Development of the PARMS Marker of the Dominant Genic Male Sterility (DGMS) Line and Its Utilization in Rapeseed (Brassica napus L.) Breeding
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Genetic Analysis
2.3. DNA Extraction and PCR
2.4. PARMS Markers Design and Markers Analysis
2.5. PARMS Markers Validate
3. Results
3.1. Genetics Analysis of the Sterile Line 8029A and the Restorer Line 6449
3.2. Development of PARMS Markers
3.3. Validation of the PARMS Markers
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Oilseeds: World Markets and Trade. Available online: https://apps.fas.usda.gov/psdonline/circulars/oilseeds.pdf (accessed on 13 October 2021).
- Fu, T.; Zhou, Y. Progress and future development of hybrid rapeseed in China. Eng. Sci. 2013, 11, 13–18. [Google Scholar] [CrossRef]
- Friedt, W.; Tu, J.; Fu, T. Academic and economic importance of Brassica napus rapeseed. In The Brassica Napus Genome; Liu, S.S.R., Chalhoub, B., Eds.; Springer: Cham, Switzerland, 2018; pp. 1–20. [Google Scholar]
- Tian, H.Y.; Channa, S.A.; Hu, S.W. Relationships between genetic distance, combining ability and heterosis in rapeseed (Brassica napus L.). Euphytica 2017, 213, 224. [Google Scholar] [CrossRef]
- Frauen, M.; Noack, J.; Girke, A.; Paulmann, W. Ten years experience of development and cultivation of winter oilseed rape hybrids in Europe based on the MSL system. In Proceedings of the 12th International Rapeseed Congress, Wuhan, China, 26–30 March 2007. [Google Scholar]
- Government of Canada, Canadian Food Inspection Agency, Plant Health and Biosecurity Directorate. DD1996-17: Determination of Environmental Safety of Plant Genetic Systems Inc.’s (PGS) Novel Hybridization System for Rapeseed (Brassica napus L.). Available online: https://inspection.canada.ca/plant-varieties/plants-with-novel-traits/approved-under-review/decision-documents/dd1996-17/eng/1303945461567/1303945595359 (accessed on 10 June 2020).
- Pelletier, G.; Budar, F. Brassica Ogu-INRA cytoplasmic male sterility: An example of successful plant somatic fusion for hybrid seed production. In Somatic Genome Manipulation; Li, X., Donnelly, D., Jensen, T., Eds.; Springer: New York, NY, USA, 2015. [Google Scholar] [CrossRef]
- Fu, T. Production and research of rapeseed in the People’s Republic of China. Eucarpia Crucif. Newsl. 1981, 6, 6–7. [Google Scholar]
- Fu, T.; Tu, J. Present situation and prospects on the research and utilization of hybrid rapeseed. In Analects of Crop Breeding; Liu, H., Ed.; China Agricultural University Press: Beijing, China, 2002; pp. 235–250. [Google Scholar]
- Lu, G.; Yang, G.; Fu, T. Molecular mapping of a dominant genic male sterility gene Ms in rapeseed (Brassica napus). Plant Breed 2004, 123, 262–265. [Google Scholar] [CrossRef]
- Lu, W.; Liu, J.; Xin, Q.; Wan, L.; Hong, D.; Yang, G. A triallelic genetic male sterility locus in Brassica napus: An integrative strategy for its physical mapping and possible local chromosome evolution around it. Ann. Bot. 2013, 111, 305–315. [Google Scholar] [CrossRef] [Green Version]
- Zeng, X.; Yan, X.; Yuan, R.; Li, K.; Wu, Y.; Liu, F.; Luo, J.; Li, J.; Wu, G. Identification and analysis of MS5d: A gene that affects double-strand break (DSB) repair during meiosis I in Brassica napus microsporocytes. Front. Plant Sci. 2017, 7, 1966. [Google Scholar] [CrossRef] [Green Version]
- Xin, Q.; Shen, Y.; Li, X.; Lu, W.; Wang, X.; Han, X.; Dong, F.; Wan, L.; Yang, G.; Hong, D. MS5 mediates early meiotic progression and its natural variants may have applications for hybrid production in Brassica napus. Plant Cell 2016, 28, 1263. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hong, D.; Wan, L.; Liu, P.; Yang, G.; He, Q. AFLP and SCAR markers linked to the suppressor gene (Rf) of a dominant genetic male sterility in rapeseed (Brassica napus L.). Euphytica 2006, 151, 401–409. [Google Scholar] [CrossRef]
- Hong, D.; Liu, J.; Yang, G.; He, Q. Development and characterization of SCAR markers associated with a dominant genic male sterility in rapeseed. Plant Breed. 2008, 127, 69–73. [Google Scholar] [CrossRef]
- Mathias, R. A new dominant gene of male sterility in rapeseed (Brassica napus L.). Zeitschrift fur Pflanzenzuchtung 1985, 94, 170–173. [Google Scholar]
- Li, S.; Qian, Y.; Wu, Z.; Stefansson, B.R. Genetic male sterility in rape (Brassica napus L.) conditioned by interaction of genes at two loci. Can. J. Plant Sci. 1988, 68, 1115–1118. [Google Scholar] [CrossRef]
- Thomson, M.J. High-throughput SNP genotyping to accelerate crop improvement. Plant Breed. Biotechnol. 2014, 2, 195–212. [Google Scholar] [CrossRef]
- Song, L.; Tingdong, F.; Guangsheng, Y. Genetic verification of multiple allelic gene for dominant genic male sterility in 609AB (Brassica napus L.). Acta Agron. Sin. 2005, 31, 869–875. [Google Scholar] [CrossRef]
- Zeng, X.; Li, W.; Wu, Y.; Liu, F.; Luo, J.; Cao, Y.; Zhu, L.; Li, Y.; Li, J.; You, Q. Fine mapping of a dominant thermo-sensitive genic male sterility gene (BntsMs) in rapeseed (Brassica napus) with AFLP-and Brassica rapa-derived PCR markers. Theor. Appl. Genet. 2014, 127, 1733–1740. [Google Scholar] [CrossRef]
- Song, L.; Fu, T.; Tu, J.; Ma, C.; Yang, G. Molecular validation of multiple allele inheritance for dominant genic male sterility gene in Brassica napus L. Theor. Appl. Genet. 2006, 113, 55–62. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Hong, D.; Wei, L.; Liu, P.; Yang, G. Genetic analysis and molecular mapping of gene associated with dominant genic male sterility in rapeseed (Brassica napus L.). Genes Genom. 2008, 30, 523–532. [Google Scholar] [CrossRef]
- Salgotra, R.K.; Stewart, C.N. Functional markers for precision plant breeding. Int. J. Mol. Sci. 2020, 21, 4792. [Google Scholar] [CrossRef]
- Jiang, G.L. Molecular Marker-Assisted Breeding: A Plant Breeder’s Review. In Advances in Plant Breeding Strategies: Breeding, Biotechnology and Molecular Tools; Al-Khayri, J.M., Jain, S.M., Johnson, D.V., Eds.; Springer: Cham, Switzerland, 2015; pp. 431–472. [Google Scholar]
- Clarke, W.E.; Higgins, E.E.; Plieske, J.; Wieseke, R.; Sidebottom, C.; Khedikar, Y.; Batley, J.; Edwards, D.; Meng, J.; Li, R.; et al. A high-density SNP genotyping array for Brassica napus and its ancestral diploid species based on optimised selection of single-locus markers in the allotetraploid genome. Theor. Appl. Genet. 2016, 129, 1887–1899. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, C.; Ma, X.; Yao, L.; Liu, Y.; Du, F.; Yang, X.; Xu, M. qRfg3, a novel quantitative resistance locus against Gibberella stalk rot in maize. Theor. Appl. Genet. 2017, 130, 1723–1734. [Google Scholar] [CrossRef] [PubMed]
- Ignacio, J.C.I.; Zaidem, M.; Casal, C., Jr.; Dixit, S.; Kretzschmar, T.; Samaniego, J.M.; Mendioro, M.S.; Weigel, D.; Septiningsih, E.M. Genetic Mapping by Sequencing More Precisely Detects Loci Responsible for Anaerobic Germination Tolerance in Rice. Plants 2021, 10, 705. [Google Scholar] [CrossRef]
- Batley, J. Plant Genotyping: Methods and Protocols; Springer: New York, NY, USA, 2015. [Google Scholar]
- Lu, J.; Hou, J.; Ouyang, Y.; Luo, H.; Zhao, J.; Mao, C.; Han, M.; Wang, L.; Xiao, J.; Yang, Y. A direct PCR–based SNP marker–assisted selection system (D-MAS) for different crops. Mol. Breed. 2020, 40, 9. [Google Scholar] [CrossRef]
- Wang, X.; Zheng, M.; Liu, H.; Zhang, L.; Chen, F.; Zhang, W.; Fan, S.; Peng, M.; Hu, M.; Wang, H. Fine-mapping and transcriptome analysis of a candidate gene controlling plant height in Brassica napus L. Biotechnol. Biofuels 2020, 13, 42. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Liang, H.; Huang, J.; Qing, D.; Wu, H.; Zhou, W.; Chen, W.; Pan, Y.; Dai, G.; Gao, L. Development of the PARMS marker of the TAC1 gene and its utilization in rice plant architecture breeding. Euphytica 2021, 217, 49. [Google Scholar] [CrossRef]


| Marker Name | Sequences | Remarks |
|---|---|---|
| Ms5-1Fc | GAAGGTGACCAAGTTCATGCTCCAGCTACCTCCTCCTTTGTTAC | Forward primer |
| MS5-1Ft | GAAGGTCGGAGTCAACGGATTCAGCTACCTCCTCCTTTGTTGT | Forward primer |
| MS5-2Ft | GAAGGTGACCAAGTTCATGCTCTTGTTATATCTCAAGACCTAAAGGTTT | Forward primer |
| MS5-2Fa | GAAGGTCGGAGTCAACGGATTCTTGTTATATCTCAAGACCTAAAGGTTA | Forward primer |
| MS5-1R12 | AATTAATTACAAAGAAAAGCGCG | Reverse primers |
| #1 | GAAGGTGACCAAGTTCATGCT-FAM | Common primer labeled with the FAM fluorophore |
| #2 | GAAGGTCGGAGTCAACGGATT-HEX | Common primer labeled with the HEX fluorophore |
| Population | Total Individuals | Sterile Individuals | Fertile Individuals | Sterile: Fertile | Expected Mendelian Segregation Ratio | χ2 |
|---|---|---|---|---|---|---|
| BC1-1 | 238 | 116 | 122 | 0.95:1 | 1:1 | 0.15, p > 0.05 |
| F2-2 | 781 | 208 | 573 | 1:2.8 | 1:3 | 1.11, p > 0.05 |
| BC1-2 | 458 | 233 | 225 | 1.0:1 | 1:1 | 0.14, p > 0.05 |
| MS5aMS5a | MS5cMS5c | MS5eMS5e | MS5aMS5c | MS5aMS5e | MS5cMS5e | |
|---|---|---|---|---|---|---|
| MS5-1F | HEX (Green) | FAM (Blue) | HEX (Green) | HEX/FAM (Red) | HEX (Green) | HEX/FAM (Red) |
| MS5-2F | HEX (Green) | FAM (Blue) | FAM (Blue) | HEX/FAM (Red) | HEX/FAM (Red) | FAM (Blue) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Z.; Yuan, R.; Wang, M.; Hong, M.; Zhu, L.; Li, X.; Guo, R.; Wu, G.; Zeng, X. Development of the PARMS Marker of the Dominant Genic Male Sterility (DGMS) Line and Its Utilization in Rapeseed (Brassica napus L.) Breeding. Plants 2022, 11, 421. https://doi.org/10.3390/plants11030421
Li Z, Yuan R, Wang M, Hong M, Zhu L, Li X, Guo R, Wu G, Zeng X. Development of the PARMS Marker of the Dominant Genic Male Sterility (DGMS) Line and Its Utilization in Rapeseed (Brassica napus L.) Breeding. Plants. 2022; 11(3):421. https://doi.org/10.3390/plants11030421
Chicago/Turabian StyleLi, Zhen, Rong Yuan, Miao Wang, Meiyan Hong, Li Zhu, Xiaofei Li, Ruixing Guo, Gang Wu, and Xinhua Zeng. 2022. "Development of the PARMS Marker of the Dominant Genic Male Sterility (DGMS) Line and Its Utilization in Rapeseed (Brassica napus L.) Breeding" Plants 11, no. 3: 421. https://doi.org/10.3390/plants11030421
APA StyleLi, Z., Yuan, R., Wang, M., Hong, M., Zhu, L., Li, X., Guo, R., Wu, G., & Zeng, X. (2022). Development of the PARMS Marker of the Dominant Genic Male Sterility (DGMS) Line and Its Utilization in Rapeseed (Brassica napus L.) Breeding. Plants, 11(3), 421. https://doi.org/10.3390/plants11030421
