google Scholar] [CrossRef]
- Zheng, X.; Liu, H.; Ji, H.; Wang, Y.; Dong, B.; Qiao, Y.; Liu, M.; Li, X. The wheat GT factor TaGT2L1D negatively regulates drought tolerance and plant development. Sci. Rep. 2016, 6, 27042. [Google Scholar] [CrossRef] [PubMed]
- Feng, C.; Song, X.; Tang, H. Molecular cloning and expression analysis of GT-2-like genes in strawberry. 3 Biotech 2019, 9, 105. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Tang, S.; Mei, F.; Peng, X.; Li, J.; Li, X.; Yan, X.; Zeng, X.; Liu, F.; Wu, Y.; et al. BnSIP1-1, a Trihelix family gene, mediates abiotic stress tolerance and ABA signaling in Brassica napus. Front. Plant Sci. 2017, 8, 44. [Google Scholar] [CrossRef]
- Liu, H.F.; Zhang, T.T.; Liu, Y.Q.; Kang, H.; Rui, L.; Wang, D.R.; You, C.X.; Xue, X.M.; Wang, X.F. Genome-wide analysis of the 6B-INTERACTING PROTEIN1 gene family with functional characterization of MdSIP1-2 in Malus domestica. Plant Physiol. Biochem. 2023, 195, 89–100. [Google Scholar] [CrossRef] [PubMed]
- Schroeder, J.I.; Kwak, J.M.; Allen, G.J. Guard cell abscisic acid signalling and engineering drought hardiness in plants. Nature 2001, 410, 327–330. [Google Scholar] [CrossRef]
- Gagné, S.; Cluzet, S.; Mérillon, J.; Gény, L. ABA initiates anthocyanin production in grape cell cultures. J. Plant Growth Regul. 2011, 30, 1–10. [Google Scholar] [CrossRef]
- Mansouri, H.; Asrar, Z.; Mehrabani, M. Effects of gibberellic acid on primary terpenoids and delta-tetrahydrocannabinol in Cannabis sativa at flowering stage. J. Integr. Plant Biol. 2009, 51, 553–561. [Google Scholar] [CrossRef]
- Yang, D.; Sheng, D.; Duan, Q.; Liang, X.; Liang, Z.; Liu, Y. PEG and ABA trigger the burst of reactive oxygen species to increase tanshinone production in Salvia miltiorrhiza hairy roots. J. Plant Growth Regul. 2012, 31, 579–587. [Google Scholar] [CrossRef]
- Kochan, E.; Balcerczak, E.; Szymczyk, P.; Sienkiewicz, M.; Zielińska-Bliźniewska, H.; Szymańska, G. Abscisic acid regulates the 3-Hydroxy-3-methylglutaryl CoA reductase gene promoter and ginsenoside production in Panax quinquefolium hairy root cultures. Int. J. Mol. Sci. 2019, 20, 1310. [Google Scholar] [CrossRef]
- Mancuso, C.; Santangelo, R. Panax ginseng and Panax quinquefolius: From pharmacology to toxicology. Food Chem. Toxicol. 2017, 107, 362–372. [Google Scholar] [CrossRef]
- Kiefer, D.; Pantuso, T. Panax ginseng. Am. Fam. Physician 2003, 68, 1539–1542. [Google Scholar] [PubMed]
- Guo, M.; Shao, S.; Wang, D.; Zhao, D.; Wang, M. Recent progress in polysaccharides from Panax ginseng C. A. Meyer. Food Funct. 2021, 12, 494–518. [Google Scholar] [CrossRef]
- Hou, M.; Wang, R.; Zhao, S.; Wang, Z. Ginsenosides in Panax genus and their biosynthesis. Acta Pharm. Sin. B 2021, 11, 1813–1834. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.P.; Liu, Y.; Chen, C.; Xiao, H.B. Screening specific biomarkers of herbs using a metabolomics approach: A case study of Panax ginseng. Sci. Rep. 2017, 7, 4609. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.L.; Hu, Z.F.; Zhang, T.T.; Gu, A.D.; Gong, T.; Zhu, P. Progress on the studies of the key enzymes of ginsenoside biosynthesis. Molecules 2018, 23, 589. [Google Scholar] [CrossRef]
- Liu, M.; Pan, Z.; Yu, J.; Zhu, L.; Zhao, M.; Wang, Y.; Chen, P.; Liu, C.; Hu, J.; Liu, T.; et al. Transcriptome-wide characterization, evolutionary analysis, and expression pattern analysis of the NF-Y transcription factor gene family and salt stress response in Panax ginseng. BMC Plant Biol. 2022, 22, 320. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Li, K.; Sheng, S.; Wang, M.; Hua, P.; Wang, Y.; Chen, P.; Wang, K.; Zhao, M.; Wang, Y.; et al. Transcriptome analysis of MYB transcription factors family and PgMYB genes involved in salt stress resistance in Panax ginseng. BMC Plant Biol. 2022, 22, 479. [Google Scholar] [CrossRef]
- Zhu, L.; Zhao, M.; Chen, M.; Li, L.; Jiang, Y.; Liu, S.; Jiang, Y.; Wang, K.; Wang, Y.; Sun, C.; et al. The bHLH gene family and its response to saline stress in Jilin ginseng, Panax ginseng C.A. Meyer. Mol. Genet. Genom. 2020, 295, 877–890. [Google Scholar] [CrossRef]
- Chen, J.; Zhou, Y.; Zhang, Q.; Liu, Q.; Li, L.; Sun, C.; Wang, K.; Wang, Y.; Zhao, M.; Li, H.; et al. Structural variation, functional differentiation and expression characteristics of the AP2/ERF gene family and its response to cold stress and methyl jasmonate in Panax ginseng C.A. Meyer. PLoS ONE 2020, 15, e226055. [Google Scholar] [CrossRef]
- Wang, N.; Wang, K.; Li, S.; Jiang, Y.; Li, L.; Zhao, M.; Jiang, Y.; Zhu, L.; Wang, Y.; Su, Y.; et al. Transcriptome-wide identification, evolutionary analysis, and GA stress response of the GRAS gene family in Panax ginseng C. A. Meyer. Plants 2020, 9, 190. [Google Scholar] [CrossRef]
- Liu, Q.; Sun, C.; Han, J.; Li, L.; Wang, K.; Wang, Y.; Chen, J.; Zhao, M.; Wang, Y.; Zhang, M. Identification, characterization and functional differentiation of the NAC gene family and its roles in response to cold stress in ginseng, Panax ginseng C.A. Meyer. PLoS ONE 2020, 15, e234423. [Google Scholar] [CrossRef]
- Di, P.; Wang, P.; Yan, M.; Han, P.; Huang, X.; Yin, L.; Yan, Y.; Xu, Y.; Wang, Y. Genome-wide characterization and analysis of WRKY transcription factors in Panax ginseng. BMC Genom. 2021, 22, 834. [Google Scholar] [CrossRef]
- Liu, C.; Wang, K.; Yun, Z.; Liu, W.; Zhao, M.; Wang, Y.; Hu, J.; Liu, T.; Wang, N.; Wang, Y.; et al. Functional study of PgGRAS68-01 gene involved in the regulation of ginsenoside biosynthesis in Panax ginseng. Int. J. Mol. Sci. 2023, 24, 3347. [Google Scholar] [CrossRef]
- Li, J.; Chen, X.; Zhou, X.; Huang, H.; Wu, D.; Shao, J.; Zhan, R.; Chen, L. Identification of trihelix transcription factors in Pogostemon cablin reveals PatGT-1 negatively regulates patchoulol biosynthesis. Ind. Crop Prod. 2021, 161, 113182. [Google Scholar] [CrossRef]
- Jiao, H.; Hua, Z.; Zhou, J.; Hu, J.; Zhao, Y.; Wang, Y.; Yuan, Y.; Huang, L. Genome-wide analysis of Panax MADS-box genes reveals role of PgMADS41 and PgMADS44 in modulation of root development and ginsenoside synthesis. Int. J. Biol. Macromol. 2023, 233, 123648. [Google Scholar] [CrossRef]
- Langfelder, P.; Horvath, S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinform. 2008, 9, 559. [Google Scholar] [CrossRef]
- Ma, J.J.; Chen, X.; Song, Y.T.; Zhang, G.F.; Zhou, X.Q.; Que, S.P.; Mao, F.; Pervaiz, T.; Lin, J.X.; Li, Y.; et al. MADS-box transcription factors MADS11 and DAL1 interact to mediate the vegetative-to-reproductive transition in pine. Plant Physiol. 2021, 187, 247–262. [Google Scholar] [CrossRef]
- Cui, Y.X.; Xu, Z.C.; Chen, X.L.; Nie, L.P.; Wu, L.W.; Wang, Y.; Song, J.Y.; Yao, H. Genome-wide identification of abscisic acid (ABA) receptor pyrabactin resistance 1-like protein (PYL) family members and expression analysis of PYL genes in response to different concentrations of ABA stress in Glycyrrhiza uralensis. Chin. J. Nat. Med. 2020, 18, 606–611. [Google Scholar] [CrossRef] [PubMed]
- Bai, G.; Xie, H.; Yao, H.; Li, F.; Chen, X.; Zhang, Y.; Xiao, B.; Yang, J.; Li, Y.; Yang, D.H. Genome-wide identification and characterization of ABA receptor PYL/RCAR gene family reveals evolution and roles in drought stress in Nicotiana tabacum. BMC Genom. 2019, 20, 575. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.G.; Yu, H.Q.; Zhang, Y.Y.; Lai, C.X.; She, Y.H.; Li, W.C.; Fu, F.L. Interaction between abscisic acid receptor PYL3 and protein phosphatase type 2C in response to ABA signaling in maize. Gene 2014, 549, 179–185. [Google Scholar] [CrossRef] [PubMed]
- Hung, Y.H.; Slotkin, R.K. The initiation of RNA interference (RNAi) in plants. Curr. Opin. Plant Biol. 2021, 61, 102014. [Google Scholar] [CrossRef] [PubMed]
- Bai, X.; Huang, X.; Tian, S.; Peng, H.; Zhan, G.; Goher, F.; Guo, J.; Kang, Z.; Guo, J. RNAi-mediated stable silencing of TaCSN5 confers broad-spectrum resistance to Puccinia striiformis f. sp. tritici. Mol. Plant Pathol. 2021, 22, 410–421. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Geng, S.; Li, A.; Mao, Y.; Mao, L. RNAi technology for plant protection and its application in wheat. aBIOTECH 2021, 2, 365–374. [Google Scholar] [CrossRef] [PubMed]
- Lu, C.; Zhao, S.; Wei, G.; Zhao, H.; Qu, Q. Functional regulation of ginsenoside biosynthesis by RNA interferences of a UDP-glycosyltransferase gene in Panax ginseng and Panax quinquefolius. Plant Physiol. Biochem. 2017, 111, 67–76. [Google Scholar] [CrossRef]
- Zhao, C.; Xu, T.; Liang, Y.; Zhao, S.; Ren, L.; Wang, Q.; Dou, B. Functional analysis of β-amyrin synthase gene in ginsenoside biosynthesis by RNA interference. Plant Cell Rep. 2015, 34, 1307–1315. [Google Scholar] [CrossRef]
- García-Cano, E.; Magori, S.; Sun, Q.; Ding, Z.; Lazarowitz, S.G.; Citovsky, V. Interaction of Arabidopsis trihelix-domain transcription factors VFP3 and VFP5 with Agrobacterium Virulence protein VirF. PLoS ONE 2015, 10, e142128. [Google Scholar] [CrossRef]
- Wang, K.; Jiang, S.; Sun, C.; Lin, Y.; Yin, R.; Wang, Y.; Zhang, M. The spatial and temporal transcriptomic landscapes of ginseng, Panax ginseng C. A. Meyer. Sci. Rep. 2015, 5, 18283. [Google Scholar] [CrossRef]
- Wright, D.W.; Angus, T.; Enright, A.J.; Freeman, T.C. Visualisation of bioPAX networks using BioLayout Express (3D). F1000Research 2014, 3, 246. [Google Scholar] [CrossRef]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
- Kim, Y.K.; Kim, Y.B.; Uddin, M.R.; Lee, S.; Kim, S.U.; Park, S.U. Enhanced triterpene accumulation in Panax ginseng hairy roots overexpressing mevalonate-5-pyrophosphate decarboxylase and farnesyl pyrophosphate synthase. ACS Synth. Biol. 2014, 3, 773–779. [Google Scholar] [CrossRef]
- Sander, L.C. Soxhlet extractions. J. Res. Natl. Inst. Stan 2017, 122, 1. [Google Scholar] [CrossRef] [PubMed]
Gene Primer Name | Primer Sequence |
---|---|
pBI121-R | CGCAGTTCAACGCTGACATC |
35S-F | GACGCACAATCCCACTATCC |
RolC-F | ATGGCTGAAGACGACTTGTGTTC |
RolC-R | TTAGCCGATTGCAAACTT |
PgGT07-01-F | ACCATCAATCTCATCCAAGC |
PgGT07-01-R | CGGTAGCGTTTACGGAGT |
PgGT16-01-F | GGATACCTCCGCACAGCC |
PgGT16-01-R | ACCGGGGTAGGAAAGAGC |
PgGT16-02-F | CCCTCGTCGAAGCCTACC |
PgGT16-02-R | GGCGGAGCTTCTCCATTT |
PgGT28-08-F | CTTTGGAAGCAGGAGACG |
PgGT28-08-R | AAGCAGCAGCCTAGCAGT |
PgGT28-19-F | TCTGGTCCCACAGGTGCT |
PgGT28-19-R | AAACATGGGTCCAAGAAG |
PgGT25-04-F | GAGCCTATGTTTGTTCAGC |
PgGT25-04-R | GCTATCCCACTTGTCTTTG |
CYP716A52v2_3-F | TGTTGATTGGAGGCCATGAC |
CYP716A52v2_3-R | CCACTTCAATAATTCTCCTGCC |
DS_3-F | CGGAACGATTGACACTATTCTGAC |
DS_3-R | CTGACCCAATCATCGTGCTGT |
UGT71A27-F | TGCGTCCGTCTATCCCTAAAG |
UGT71A27-R | TGATGTCCTGTCCAAGAATCCTAC |
FPS_22-F | GGATGATTATCTGGATTGCTTTGG |
FPS_22-R | CAGTGCTTTTACTACCAACCAGGAG |
SE2_1-F | GCAAGGGACTGTGACATCTCTG |
SE2_1-R | TGCTGCCGACATTTCTTGG |
CYP137-F | GGACAACGAGGCAGCACTT |
CYP137-R | AAGTGAGCGACTCTGACATAGCG |
DS_1-F | CGGAACGATTGACACTATTCTGAC |
DS_1-R | CTGACCCAATCATCGTGCTGT |
SE2-4-F | TAATCGTCATCGGAGTCGCC |
SE2-4-R | ACCCGACCCCTTATCTGTGA |
ACT1-F | TGGCATCACTTTCTACAACG |
ACT1-R | TTTGTGTCATCTTCTCCCTGTT |
Time (min) | Acetonitrile (%) | Water (%) |
---|---|---|
0–40 | 18–21 | 82–79 |
40–42 | 21–26 | 79–74 |
42–46 | 26–32 | 74–68 |
46–66 | 32–33.5 | 68–66.5 |
66–71 | 33.5–38 | 66.5–62 |
71–86 | 38–65 | 62–35 |
86–91 | 65 | 35 |
91–96 | 65–85 | 35–15 |
96–103 | 85 | 15 |
103–105 | 85–18 | 15–82 |
105–106 | 18 | 82 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, L.; Hu, J.; Li, R.; Liu, C.; Jiang, Y.; Liu, T.; Liu, M.; Zhao, M.; Wang, Y.; Wang, K.; et al. Transcriptome-Wide Integrated Analysis of the PgGT25-04 Gene in Controlling Ginsenoside Biosynthesis in Panax ginseng. Plants 2023, 12, 1980. https://doi.org/10.3390/plants12101980
Zhu L, Hu J, Li R, Liu C, Jiang Y, Liu T, Liu M, Zhao M, Wang Y, Wang K, et al. Transcriptome-Wide Integrated Analysis of the PgGT25-04 Gene in Controlling Ginsenoside Biosynthesis in Panax ginseng. Plants. 2023; 12(10):1980. https://doi.org/10.3390/plants12101980
Chicago/Turabian StyleZhu, Lei, Jian Hu, Ruiqi Li, Chang Liu, Yang Jiang, Tao Liu, Mingming Liu, Mingzhu Zhao, Yi Wang, Kangyu Wang, and et al. 2023. "Transcriptome-Wide Integrated Analysis of the PgGT25-04 Gene in Controlling Ginsenoside Biosynthesis in Panax ginseng" Plants 12, no. 10: 1980. https://doi.org/10.3390/plants12101980
APA StyleZhu, L., Hu, J., Li, R., Liu, C., Jiang, Y., Liu, T., Liu, M., Zhao, M., Wang, Y., Wang, K., & Zhang, M. (2023). Transcriptome-Wide Integrated Analysis of the PgGT25-04 Gene in Controlling Ginsenoside Biosynthesis in Panax ginseng. Plants, 12(10), 1980. https://doi.org/10.3390/plants12101980