Next Article in Journal
Genetic Inheritance of Stripe Rust (Puccinia Striiformis) Resistance in Bread Wheat Breeding Lines at Seedling and Maturity Stages
Next Article in Special Issue
Caucasian Dragonheads: Phenolic Compounds, Polysaccharides, and Bioactivity of Dracocephalum austriacum and Dracocephalum botryoides
Previous Article in Journal
Antibacterial Activity against Foodborne Pathogens and Inhibitory Effect on Anti-Inflammatory Mediators’ Production of Brazilin-Enriched Extract from Caesalpinia sappan Linn
Previous Article in Special Issue
Bulgarian Medicinal Extracts as Natural Inhibitors with Antiviral and Antibacterial Activity
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative LC–LTQ–MS–MS Analysis of the Leaf Extracts of Lantana camara and Lantana montevidensis Growing in Egypt with Insights into Their Antioxidant, Anti-Inflammatory, and Cytotoxic Activities

1
Department of Pharmacognosy, Faculty of Pharmacy, Ain-Shams University, Cairo 11566, Egypt
2
Pharmacognosy Group, Department of Pharmaceutical Biosciences, Biomedical Centre, Uppsala University, P.O. Box 591, 751 24 Uppsala, Sweden
3
School of Pharmaceutical Sciences, Jilin University, Changchun 130021, China
4
Biochemistry Division, Chemistry Department, Faculty of Science, Tanta University, Tanta 31527, Egypt
5
Department of Chemistry, Faculty of Science, Menoufia University, Shebin El-Kom 32512, Egypt
6
International Research Center for Food Nutrition and Safety, Jiangsu University, Zhenjiang 212013, China
7
International Joint Research Laboratory of Intelligent Agriculture and Agri-Products Processing, Jiangsu Education Department, Jiangsu University, Zhenjiang 212013, China
8
Graduate Institute of Natural Products, College of Pharmacy, Kaohsiung Medical University, Kaohsiung 80708, Taiwan
9
Graduate Institute of Natural Products, College of Medicine, Chang Gung University, Kweishan, Taoyuan 33302, Taiwan
10
Research Center for Chinese Herbal Medicine, Graduate Institute of Health Industry Technology, College of Human Ecology, Chang Gung University of Science and Technology, Kweishan, Taoyuan 33302, Taiwan
11
Department of Anesthesiology, Chang Gung Memorial Hospital, Taoyuan 33305, Taiwan
12
Department of Chemical Engineering, Ming Chi University of Technology, New Taipei City 243303, Taiwan
13
Department of Botany and Microbiology, Faculty of Science, South Valley University, Qena 83523, Egypt
14
Department of Pharmaceutical Biology, Faculty of Pharmacy and Biotechnology, German University in Cairo, Cairo 11835, Egypt
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Plants 2022, 11(13), 1699; https://doi.org/10.3390/plants11131699
Submission received: 30 May 2022 / Revised: 20 June 2022 / Accepted: 23 June 2022 / Published: 27 June 2022

Abstract

:
Lantana camara L. and Lantana montevidensis Briq. (F. Verbenaceae) are invasive ornamental weeds native to the tropical regions of Africa and America. The leaves of both species have been traditionally used as infusions for treating fever, rheumatism, and cancer. LC–MS–MS-guided profiling of the methanolic extracts of the leaves of L. camara and L. montevidensis growing in Egypt led to the putative identification of 59 compounds belonging to terpenoids, flavonoids, iridoid glycosides, phenolic acids, and their derivatives. The in-vitro antioxidants and anti-inflammatory and anticancer activities of the two extracts were investigated. L. camara and L. montevidensis inhibited DPPH (IC50 = 34.01 ± 1.32 and 47.43 ± 1.74 µg/mL), ABTS+ (IC50 = 30.73 ± 1.42 and 40.37 ± 1.51 µg/mL), and superoxide anion (IC50 = 1.57 ± 0.19 and 1.31 ± 0.14 μg/mL) free radicals. A potent anti-inflammatory effect was observed for both species through the inhibition of elastase release in fMLF/CB-induced human neutrophils (IC50 = 2.40 ± 0.16 and 1.90 ± 0.07 μg/mL). The extracts showed significant cytotoxic activity against a panel of cancer cell lines with the most potent activity against Caco cells (IC50 = 45.65 ± 1.64 and 40.67 ± 1.52 µg/mL for L. camara and L. montevidensis, respectively). Western blotting supported by FACS analysis revealed that the extracts inhibited cancer cell proliferation, reduced metastasis, and induced apoptosis resulting in cell cycle arrest. This was achieved via increasing mRNA and protein expressions of p53 and GSK-3β as well as decreasing the expression of PI3K, Akt, and cyclin D1.

1. Introduction

Lantana sp. (Verbenaceae) is a highly invasive tropical weed that attacks more than 60% of forests worldwide [1]. The genus harbors 150 species and is native to the tropical and subtropical areas of South America, Asia, and Africa. L. camara L. is the most dominant species [2]. Although Lantana sp. is used in many countries as a decorative ornamental, the presence of pentacyclic triterpenoids, including lantadenes A and B in their leaves and seeds, has been correlated with the plant’s adverse effects, especially when ingested by animals, causing cholestasis, hepatotoxicity, and phototoxicity [2]. Lantana sp. is rich in phenolics, including flavonoids, iridoids, and phenylethanoids. It likewise contains alkaloids and furanonaphthoquinones. In some countries the fruits are edible and the whole Lantana sp. parts are used in folk medicine against fever, cancer, influenza, skin sores, chickenpox, measles, asthma, leprosy, rheumatism, and hypertension [3]. Some of these uses were proven by several studies, which reported that the leaf extracts demonstrated anti-inflammatory [4], anticancer [5], antibacterial [6], antifungal, insecticidal [7], and nematocidal activities [2]. Externally, the leaf extract is applied to the skin to heal ulcers [8] and eczema exacerbations. L. camara showed an ecological role by accumulating heavy metals from the soil in its roots [9]. In contrast to L. camara L., which is native to Africa and America, L. montevidensis Briq. is a small shrub indigenous to South American countries, such as Uruguay and Brazil. It is rich in phenolics, flavonoids, iridoids [10], and triterpenes. It shows antioxidant [11], antibacterial [12], and antiprotozoal [13] activities.
The accumulation of reactive oxygen species (ROS) is usually elicited by the improper balance between their production and elimination, resulting in oxidative stress, which may lead to chronic inflammation. The latter is a key factor that triggers numerous neurological [14], cardiovascular [15], hepatic [16], diabetic [17], and retinal disorders [18]. Neutrophil infiltration is one key parameter linked to inflammation and is characterized, among others, by the accumulation of superoxide anion free radicals, the release of elastases, the stimulation of serine proteases that can attack the host’s own proteins, such as lung elastin and fibronectin with the subsequent release of proinflammatory cytokines [19,20]. Excessive neutrophil activation is a profound phenomenon in the different stages of cancer development and the viral infection cycle, where the virus may act as a carcinogenic agent. Therefore, it is crucial to search for new agents from nature to inhibit neutrophil functioning, which can also indirectly suppress oxidative stress and carcinogenesis.
Cancer represents a serious public health concern with a large socioeconomic burden, especially in developing countries. By 2030, the worldwide cancer burden is expected to increase to 26 million new cases and 17 million deaths due to population expansion and aging [21]. Lung cancer has been reported to be the most prevailing diagnosed type and the leading cause of cancer death followed by breast, colorectal, and prostate cancer [22]. Surgical interventions, radiation, and chemotherapy are still the mainstay of cancer treatments despite their severe side effects arising from the indiscriminate destruction of normal cells. Therefore, there is a constant quest for the discovery of selective alternative therapies with better safety profiles, especially from nature [20,23].
AkT is a proto-oncogenic serine-threonine kinase that plays a role in cell proliferation and apoptosis. The activation of the PI3K/AkT pathway was observed in several cancer types. Therefore, the inhibition of PI3K/AkT signaling results in p53 activation, cell cycle arrest, and cancer cell apoptosis [24]. Glycogen synthase kinase 3 (GSK-3β) is a constitutively active serine/threonine kinase that is physiologically inhibited by PI3K. G1/S specific cyclin D1 is a mitogenic signal sensor whose degradation is regulated by GSK-3β and its gene expression is downregulated due to the negative regulation of GSK-3β on the oncogenic Wnt/β-catenin signaling. Cyclin D1 activity is normally intensified in cancer; therefore, cancers showing overexpression of cyclin D1 are susceptible to GSK-3β activation [25].
In continuation of our work (in finding new sources of pharmacologically active molecules from Egyptian flora [26,27]), we performed a detailed LC–MS–MS metabolome profiling of the polyphenol-rich leaf extracts of L. camara L. and L. montevidensis Briq. A comparative assessment of the extracts’ antioxidant potential, their inhibitory effects on neutrophil elastases, as well as their cytotoxic activities on cancer cell proliferation and metastasis supported by mechanistic studies on their effects on PI3K/AkT and GSK-3β/Cyclin D1 signaling pathways, were likewise investigated.

2. Results and Discussion

2.1. LC–LTQ–MS–MS Analysis and GNPS-Aided Annotation of L. camara and L. montevidensis Constituents

The metabolomic mass profiles of the two Lantana extracts, L. camara and L. montevidensis, were screened using the Global Natural Product Social Molecular Networking (GNPS) based on tandem mass spectrometry data (Figure 1 and Figure 2) [28,29,30] in the positive ionization mode of Lantana extract samples. The metabolites were represented by nodes in the molecular network, with chemically related metabolites clustered together. The network in Figure 2 was displayed as a pie chart to reflect the relative abundance of each ion in the analyzed Lantana extract samples. The results demonstrated a total of 157 nodes assigned for the parent ions of L. camara demonstrated in Figure 2 as yellow-colored nodes, of which, five parent ions matched five known standards in the GNP library (Table 1) belonging to pentacyclic triterpenes, sesquiterpenes, flavonoids, and amides. On the other side, a total of 153 nodes were assigned for the parent ions of L. montevidensis demonstrated in Figure 2 as blue-colored nodes, of which, four parent ions matched the known standards in the GNP library, namely palmitamide, α-humulene, coprostanone, and carminic acid. The network showed the similarities and variances of metabolites in both extracts and prescribed N1–59 as the identified metabolites (Table 1).
LC–LTQ–MS–MS analysis and molecular networking analysis resulted in the tentative identification of 59 compounds from both Lantana species, including 37 terpenoids, 3 iridoid glycosides, 11 flavonoids/flavonoid glycosides, 11 phenolic acids and their derivatives, among others (Table 1). The iridoid momordol and copaenol sesquiterpene were identified for the first time from the genus Lantana. The iridoid glycoside, durantoside, was previously identified in the roots of L. viburnoides [40]. Other identified compounds were previously reported from L. camara and L. montevidensis.
Terpenoids are the major metabolites produced by the genus Lantana [40]. Various pentacyclic triterpenoids have been reported in different Lantana species and are known for their wide range of pharmacological activities. Lantadenes A, D, and C, icterogenin, and pomonic acid identified in our studied Lantana species showed mass data following the previously reported data. Amyrin and lantabetulic acid were exclusively identified in L. montevidensis.
Flavonoids represented one of the chief constituents in the genus Lantana, particularly flavones and flavonols [40]. Vicenin-2 (m/z 594.96) was tentatively identified in L. camara based on the characteristic fragmentation patterns of C-glycosides by cross-ring cleavage of the glucose moiety and the subsequent formation of the fragment ions [M+H-120]+ [59]. The dimethoxy flavone pectolinarigenin (m/z 315.5381) was identified in both L. camara and L. montevidensis. Flavonoid glycosides, such as pectolinarin, camaroside, and lantanoside, were detected in both species. Their identification was based on the molecular ion peaks and the respective sugars lost. A fragment ion at [M+H-162]+ indicated the loss of a hexoside moiety, while a fragment ion at [M+H-204]+ corresponded to a loss of acetylhexoside.
Simple phenolic acids, such as gallic acid, ferulic acid, and coumaric acid having m/z at 170.5321, 193.3430, and 166.5324, respectively, were detected in both Lantana extracts. Other phenolic acids including cistanoside C, lipedoside A, osmanthuside B, forsythoside A, calceolarioside E, isonuomioside A were also identified. Their mass fragmentation patterns were characteristic, revealing the type of the attached phenolic acid, for example, a loss of 163 Da corresponded to the loss of a caffeoyl moiety, while the loss of 147 Da corresponded to the loss of coumaric acid moiety. Iridoids such as verbascoside (m/z 624.8313, C29H36O15) were found in both species with fragment ions corresponding to the loss of both a caffeoyl moiety and a dehydrated rhamnose part [60].

2.2. Assessment of the Antioxidant Effects of L. camara and L. montevidensis Extracts

2.2.1. DPPH Assay

The stable DPPH radical scavenging activity assay was used to evaluate and compare the antioxidant potential of L. camara and L. montevidensis extracts. The abilities of both extracts to scavenge free radicals were assessed by measuring the change in absorbance produced by the decrease of DPPH radicals (Figure 3). The results demonstrated the dose-dependent radical scavenging capabilities of the two extracts. L. camara demonstrated more potent activity in scavenging DPPH free radicals with an IC50 value of 34.01 ± 1.32 µg/mL compared to L. montevidensis, which displayed an IC50 of 47.43 ± 1.74 µg/mL. The results were comparable to the standard L-ascorbic acid (IC50 20.3 ± 1.24 µg/mL).

2.2.2. ABTS+ Assay

The ABTS+ cation radical scavenging activity was measured using the decolorization assay at various concentrations of L. camara and L. montevidensis. The results showed that the ABTS+ cation radical scavenging activity of both extracts was concentration-dependent, similar to the DPPH assay (Figure 3). The IC50 scavenging capability exhibited by L. camara and L. montevidensis values were 30.73 ± 1.42 and 40.37 ± 1.51 µg/mL, respectively, compared with the standard L-ascorbic acid showing IC50 of 15.7 ± 1.21 µg/mL. Based on these findings, it can be concluded that both extracts exhibited a high radical scavenging capacity by reducing oxidative stress.

2.3. In Vitro Assessment of the Anti-Inflammatory Effects of L. camara and L. montevidensis

The methanol extracts of L. camara and L. montevidensis were investigated for their anti-inflammatory effects through the inhibition of superoxide anion generation and elastase release in fMLF/CB-induced human neutrophils. The LDH assay was likewise performed to assess the safety and/or toxicity of the tested extracts. LDH is a stable enzyme, present in all cell types, rapidly released into the cell culture medium upon the damage of the plasma membrane. The LDH assay is commonly used for the determination of cell death and cytotoxicity [61]. The results of the LDH analysis indicated the nontoxic features of both Lantana extracts at the tested dose of 10 μg/mL with cell viability exceeding 95% (Table 2). Therefore, both samples did not affect the growth of human neutrophils at 10 μg/mL.
Lantana extracts showed a dose-dependent inhibition of superoxide anion generation and elastase release in fMLF/CB-induced human neutrophils (Table 3 and Table 4). The extract of L. montevidensis demonstrated slightly more potent inhibition of superoxide anion with an IC50 of 1.31 ± 0.14 μg/mL compared to L. camara (IC50 of 1.57 ± 0.19 μg/mL). Similarly, L. montevidensis methanolic extract showed marked inhibition of elastase release (IC50 of 1.90 ± 0.07 μg/mL) compared to L. camara extract (IC50 of 2.40 ± 0.16 μg/mL) in fMLF/CB-induced human neutrophils. Both extracts at 10 μg/mL almost completely (~100%) attenuated the activation of human neutrophils, which play role in different stages of cancer and viral infections. Our results support previous studies reporting the anti-inflammatory activities of L. camara and L. montevidensis in different models [62,63]. This activity was attributed to their phytoconstituents, such as pectolinarigenin, and rutin, among others, which showed anti-inflammatory activity in previous reports [51,64,65,66].

2.4. In Vitro Cytotoxicity Studies on L. camara and L. montevidensis Extracts

L. camara extract demonstrated cytotoxic effects when evaluated on MDA-231, Caco, PCL, and MCF-7 cancer cell lines with IC50 values of 74.3 ± 1.19, 45.65 ± 1.64, 52.55 ± 1.14, and 78.08 ± 1.39 µg/mL, respectively. The IC50 values of L. montevidensis extract on the same panel of cancer cell lines were 75.54 ± 1.35, 40.67 ± 1.52, 66.89 ± 1.24, and 61.43 ± 1.46 µg/mL, respectively (Figure 4). Our findings revealed the superiority of both extracts, especially on the Caco colon cancer cell line, when compared to tamoxifen (TAM—the reference drug), which had an IC50 value of 38.53 ± 1.25 µg/mL). The two Lantana extracts did not display any cytotoxicity on WISH normal cells (IC50 values of 166.5 ± 1.78 and 199.1 ± 1.63 µg/mL, respectively), indicating their safety on normal cells, in contrast to TAM, which showed cytotoxic effects on normal cells (IC50 = 30.62 ± 1.31 µg/mL) as well. Accordingly, the Caco cancer cells were selected for further molecular mechanistic studies.

2.4.1. Alterations in Morphological Features of Treated Cancer Cells

Cytotoxic agents frequently alter cell morphology, resulting in abnormal morphological changes, elevated cellular debris, and reduction in cell number. In the current study, detectable morphological features of apoptosis were observed in Caco cells treated with L. camara and L. montevidensis extracts, including cellular shrinkage, reduction in cell number, detachment of the cells, cell rounding, and condensation of the cytoplasm. However, the morphology of the untreated cells appeared normal and confluent (Figure 5).

2.4.2. Analysis of the Cell Cycle

Cell cycle arrest occurs when the PI3K/Akt protein kinases are inhibited. The activation of GSK-3β and the blockade of the cyclin D1 signaling pathway reduces the proliferation and metastasis of the Caco cancer cell line. When compared with the untreated cells, both extracts increased the percentage of cells in the sub-G0/G1 phase (the phase at which the cells wait before entering the cell cycle to duplicate) in Caco cells at the IC50 level. When the number of cells in this phase rises, the cell cycle stops, and division as well as DNA replication are impossible. Figure 6 showed that at the IC50 concentrations, the two Lantana extracts caused cell cycle arrest at rates of 19.2% and 17.2% in the sub-G0/G1 phase, respectively, compared to the untreated Caco cells (3.4%). These findings showed that Lantana extracts could inhibit the PI3K/AkT and GSK-3β/cyclin D1 signaling pathways, as well as trigger apoptosis by arresting the cell cycle in the sub-G0/G1 phase [67,68].

2.4.3. qRT-PCR Assessment

The mRNA expressions of the p53 (apoptotic markers), PI3K, and GSK-3β (proliferative markers) genes in the Caco cell line were measured using qRT-PCR. The expressions of p53 and GSK-3β were significantly (p < 0.0001) enhanced in cells treated with both Lantana extracts compared to the untreated cells. Similarly, PI3K gene expression was downregulated in Lantana-treated cells as compared with the untreated cells (Figure 7). Therefore, Lantana extracts had the potential to limit cancer cell proliferation and metastasis causing cell cycle arrest and apoptosis, which was clarified by the overexpression of p53 and GSK-3β as well as the downregulation of the PI3K gene [69].

2.4.4. Immunoblotting Assay

Compared to the untreated cells, both Lantana extracts resulted in a significant decrease in Akt protein kinase (Figures S1–S3) and cyclin D1 (Figures S4–S6) in Caco cells (Figure 8). These findings revealed that the extracts suppressed PI3K resulting in Akt inhibition via dephosphorylation. The dephosphorylation of Akt activates p53, which subsequently arrests the cell cycle. It likewise stimulated GSK-3β, which inhibited cyclin D1, leading to reduced cellular proliferation, angiogenesis, and metastasis.

3. Materials and Methods

3.1. Plant Collection and Extraction

Fresh young leaves of L. camara L. (Syn. Camara vulgaris Benth.) and L. montevidensis (Spreng.) Briq. (Verbenaceae) were collected from South Valley University Garden and Aswan Botanical Garden, Aswan, Egypt, respectively, in March 2020. The woody shrubs of L. camara L. were grown in sandy soil, irrigated by groundwater wells, and supplied by natural fertilizers. Nevertheless, L. montevidensis woody shrubs were grown in loam soil, irrigated by river Nile fresh water, and supplied by natural fertilizers. Photos of the collected fresh leaves are demonstrated in Figure 9. Authentication was achieved by Therese Labib, Consultant at El-Orman Botanic Garden, Giza, Egypt. Voucher specimens were deposited at the herbarium at the Department of Pharmacognosy, Faculty of Pharmacy, Ain Shams University, Egypt (PHG-V-LC-244), and (PHG-V-LM-245). The dried plant materials (500 g each) were extracted by successive maceration (3X-2 L each) in methanol (Al-Brouj, Giza, Egypt). The macerate was filtered, evaporated, and concentrated in vacuo at 45 °C to yield 2.17 g and 2.34 g of dark brown extracts of L. camara and L. montevidensis, respectively. The methanol extracts were subsequently defatted using n-hexane (Al-brouj, Giza, Egypt), evaporated, freeze-dried, then stored in amber-colored bottles for further chemical analysis and biological investigations.

3.2. LC–LTQ–MS–MS Analysis of L. camara and L. montevidensis Extracts

The defatted methanol extract was analyzed using LC–MS–MS. A Shimadzu LC-10 HPLC with a Grace Vydac Everest Narrowbore C-18 column (100 mm × 2.1 mm i.d., 5 µm, 300 Å). LC–MS, connected to an LTQ Linear Ion Trap MS (Thermo Finnigan, San Jose, CA) was utilized with a mass range of 100–2000 m/z. A 2 µL sample was injected using an autosampler. A 35 min method was used as follows: 5 min isocratic run using 5% acetonitrile (Acn) and 0.05% formic acid (FA), then a gradient was run for 25 min until 95% AcN 0.05% FA. Finally, there was 5 min of conditioning the column with 5% AcN and 0.05% FA. The data were processed and analyzed using foundation 3.1_Xcalibur_3.1.6610. Furthermore, the raw data files were converted to mzXML format using MSConvert from the ProteoWizard suite [70]. The molecular network was created using the Global Natural Products Social Molecular Networking (GNPS) online workflow [28,29]. The spectra in the network were then searched against the GNPS spectral libraries and published data.

3.3. In Vitro Assessment of the Antioxidant Activities of L. camara and L. montevidensis Extracts

3.3.1. DPPH Free Radical Scavenging

The DPPH assay was used to examine the free radical scavenging capacity of the two extracts according to the method published by Burits and Bucar [71] with certain modifications. Briefly, various concentrations of LC and LM (1.56–100 µg/mL) were added and mixed gently with 975 µL of (0.003 g%) DPPH in methanol. The reaction mixture absorbance (A) was measured at 515 nm using a Jenway 6305 UV/Vis spectrophotometer after 1 h of dark incubation at room temperature. A reaction without the extract was carried out as a control. As a positive control, L-ascorbic acid (20–100 µg/mL) was utilized, and the DPPH radical scavenging activity (%) was measured using the equation:
DPPH   radical   scavenging   activity   % = A   control A   sample A   control × 100

3.3.2. ABTS+ Radical Scavenging Activity

The ABTS cation radical (ABTS+) scavenging activity of the two extracts was measured according to Re et al. [72]. The ABTS solution (14 mM) reacted with the potassium persulfate solution (4.9 mM) for 16 h in the dark. ABTS+ cation radicals were produced. The ABTS+ solution was diluted with distilled water to achieve an absorbance of 0.734 at 734 nm before use. Then, 975 µL of ABTS+ solution was added to 25 µL of the two Lantana extracts containing different concentrations (from 1.56 to 100 µg/mL). Absorbance was measured at 734 nm after 4 min of dark incubation and compared to the control. Ascorbic acid (20–100 µg/mL) was employed as a positive control and the ABTS+ cation radical scavenging activity (%) was estimated using the following equation:
ABTS   radical   scavenging   activity   ( % ) = A   control A   sample A   control × 100

3.4. In Vitro Assessment of the Anti-Inflammatory Activity of L. camara and L. montevidensis

3.4.1. Preparation of Human Neutrophils

Blood was collected from healthy human donors (20–35 years old) using a protocol conducted according to the guidelines of the Declaration of Helsinki, and approved by the institutional review board at Chang Gung Memorial Hospital (IRB no. 201902217A3). Informed consent was obtained from all subjects involved in the study. Neutrophils were isolated as previously described [73]. In brief, the blood samples were processed by dextran sedimentation and Ficoll–Hypaque centrifugation, followed by hypotonic lysis of contaminating red blood cells [74]. The segregated neutrophils were suspended and stored in pH 7.4 Ca2+-free Hank’s balanced salt solution (HBSS) at 4 °C before the experiments. Next, the Wright–Giemsa stain was applied to confirm the purity of the suspension of neutrophils. Finally, the cellular viability of >98% was confirmed by the trypan blue exclusion method.

3.4.2. Lactate Dehydrogenase (LDH) Assay

The damage or toxicity to the cells may be expressed as LDH release because the cell membrane loses its integrity, and LDH stored in the cytoplasm is released outside the cell. The cell viability assay based on LDH release was performed to ensure the safety of the extracts on human neutrophils [75]. In brief, human neutrophils (6 × 105 cells/mL) were preheated at 37 °C for 5 min in 1 mM CaCl2 and were incubated with the tested extracts for 15 min. Total LDH released from the cells was incubated with 0.1% of Triton X-100 for 30 min to completely cause cell lysis. Cells were centrifuged at 4 °C for 200× g for 8 min, an LDH reagent was added to the supernatant, and the mixture was incubated in the dark at room temperature for 30 min. The absorbance was then measured at 492 nm, and the LDH release was calculated and compared to the total LDH release set as 0%; untreated cells were set as 100%.

3.4.3. Measurement of Superoxide Generation

Ferricytochrome c was used to evaluate the superoxide release in human neutrophils [76]. The method was described in a previous study [77]. Human neutrophils (6 × 105 cells/mL) were incubated in HBSS containing ferricytochrome c (0.6 mg/mL) and CaCl2 (1 mM). The mixture was equilibrated at 37 °C for 5 min and then was incubated with the tested samples or DMSO (control) for 5 min. Cells were primed by cytochalasin B (CB, 1 μg/mL) and were activated with formyl-methionyl-leucyl-phenylalanine (fMLF, 100 nM) for 10 min. The absorbance was constantly monitored at 550 nm using a double-beam, six-cell positioned spectrophotometer Hitachi U-3010 with constant stirring (Hitachi Inc., Tokyo, Japan). Calculations were based on the differences in absorbance in the presence or absence of superoxide dismutase (SOD, 100 U/mL) divided by the extinction coefficient for ferricytochrome c reduced form (ε = 21.1/mM/10 mm). LY294002 was used as the positive control.

3.4.4. Measurement of Elastase Release

Elastase release was measured by degranulation of azurophilic granules in human neutrophils [78]. Human neutrophils (6 × 105 cells/mL) were equilibrated with elastase substrate MeO-Suc-Ala-Ala-Pro-Val-p-nitroanilide (100 μM) in HBSS supplemented with CaCl2 (1 mM) at 37 °C for 2 min and then were incubated with samples or DMSO (control) for 5 min. Human neutrophils were activated by 100 nM fMLF and 0.5 μg/mL CB and the changes in the absorbance at 405 nm were continuously monitored by a spectrometer (Hitachi U-3010, Tokyo, Japan) to record the elastase release. The results were expressed as the percent of elastase release in the fMLF/CB-activated drug-free control system. LY294002 was used as the positive control.

3.5. In Vitro Cytotoxicity Investigation of L. camara and L. montevidensis Extracts

3.5.1. Cell Lines Maintenance and Treatment

The triple-negative breast cancer cell line (MDA-231), pancreatic cancer cell line (PCL), estrogen receptor-positive breast cancer cell line (MCF-7), colon cancer cell line (Caco), and WISH normal cell line were seeded with (1 × 104 cells/well) separately using complete media containing Dulbecco’s Modified Eagle supplemented with 10% heat-inactivated fetal bovine serum (FBS, GIBCO, Langley, OK, USA; cat. no. 10099133), 1% penicillin/streptomycin (Thermo Fisher Scientific, Waltham, MA, USA; cat. no. SV30082) in 5% CO2 incubator and 95% humidified environment at 37 °C. All cell lines were provided by the Centre of Excellence for Research in Regenerative Medicine and its Applications, Alexandria University, Egypt. Cell lines were incubated with Lantana extracts at several concentrations (0–200 µg/mL) and tamoxifen (TAM) as a standard chemotherapeutic drug (0–100 µg/mL) for 48 h. The viability of cells was determined using the tetrazolium 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay (Gibco-BRL, New York, NY, USA) [79].

3.5.2. Cell Morphology Study

Briefly, 1 × 105 of the Caco cell line was seeded in a 6-well plate, incubated for 24 h, then treated with Lantana extracts at their IC50 concentrations. After 48 h of incubation, morphological alterations of the treated and untreated cells were evaluated and captured using an inverted light microscope (Olympus, Tokyo, Japan).

3.5.3. Cell Cycle Examination

Flow cytometry was used to analyze cell cycle phases using an Accuri C6 flow cytometer (Becton Dickinson BD, Franklin Lakes, NJ, USA) on Caco cells 1 × 105 that were trypsinized, centrifuged at 5000 rpm at 4 °C, washed with cold phosphate buffer saline (PBS), and fixed with cold absolute ethanol, as described by Noser et al. and Darzynkiewicz et al. [80,81].

3.5.4. Quantitative Real-Time PCR (qRT-PCR)

The Caco 1 × 105 control and treated cells were trypsinized, centrifuged at 4500 rpm at 4 °C, and washed with PBS. The pelleted cells were subjected to RNA extraction and transcription to cDNA as described by Kvastad et al. [82]. The expressions of p53, GSK-3β, and PI3K mRNA were measured using Applied qPCR Biosystems (Foster City, CA, USA) on treated and control cells according to Livak and Schmittgen [83]. The primer sequences were designed using primer 3 plus as shown in Table 5.

3.5.5. Western Blot Analysis

The method of Mruk and Cheng was used for immunoblotting assay [84]. Proteins were separated from Caco control and treated cells using cold RIPA lysis buffer and were quantified using Bradford [85]. Equal amounts of proteins (20 mg) were separated and transferred to a polyvinylidene difluoride (PVDF) membrane. After blocking the membrane, the primary antibodies, phospho-AkT (ab81283) and cyclin D1 (ab134175), were added and incubated with it. Then, the primary antibodies were removed, carefully washed several times, and incubated with the secondary antibody horseradish peroxidase (HRP) (ab205718). The bands were visualized using enhanced chemiluminescence (ECL) detection kit (Promega, Madison, WI, USA). A gel documentation system (Geldoc-it, UVP, Cambridge, UK), was applied for data analysis using TotalLab analysis software, Newcastle upon Tyne, England, www.totallab.com, (Ver.1.0.1).

3.6. Statistical Analysis

Results are expressed as mean ± SEM value of at least three independent measurements unless otherwise specified. The 50% inhibitory concentration (IC50) was calculated from the dose-response curve obtained by plotting the percentage of inhibition versus concentrations (linear function, Microsoft Office, Redmond, WA, U.S). Statistical analysis was performed by Student’s t-test (Sigma Plot, Systat software, Systat Software Inc., San Jose, CA, USA, anti-inflammatory assay). Values with * p < 0.05, ** p < 0.01, *** p < 0.001 were considered statistically significant.

4. Conclusions

LC–MS–MS-guided metabolic profiling of L. camara and L. montevidensis extracts resulted in the tentative identification of 59 compounds belonging to different phytochemical classes including pentacyclic triterpenes, flavonoids, and phenolic acids. In vitro studies revealed that Lantana species displayed potent radical scavenging and anti-inflammatory activities through the inhibition of elastase release in fMLF/CB-induced human neutrophils. The extracts, despite their encouraging safety profile on normal human cells, exhibited potent cytotoxic effects on a wide array of cancer cell lines, especially against Caco cells. Lantana extracts induced apoptosis and triggered cell cycle arrest. They inhibited the proliferation and metastasis of cancer cells by downregulating the PI3K/AkT signaling cascade and reducing cyclin D1 levels via the activation of GSK-3β. Our findings imply that L. camara and L. montevidensis crude extracts could be valuable sources for further research as potential anticancer agents.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants11131699/s1, Figure S1. β- actin expression level for samples; Figure S2. Computerized analysis of β-actin protein expression level for samples; Figure S3. Anti P-AkT antibody protein expression level for samples; Figure S4. Computerized analysis of anti P-AkT antibody protein expression level for samples; Figure S5. Dendograms of anti- P-AkT antibody protein expression level for samples 1 (A), 2 (B), and 3 (C); Figure S6. Anti-cyclin D1 antibody protein expression level for samples; Figure S7. Computerized analysis of anti-cyclin D1 antibody protein expression level for samples; Figure S8. Dendograms of anti-cyclin D1 antibody protein expression level for samples 1 (A), 2 (B), and 3 (C).

Author Contributions

LC–MS measurements and interpretation, M.I.G.E.-D., N.M.F., O.M.K., S.F. and F.W.; in-vitro biological part (antioxidant, cytotoxicity and different molecular mechanism), M.M.S.; in-vitro anti-inflammatory assessment (LDH assay, measurement of superoxide generation measurement of elastase release), M.K.; resources and supervision, H.R.E.-S., T.-L.H., and M.E.-S.; plant collection, A.K.O.; writing and editing, all authors. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by grants from the Ministry of Science and Technology (MOST 111-2321-B-182-001, MOST 109-2320-B-650-001-MY3, MOST 108-2320-B-255-003-MY3, and MOST 109-2327-B-255-001), Chang Gung University of Science and Technology (ZRRPF3L0091), and Chang Gung Memorial Hospital (CMRPF1J0051~3, CORPF1L0011, CMRPF1L0071, and BMRP450).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Institutional Review Board of the institutional review board at Chang Gung Memorial Hospital (protocol code: IRB no. 201902217A3 and date of approval: 24 December 2020).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Data are available in the manuscript and Supplementary Material.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Sharma, G.P.; Raghubanshi, A.S.; Singh, J.S. Lantana invasion: An overview. Weed Biol. Manag. 2005, 5, 157–165. [Google Scholar] [CrossRef]
  2. Negi, G.C.S.; Sharma, S.; Vishvakarma, S.C.R.; Samant, S.S.; Maikhuri, R.K.; Prasad, R.C.; Palni, L.M.S. Ecology and Use of Lantana camara in India. Bot. Rev. 2019, 85, 109–130. [Google Scholar] [CrossRef] [Green Version]
  3. Saxena, M.; Saxena, J.; Khare, S. A brief review on: Therapeutical values of Lantana camara plant. Int. J. Pharm. Life Sci. 2012, 3, 1551–1554. [Google Scholar]
  4. dos Santos Lencina, J.; Bonfa Moslaves, I.S.; de Araujo Isaias Muller, J.; Carvalho, R.; Amianti, C.; Bonfim, I.; Alves, F.M.; Carollo, C.A.; Candeloro, L.; dos Santos Júnior, A.A.; et al. Lantana canescens (Kunth) inhibits inflammatory and hyperalgesic responses in murine models. J. Ethnopharmacol. 2021, 280, 114461. [Google Scholar] [CrossRef]
  5. Dawood, A.S.; Chua, L.S.; Tan, T.S.; Alshemary, A.F. Apoptotic mechanism of lantadene A from Lantana camara leaves against prostatic cancer cells. Egypt. J. Chem. 2021, 64, 7503–7510. [Google Scholar] [CrossRef]
  6. Amany, R.; Yara, K.; Tharwat, R.; Gamal, H.; Khaulood, H. Multidrug-resistant Staphylococcus bacteria isolated from pregnant women and the antimicrobial effect of Lantana camara L. different extracts. Egypt. J. Exp. Biol. 2021, 17, 33. [Google Scholar]
  7. Qureshi, H.; Anwar, T.; Ali, Q.; Haider, M.Z.; Habib, N.; Fatima, S.; Waseem, M.; Bibi, Y.; Arshad, M.; Adkins, S.W. Isolation of natural herbicidal compound from Lantana camara. Int. J. Environ. Anal. Chem. 2021, 101, 631–638. [Google Scholar] [CrossRef]
  8. Edem, G.D.; Okon, K.A.; Essien, S.I.; Bassey, E.-O.I. Lantana camara: A potent influential factor in improving the gastric mucosa of wistar rats ravaged by ulcer. Biol. Clin. Sci. Res. J. 2021, 2021. [Google Scholar] [CrossRef]
  9. Ibrahim, M.A.; Sabti, M.Z.; Mousa, S.H. In vitro accumulation potentials of heavy metals in big-sage (Lantana camara L.) plant. DYSONA-Life Sci. 2021, 2, 12–17. [Google Scholar] [CrossRef]
  10. Mohamed, N.M.; Makboul, M.A.; Farag, S.F.; Tarawneh, A.H.; Khan, S.I.; Brooks, T.A.; Wang, Y.-H.; Ross, S.A. Iridoid and phenylpropanoid glycosides from the roots of Lantana montevidensis. Med. Chem. Res. 2017, 26, 1117–1126. [Google Scholar] [CrossRef]
  11. Sousa, E.O.; Rocha, J.B.T.; Barros, L.M.; Barros, A.R.C.; Costa, J.G.M. Phytochemical characterization and in vitro antioxidant properties of Lantana camara L. and Lantana montevidensis Briq. Ind. Crops Prod. 2013, 43, 517–522. [Google Scholar] [CrossRef]
  12. Barreto, F.S.; Sousa, E.O.; Rodrigues, F.F.G.; Costa, J.G.M.; Campos, A.R. Antibacterial Activity of Lantana camara Linn Lantana montevidensis Brig Extracts from Cariri-Ceara, Brazil. J. Young Pharm. 2010, 2, 42–44. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Mohamed, N.M.; Makboul, M.A.; Farag, S.F.; Jain, S.; Jacob, M.R.; Tekwani, B.L.; Ross, S.A. Triterpenes from the roots of Lantana montevidensis with antiprotozoal activity. Phytochem. Lett. 2016, 15, 30–36. [Google Scholar] [CrossRef] [Green Version]
  14. Hald, A.; Lotharius, J. Oxidative stress and inflammation in Parkinson’s disease: Is there a causal link? Exp. Neurol. 2005, 193, 279–290. [Google Scholar] [CrossRef] [PubMed]
  15. García, N.; Zazueta, C.; Aguilera-Aguirre, L. Oxidative Stress and Inflammation in Cardiovascular Disease. Oxidative Med. Cell. Longev. 2017, 2017, 5853238. [Google Scholar] [CrossRef] [Green Version]
  16. Li, S.; Hong, M.; Tan, H.-Y.; Wang, N.; Feng, Y. Insights into the Role and Interdependence of Oxidative Stress and Inflammation in Liver Diseases. Oxidative Med. Cell. Longev. 2016, 2016, 4234061. [Google Scholar] [CrossRef]
  17. Burgos-Morón, E.; Abad-Jiménez, Z.; Martínez de Marañón, A.; Iannantuoni, F.; Escribano-López, I.; López-Domènech, S.; Salom, C.; Jover, A.; Mora, V.; Roldan, I.; et al. Relationship between Oxidative Stress, ER Stress, and Inflammation in Type 2 Diabetes: The Battle Continues. J. Clin. Med. 2019, 8, 1385. [Google Scholar] [CrossRef] [Green Version]
  18. Rivera, J.C.; Dabouz, R.; Noueihed, B.; Omri, S.; Tahiri, H.; Chemtob, S. Ischemic Retinopathies: Oxidative Stress and Inflammation. Oxidative Med. Cell. Longev. 2017, 2017, 3940241. [Google Scholar] [CrossRef] [Green Version]
  19. Kawabata, K.; Hagio, T.; Matsuoka, S. The role of neutrophil elastase in acute lung injury. Eur. J. Pharmacol. 2002, 451, 1–10. [Google Scholar] [CrossRef]
  20. Fayez, S.; Ayoub, I.M.; Mostafa, N.M.; Moussa, A.Y.; Gamal El-Din, M.I.; El-Shazly, M. Nutraceuticals in Cancer Therapy. In Handbook of Oxidative Stress in Cancer: Therapeutic Aspects; Chakraborti, S., Ed.; Springer: Singapore, 2021; pp. 1–20. [Google Scholar]
  21. Thun, M.J.; DeLancey, J.O.; Center, M.M.; Jemal, A.; Ward, E.M. The global burden of cancer: Priorities for prevention. Carcinogenesis 2010, 31, 100–110. [Google Scholar] [CrossRef] [Green Version]
  22. von Meyenfeldt, M. Cancer-associated malnutrition: An introduction. Eur. J. Oncol. Nurs. 2005, 9, S35–S38. [Google Scholar] [CrossRef] [PubMed]
  23. Wang, C.-D.; Yuan, C.-F.; Bu, Y.-Q.; Wu, X.-M.; Wan, J.-Y.; Zhang, L.; Hu, N.; Liu, X.-J.; Zu, Y.; Liu, G.-L.; et al. Fangchinoline inhibits cell proliferation via Akt/GSK-3beta/cyclin D1 signaling and induces apoptosis in MDA-MB-231 breast cancer cells. Asian Pac. J. Cancer Prev. 2014, 15, 769–773. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Luo, J.; Manning, B.D.; Cantley, L.C. Targeting the PI3K-Akt pathway in human cancer: Rationale and promise. Cancer Cell 2003, 4, 257–262. [Google Scholar] [CrossRef] [Green Version]
  25. Takahashi-Yanaga, F.; Sasaguri, T. GSK-3β regulates cyclin D1 expression: A new target for chemotherapy. Cell. Signal. 2008, 20, 581–589. [Google Scholar] [CrossRef]
  26. El-Seedi, H.R.; Burman, R.; Mansour, A.; Turki, Z.; Boulos, L.; Gullbo, J.; Goransson, U. The traditional medical uses and cytotoxic activities of sixty-one Egyptian plants: Discovery of an active cardiac glycoside from Urginea maritima. J. Ethnopharmacol. 2013, 145, 746–757. [Google Scholar] [CrossRef]
  27. El-Seedi, H.R.; Yosri, N.; Khalifa, S.A.M.; Guo, Z.; Musharraf, S.G.; Xiao, J.; Saeed, A.; Du, M.; Khatib, A.; Abdel-Daim, M.M. Exploring natural products-based cancer therapeutics derived from egyptian flora. J. Ethnopharmacol. 2021, 269, 113626. [Google Scholar] [CrossRef]
  28. El-Garawani, I.M.; El-Sabbagh, S.M.; Abbas, N.H.; Ahmed, H.S.; Eissa, O.A.; Abo-Atya, D.M.; Khalifa, S.A.M.; El-Seedi, H.R. A newly isolated strain of Halomonas sp.(HA1) exerts anticancer potential via induction of apoptosis and G2/M arrest in hepatocellular carcinoma (HepG2) cell line. Sci. Rep. 2020, 10, 14076. [Google Scholar] [CrossRef]
  29. El-Garawani, I.; Hassab El-Nabi, S.; El Kattan, A.; Sallam, A.; Elballat, S.; Abou-Ghanima, S.; El Azab, I.H.; El-Seedi, H.R.; Am Khalifa, S.; El-Shamy, S. The ameliorative role of Acacia senegal gum against the oxidative stress and genotoxicity induced by the radiographic contrast medium (ioxitalamate) in albino rats. Antioxidants 2021, 10, 221. [Google Scholar] [CrossRef]
  30. Elrasoul, A.S.A.; Mousa, A.A.; Orabi, S.H.; Mohamed, M.A.E.-G.; Gad-Allah, S.M.; Almeer, R.; Abdel-Daim, M.M.; Khalifa, S.A.M.; El-Seedi, H.R.; Eldaim, M.A.A. Antioxidant, anti-inflammatory, and anti-apoptotic effects of Azolla pinnata ethanolic extract against lead-induced hepatotoxicity in rats. Antioxidants 2020, 9, 1014. [Google Scholar] [CrossRef]
  31. Sousa, E.O.; Miranda, C.M.; Nobre, C.B.; Boligon, A.A.; Athayde, M.L.; Costa, J.G. Phytochemical analysis and antioxidant activities of Lantana camara and Lantana montevidensis extracts. Ind. Crops Prod. 2015, 70, 7–15. [Google Scholar] [CrossRef]
  32. Sharma, O.P.; Sharma, S.; Pattabhi, V.; Mahato, S.B.; Sharma, P.D. A review of the hepatotoxic plant Lantana camara. Crit. Rev. Toxicol. 2007, 37, 313–352. [Google Scholar] [CrossRef] [PubMed]
  33. Cittadini, M.C.; García-Estévez, I.; Escribano-Bailón, M.T.; Rivas-Gonzalo, J.C.; Valentich, M.A.; Repossi, G.; Soria, E.A. Modulation of fatty acids and interleukin-6 in glioma cells by South American tea extracts and their phenolic compounds. Nutr. Cancer 2018, 70, 267–277. [Google Scholar] [CrossRef] [PubMed]
  34. Singh, M.; Tamma, R.V.; Nigg, H.N. HPLC identification of allelopathic compounds from Lantana camara. J. Chem. Ecol. 1989, 15, 81–89. [Google Scholar] [CrossRef] [PubMed]
  35. Van Wyk, B.-E. A review of African medicinal and aromatic plants. Med. Aromat. Plants World-Afr. 2017, 3, 19–60. [Google Scholar]
  36. Begum, S.; Ahmed, M.; Siddiqui, B.S.; Khan, A.; Saify, Z.S.; Arif, M. Triterpenes, a sterol and a monocyclic alcohol from Momordica charantia. Phytochemistry 1997, 44, 1313–1320. [Google Scholar] [CrossRef]
  37. Lata, R.R. Extraction and Bioactivity of Organic Extracts of Lantana camara Leaves. Master’s Thesis, The University of the South Pacific, Suva, Fiji, 2020. [Google Scholar]
  38. Singh, S.K.; Tripathi, V.J.; Singh, R.H. 3β, 24-Dihydroxyolean-12-en-28-oic acid, a pentacyclic triterpene acid from Lantana indica. Phytochemistry 1990, 29, 3360–3362. [Google Scholar] [CrossRef]
  39. Shamsee, Z.R.; Al-Saffar, A.Z.; Al-Shanon, A.F.; Al-Obaidi, J.R. Cytotoxic and cell cycle arrest induction of pentacyclic triterpenoides separated from Lantana camara leaves against MCF-7 cell line in vitro. Mol. Biol. Rep. 2019, 46, 381–390. [Google Scholar] [CrossRef]
  40. Sousa, E.O.; Costa, J.G. Genus Lantana: Chemical aspects and biological activities. Rev. Bras. Farmacogn. 2012, 22, 1115–1180. [Google Scholar] [CrossRef] [Green Version]
  41. Matsuda, H.; Li, Y.; Murakami, T.; Yamahara, J.; Yoshikawa, M. Protective effects of oleanolic acid oligoglycosides on ethanol- or indomethacin-induced gastric mucosal lesions in rats. Life Sci. 1998, 63, Pl245–Pl250. [Google Scholar] [CrossRef]
  42. de Sousa, E.O.; de Almeida, S.C.; Damasceno, S.S.; Nobre, C.B.; da Costa, J.G.M. Lantana camara L. and Lantana montevidensis (Spreng.) Briq. In Medicinal and Aromatic Plants of South America; Springer: Berlin/Heidelberg, Germany, 2018; pp. 275–288. [Google Scholar]
  43. Nagao, T.; Abe, F.; Kinjo, J.; Okabe, H. Antiproliferative constituents in plants 10. Flavones from the leaves of Lantana montevidensis B RIQ. and consideration of structure–activity relationship. Biol. Pharm. Bull. 2002, 25, 875–879. [Google Scholar] [CrossRef] [Green Version]
  44. Darwish, R.S.; El-Banna, A.A.; Ghareeb, D.A.; El-Hosseny, M.F.; Seadawy, M.G.; Dawood, H.M. Chemical profiling and unraveling of anti-COVID-19 biomarkers of red sage (Lantana camara L.) cultivars using UPLC-MS/MS coupled to chemometric analysis, in vitro study and molecular docking. J. Ethnopharmacol. 2022, 291, 115038. [Google Scholar] [CrossRef] [PubMed]
  45. Weyerstahl, P.; Wahlburg, H.C.; Marschall, H.; Rustaiyan, A. Terpenes and terpene derivatives, XXXII. New cadinene and bisabolene derivatives from the essential oil of Pulicaria gnaphalodes. Liebigs Ann. Chem. 1993, 1993, 1117–1123. [Google Scholar] [CrossRef]
  46. Rahma, N.A.; Rohman, A. UPLC MS/MS Profile and Antioxidant Activities from Nonpolar Fraction of Patiwala (Lantana camara) Leaves Extract. Separations 2022, 9, 75. [Google Scholar]
  47. Hart, N.; Lamberton, J.; Sioumis, A.; Suares, H. New triterpenes of Lantana camara. A comparative study of the constituents of several taxa. Aust. J. Chem. 1976, 29, 655–671. [Google Scholar] [CrossRef]
  48. Hussain, H.; Hussain, J.; Al-Harrasi, A.; Shinwari, Z.K. Chemistry of some species genus Lantana. Pak. J. Bot. 2011, 43, 51–62. [Google Scholar]
  49. Makboul, M.A.; Attia, A.A.; Farag, S.F.; Mohamed, N.M.; Ross, S.A. Chemical constituents with free-radical scavenging activity from the leaves of Lantana montevidensis (Spreng.) Briq. Phcog J. 2014, 6, 27–31. [Google Scholar] [CrossRef]
  50. Gaillard, P.; HautevIlle, M.; Picq, M.; Duclos, M.-C.; Dubois, M.; Prigent, A.-F. Selective inhibition of rat heart cAMP phosphodiesterases by lipophilic C-methyl-2-phenyl-4H-1-benzopyran-4-ones (C-methylflavones). Chem. Pharm. Bull. 1996, 44, 1571–1576. [Google Scholar] [CrossRef] [Green Version]
  51. Begum, S.; Ayub, A.; Shaheen Siddiqui, B.; Fayyaz, S.; Kazi, F. Nematicidal triterpenoids from Lantana camara. Chem. Biodivers. 2015, 12, 1435–1442. [Google Scholar] [CrossRef]
  52. Begum, S.; Zehra, S.Q.; Siddiqui, B.S.; Fayyaz, S.; Ramzan, M. Pentacyclic triterpenoids from the aerial parts of Lantana camara and their nematicidal activity. Chem. Biodivers. 2008, 5, 1856–1866. [Google Scholar] [CrossRef]
  53. Begum, S.; Zehra, S.Q.; Wahab, A.; Siddiqui, B.S. Triterpenoidal secondary metabolites from Lantana camara Linn. Helv. Chim. Acta 2006, 89, 1932–1941. [Google Scholar] [CrossRef]
  54. Begum, S.; Ayub, A.; Qamar Zehra, S.; Shaheen Siddiqui, B.; Iqbal Choudhary, M. Leishmanicidal triterpenes from Lantana camara. Chem. Biodivers. 2014, 11, 709–718. [Google Scholar] [CrossRef] [PubMed]
  55. Abdel-Hady, H.; El-Sayed, M.M.; Abdel-Hady, A.A.; Hashash, M.M.; Abdel-Hady, A.M.; Aboushousha, T.; Abdel-Hameed, E.-S.S.; Abdel-Lateef, E.E.-S.; Morsi, E.A. Nephroprotective Activity of methanolic extract of Lantana camara and squash (Cucurbita pepo) on cisplatin-induced nephrotoxicity in rats and identification of certain chemical constituents of Lantana camara by HPLC-ESI-MS. Pharmacogn. J. 2018, 10, 136–147. [Google Scholar] [CrossRef]
  56. Sharma, O.P.; Singh, A.; Sharma, S. Levels of lantadenes, bioactive pentacyclic triterpenoids, in young and mature leaves of Lantana camara var. aculeata. Fitoterapia 2000, 71, 487–491. [Google Scholar] [CrossRef]
  57. Siddiqui, B.S.; Raza, S.M.; Begum, S.; Siddiqui, S.; Firdous, S. Pentacyclic triterpenoids from Lantana camara. Phytochemistry 1995, 38, 681–685. [Google Scholar] [CrossRef]
  58. Wollenweber, E.; Dorr, M.; Muniappan, R.; Siems, K. Flavonoid aglycones and triterpenoids from the leaf exudate of Lantana camara and Lantana montevidensis. Biochem. Syst. Ecol. 1997, 25, 269–270. [Google Scholar] [CrossRef]
  59. Sánchez-Rabaneda, F.; Jáuregui, O.; Casals, I.; Andrés-Lacueva, C.; Izquierdo-Pulido, M.; Lamuela-Raventós, R.M. Liquid chromatographic/electrospray ionization tandem mass spectrometric study of the phenolic composition of cocoa (Theobroma cacao). J. Mass Spectrom. 2003, 38, 35–42. [Google Scholar] [CrossRef] [PubMed]
  60. Cardinali, A.; Pati, S.; Minervini, F.; D’Antuono, I.; Linsalata, V.; Lattanzio, V. Verbascoside, isoverbascoside, and their derivatives recovered from olive mill wastewater as possible food antioxidants. J. Agric. Food Chem. 2012, 60, 1822–1829. [Google Scholar] [CrossRef]
  61. Kumar, P.; Nagarajan, A.; Uchil, P.D. Analysis of cell viability by the lactate dehydrogenase assay. Cold Spring Harb. Protoc. 2018, 2018, pdb.prot095497. [Google Scholar] [CrossRef]
  62. Wu, P.; Song, Z.; Wang, X.; Li, Y.; Li, Y.; Cui, J.; Tuerhong, M.; Jin, D.-Q.; Abudukeremu, M.; Lee, D. Bioactive triterpenoids from Lantana camara showing anti-inflammatory activities in vitro and in vivo. Bioorg. Chem. 2020, 101, 104004. [Google Scholar] [CrossRef]
  63. Silva, T.; Suffredini, I.; Ricci, E.; Fernandes, S.; Gonçalves, V., Jr.; Romoff, P.; Lago, J.; Bernardi, M. Antinociceptive and anti-inflammatory effects of Lantana camara L. extract in mice. Rev. Bras. Plantas Med. 2015, 17, 224–229. [Google Scholar] [CrossRef] [Green Version]
  64. Ghosh, S.; Das Sarma, M.; Patra, A.; Hazra, B. Anti-inflammatory and anticancer compounds isolated from Ventilago madraspatana Gaertn., Rubia cordifolia Linn. and Lantana camara Linn. J. Pharm. Pharmacol. 2010, 62, 1158–1166. [Google Scholar] [CrossRef] [PubMed]
  65. Yuting, C.; Rongliang, Z.; Zhongjian, J.; Yong, J. Flavonoids as superoxide scavengers and antioxidants. Free Radic. Biol. Med. 1990, 9, 19–21. [Google Scholar] [CrossRef]
  66. Xu, G.-H.; Kim, Y.-H.; Choo, S.-J.; Ryoo, I.-J.; Yoo, J.-K.; Ahn, J.-S.; Yoo, I.-D. Chemical constituents from the leaves of Ilex paraguariensis inhibit human neutrophil elastase. Arch. Pharmacal Res. 2009, 32, 1215–1220. [Google Scholar] [CrossRef]
  67. Deng, S.; Dai, G.; Chen, S.; Nie, Z.; Zhou, J.; Fang, H.; Peng, H.J.B. Dexamethasone induces osteoblast apoptosis through ROS-PI3K/AKT/GSK3β signaling pathway. Biomed. Pharmacother. 2019, 110, 602–608. [Google Scholar] [CrossRef] [PubMed]
  68. Yang, K.; Guo, Y.; Stacey, W.C.; Harwalkar, J.; Fretthold, J.; Hitomi, M.; Stacey, D.W. Glycogen synthase kinase 3 has a limited role in cell cycle regulation of cyclin D1 levels. BMC Cell Biol. 2006, 7, 33. [Google Scholar] [CrossRef] [Green Version]
  69. Gao, X.; Li, X.; Ho, C.-T.; Lin, X.; Zhang, Y.; Li, B.; Chen, Z. Cocoa tea (Camellia ptilophylla) induces mitochondria-dependent apoptosis in HCT116 cells via ROS generation and PI3K/Akt signaling pathway. Food Res. Int. 2020, 129, 108854. [Google Scholar] [CrossRef]
  70. MS-Convert. Available online: http://proteowizard.sourceforge.net/download.html (accessed on 1 June 2021).
  71. Burits, M.; Bucar, F. Antioxidant activity of Nigella sativa essential oil. Phytother. Res. 2000, 14, 323–328. [Google Scholar] [CrossRef]
  72. Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free Radic. Biol. Med. 1999, 26, 1231–1237. [Google Scholar] [CrossRef]
  73. Yang, S.-C.; Chung, P.-J.; Ho, C.-M.; Kuo, C.-Y.; Hung, M.-F.; Huang, Y.-T.; Chang, W.-Y.; Chang, Y.-W.; Chan, K.-H.; Hwang, T.-L. Propofol inhibits superoxide production, elastase release, and chemotaxis in formyl peptide–activated human neutrophils by blocking formyl peptide receptor 1. J. Immunol. 2013, 190, 6511–6519. [Google Scholar] [CrossRef] [Green Version]
  74. Bøyum, A.; Løvhaug, D.; Tresland, L.; Nordlie, E. Separation of leucocytes: Improved cell purity by fine adjustments of gradient medium density and osmolality. Scand. J. Immunol. 1991, 34, 697–712. [Google Scholar] [CrossRef]
  75. Korinek, M.; Hsieh, P.-S.; Chen, Y.-L.; Hsieh, P.-W.; Chang, S.-H.; Wu, Y.-H.; Hwang, T.-L. Randialic acid B and tomentosolic acid block formyl peptide receptor 1 in human neutrophils and attenuate psoriasis-like inflammation in vivo. Biochem. Pharmacol. 2021, 190, 114596. [Google Scholar] [CrossRef] [PubMed]
  76. Babior, B.M.; Kipnes, R.S.; Curnutte, J.T. Biological defense mechanisms. The production by leukocytes of superoxide, a potential bactericidal agent. J. Clin. Investig. 1973, 52, 741–744. [Google Scholar] [CrossRef] [PubMed]
  77. Chen, C.-Y.; Liaw, C.-C.; Chen, Y.-H.; Chang, W.-Y.; Chung, P.-J.; Hwang, T.-L. A novel immunomodulatory effect of ugonin U in human neutrophils via stimulation of phospholipase C. Free Radic. Biol. Med. 2014, 72, 222–231. [Google Scholar] [CrossRef] [PubMed]
  78. Hwang, T.-L.; Leu, Y.-L.; Kao, S.-H.; Tang, M.-C.; Chang, H.-L. Viscolin, a new chalcone from Viscum coloratum, inhibits human neutrophil superoxide anion and elastase release via a cAMP-dependent pathway. Free Radic. Biol. Med. 2006, 41, 1433–1441. [Google Scholar] [CrossRef]
  79. Dash, S.K.; Ghosh, T.; Roy, S.; Chattopadhyay, S.; Das, D. Zinc sulfide nanoparticles selectively induce cytotoxic and genotoxic effects on leukemic cells: Involvement of reactive oxygen species and tumor necrosis factor alpha. J. Appl. Toxicol. 2014, 34, 1130–1144. [Google Scholar] [CrossRef]
  80. Darzynkiewicz, Z.; Halicka, H.D.; Zhao, H. Analysis of cellular DNA content by flow and laser scanning cytometry. Polyploidization Cancer 2010, 676, 137–147. [Google Scholar]
  81. Noser, A.A.; Abdelmonsef, A.H.; El-Naggar, M.; Salem, M.M. New Amino Acid Schiff Bases as Anticancer Agents via Potential Mitochondrial Complex I-Associated Hexokinase Inhibition and Targeting AMP-Protein Kinases/mTOR Signaling Pathway. Molecules 2021, 26, 5332. [Google Scholar] [CrossRef]
  82. Kvastad, L.; Werne Solnestam, B.; Johansson, E.; Nygren, A.; Laddach, N.; Sahlén, P.; Vickovic, S.; Bendigtsen, S.C.; Aaserud, M.; Floer, L.; et al. Single cell analysis of cancer cells using an improved RT-MLPA method has potential for cancer diagnosis and monitoring. Sci. Rep. 2015, 5, 16519. [Google Scholar] [CrossRef]
  83. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  84. Mruk, D.D.; Cheng, C.Y. Enhanced chemiluminescence (ECL) for routine immunoblotting: An inexpensive alternative to commercially available kits. Spermatogenesis 2011, 1, 121–122. [Google Scholar] [CrossRef] [Green Version]
  85. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
Figure 1. LC-MS chromatograms of L. montevidensis and L. camara in the positive ion mode prescribing the annotated metabolites from N1–N59 as exhibited in Table 1.
Figure 1. LC-MS chromatograms of L. montevidensis and L. camara in the positive ion mode prescribing the annotated metabolites from N1–N59 as exhibited in Table 1.
Plants 11 01699 g001
Figure 2. Molecular network (showing clusters of metabolites of interest) based on tandem mass spectrometry data in the positive ionization mode of Lantana extracts. The network is displayed as a pie chart to reflect the relative abundance of each ion in the analyzed samples. L. camara is indicated in yellow and L. montevidensis is indicated in light blue.
Figure 2. Molecular network (showing clusters of metabolites of interest) based on tandem mass spectrometry data in the positive ionization mode of Lantana extracts. The network is displayed as a pie chart to reflect the relative abundance of each ion in the analyzed samples. L. camara is indicated in yellow and L. montevidensis is indicated in light blue.
Plants 11 01699 g002
Figure 3. The antioxidant scavenging activity of L. camara and L. montevidensis extracts. Results were expressed as mean ± SE, (n = 3).
Figure 3. The antioxidant scavenging activity of L. camara and L. montevidensis extracts. Results were expressed as mean ± SE, (n = 3).
Plants 11 01699 g003
Figure 4. The cytotoxic effects of L. camara, L. montevidensis, and tamoxifen (standard) on different cancer cell lines. Cells were treated with various concentrations of L. camara, L. montevidensis, and tamoxifen for 48 h and cell viability was plotted against drugs concentration to calculate the IC50. Results were expressed as mean ± SE, (n = 5).
Figure 4. The cytotoxic effects of L. camara, L. montevidensis, and tamoxifen (standard) on different cancer cell lines. Cells were treated with various concentrations of L. camara, L. montevidensis, and tamoxifen for 48 h and cell viability was plotted against drugs concentration to calculate the IC50. Results were expressed as mean ± SE, (n = 5).
Plants 11 01699 g004
Figure 5. Morphological features of apoptosis in Caco cells treated with L. camara and L. montevidensis extracts (at their IC50 concentrations) after 48 h.
Figure 5. Morphological features of apoptosis in Caco cells treated with L. camara and L. montevidensis extracts (at their IC50 concentrations) after 48 h.
Plants 11 01699 g005
Figure 6. Cell cycle phases of Caco cells treated with L. camara and L. montevidensis extracts (at their IC50 concentrations) after 48 h of treatment.
Figure 6. Cell cycle phases of Caco cells treated with L. camara and L. montevidensis extracts (at their IC50 concentrations) after 48 h of treatment.
Plants 11 01699 g006
Figure 7. Relative expression of p53, GSK-3β, and PI3K in Caco cells. Results were expressed as mean ± SE, (n = 3). **** p < 0.0001 is considered significant compared to the Caco control untreated cells.
Figure 7. Relative expression of p53, GSK-3β, and PI3K in Caco cells. Results were expressed as mean ± SE, (n = 3). **** p < 0.0001 is considered significant compared to the Caco control untreated cells.
Plants 11 01699 g007
Figure 8. Western blot analysis of L. camara and L. montevidensis extracts in Caco cells. Results were expressed as mean ± SE, (n = 3). *** p < 0.001 and **** p < 0.0001 is considered significant compared to the Caco control untreated cells. Bands were relatively expressed to β-actin protein (internal control) (Figures S7 and S8) by western blot analysis.
Figure 8. Western blot analysis of L. camara and L. montevidensis extracts in Caco cells. Results were expressed as mean ± SE, (n = 3). *** p < 0.001 and **** p < 0.0001 is considered significant compared to the Caco control untreated cells. Bands were relatively expressed to β-actin protein (internal control) (Figures S7 and S8) by western blot analysis.
Plants 11 01699 g008
Figure 9. Photos of the collected fresh leaves of L. camara (A) and L. montevidensis (B).
Figure 9. Photos of the collected fresh leaves of L. camara (A) and L. montevidensis (B).
Plants 11 01699 g009
Table 1. LC–LTQ–MS–MS dereplication of the alcoholic leaf extracts of L. camara (Lc) and L. montevidensis (Lm) crude extracts.
Table 1. LC–LTQ–MS–MS dereplication of the alcoholic leaf extracts of L. camara (Lc) and L. montevidensis (Lm) crude extracts.
No.Compound NameRtFormulam/zMS2Relative AbundanceChemical ClassRef.
LcLm
1.Palmitamide1.69C16H33NO257.2312239.1328, 201.1358, 187.1268, 103.0043, 88.993611.844.58FA amideGNPS
2.Gallic acid2.67C7H6O5171.5321152.9517, 85.914717.8512.44Phenolic acid [31]
3.α-Humulene 2.76C15H24202.3955155.9594, 141.9675, 127, 93919.654.14Monocyclic sesquiterpeneGNPS
4.p-Coumaric acid3.73C9H8O3166.5324148.9633, 119.93895.953.97Phenolic acid[32]
5.Theveside3.88C16H22O11391.1981373.0371, 355.0253, 279.0401, 228.9559, 210.9715, 192.9794, 148.9357.156.09Iridoid[33]
6.Ferulic acid 4.82C10H10O4193.3430174.9286, 162.9635, 116.995115.3214.58Phenolic acid[34]
7.Lamiridoside8.01C17H26O12425.3458276.1333, 218.0855, 160.057612.5212.14Iridoid[35]
8.Momorodol9.84C26H49O5441.5767292.1333, 234.0912, 176.1231, 172.0572, 160.08179.096.65Triterpene[36]
9.Pomolic acid10.01C30H48O4473.4977455.1928, 397.1318, 321.1171, 227.0642, 169.069211.083.49Triterpene[13,37]
10.Coprostanone10.12C27H46O387.3893369.0617, 355.1737, 351.2124, 313.1629, 269.18626.313.55TriterpeneGNPS
11.Dihydrixyolean-enoic acid
(Hederagenin)
10.12C30H49O4473.5281455.1928, 397.1318, 379.2358, 339.2030, 321.1171, 245.1248, 227.0642, 203.158811.088.26Triterpene[37,38]
12.Carminic acid10.18C22H20O13491.3225315.1465, 300.1916, 159.102232.6221.71FlavonoidGNPS
13.Amyrin10.42C30H50O467.4973334.1802, 276.1421, 218.0966, 160.013-6.39Triterpene[38]
14.Rutin10.77C27H30O16611.6093553.2927, 477.2678, 317.1439, 301.124, 271.109545.8639.98Flavonoid[31]
15.Lantadene C11.32C35H54O5553.61535.2781, 525.3694, 495.2407, 477.2509, 401.1971, 301.131721.5124.82Triterpene[39]
16.Calceolarioside E11.88C23H26O11479.4901461.0790, 443.0788, 425.1241, 317.0097, 299.1252, 263.1182, 162.98217.1711.54Phenolic acid[37]
17.Triterpene glycoside derivative 12-589.7351513.2347, 455.2542, 437.2231, 379.2318, 285.144357.7473.83Triterpene glycoside[39,40]
18.Triterpene glycoside derivative 12.4-727.4208709.4453, 669.3836, 670.4085, 651.4137, 611.3975, 593.370856.8473.05Triterpene glycoside
19.Triterpene glycoside derivative 12.5-647.7673571.2557, 513.2347, 455.2542, 437.2231, 379.2318, 285.144373.45100Triterpene glycoside[41]
20.Triterpene glycoside derivative12.8-705.8645571.2820, 513.2588, 629.2966, 437.2466, 495.2869, 455.2817, 285.144355.6575.45Triterpene glycoside[39,40]
21.Triterpene glycoside derivative 13.4-785.4552727.4422, 709.4453, 669.3836, 670.4085, 651.4137, 611.3975, 593.3708,66.1467.99Triterpene glycoside
22.Durantoside13.13C35H40O19763.9281687.3165, 629.3169, 571.0399, 513.3507, 437.2202, 285.133639.4152.87Iridoid[40]
23.Dihydroxy-dimethoxyflavone-O-glucopyranoside (Camaroside)13.45C23H24O11477.4684459.1729, 357.1318, 315.2007, 301.174547.1736.08Flavonoid [37]
24.Triterpene glycoside derivative14.27-843.9122785.4807, 767.5064, 727.5031, 709.491854.3554.97Triterpene glycoside
25.Triterpene glycoside derivative 14.83-901.9307543.5972, 825.6067, 767.5857, 709.556639.5938.59Triterpene glycoside
26.Lantanoside14.68C25H26O12519.6086459.1729, 357.1318, 315.2007, 301.1745,10.8910.75Flavonoid [42]
27.Cirsiliol/
Trihydroxy-dimethoxyflavone
15.05C17H14O7331.4301316.1003, 285.1243, 271.1618, 151.05214.3017.36Flavonoid [43,44]
28.Hexahydroxyflavone (Gossypetin)15.07C15H10O8318.6483283.10, 242.90, 183.05, 169, 156.90, 109, 96.926.034.86Flavonoid [37]
29.Caffeic acid 16.26C9H9O4181.5156162.9605, 135.0327, 107.0433, 59.044023.1716.72Phenolic acid[44]
30.Copaenol16.44C15H25O221.7963203.0473, 175.0733, 161.049213.815.39Sesquiterpene[45]
31.Catechin16.81C15H15O6291.6731273.0806, 255.1193, 217.0495, 147.040212.799.06Flavonoid[46]
32.Methyl-hydroxylantanolate16.84C31H49O500.7488482.2634, 469.2448, 401.2497, 317.14575.213.48Triterpeme [47]
33.Ursangilic acid17.06C36H54O6583.6300565.2075, 485.2668, 467.3068, 449.3616.468.04Triterpene[40,48]
34.Benzalkonium chloride 17.65C21H38N+304.8513212.1338, 90.91763.6-Ammonium CompoundGNPS
35.Dihydroxy-dimethoxyflavone (Pectolinarigenin)18.05C17H14O6315.5381300.0404, 282.0015, 269.0966, 121.029426.1722.87Flavonoid[37,49]
36.Dihydroxy-trimethoxyflavone18.20C18H17O7345.4969330.1257, 313.1737, 285.16, 151.004217.834.92Flavonoid[50]
37.Lantaninilic acid/Lantoic acid18.50C30H46O5487.6703469.2092, 451.2662, 433.2741, 405.2914, 259.101118.7510.55Triterpene[37,51]
38.Camarin18.62C30H46O4471.865451.2739, 433.3931, 423.2796, 405.3678, 395.294, 313.2488, 271.19246.9315.27Triterpene[52,53]
39.Stigmasterol acetate18.77C31H50O2454.2024328.1359, 299.1358. 270.1251, 241.083, 211.9450, 182.971216.8318.26Triterpene[35]
40.Triterpene glycoside derivative18.99-927.9218851.6035, 793.5519, 735.5273, 677.4890, 635.444628.2734.97Triterpene
41.Pomonic acid19.24C30H46O4469.6669451.2739, 395.294, 313.248820.6817.92Triterpene[37]
42.Triterpene glycoside derivative19.80-985.9156909.6604, 851.6151, 793.5680, 735.5282, 677.492535.3743.41Triterpene
43.Lantadene A20.02C35H52O5552.7491524.3465, 506.4606, 478.4638, 316.265926.8831.96Triterpene[54]
44.Lantanone20.14C32H48O5512.3184482.4986, 425.2136, 357.3943, 328.3304, 299.2942, 270.18395.8147.77Triterpene[37]
45.Lablaboside derivative 20.51-1043.9023941.7347, 793.5754, 647.5658, 473.4372, 389.2796, 331.267137.0845.57Triterpene glycoside
46.Lantadene D21.21C34H52O5541.2581511.6045, 425.2182, 357.3688, 328.3118, 299.2821, 270.2123, 241.1226.5356.70Triterpene[39]
47.Lablaboside A21.26C54H87O231102.8948941.7347, 793.5754, 647.5658, 473.4372, 389.2796, 331.267137.3947.76Triterpene glycosides[41]
48.Icterogenin/Lantacin21.64C35H52O6570.2877551.2625, 451.2778, 405.2828, 357.3562, 299.2313, 241.112159.4367.93Triterpene[39,40,52]
49.Osmanthuside B22.33C29H36O13592.267574.2937, 524.5654, 447.2928, 389.3079, 331.2425, 273.157130.8532.81Phenolic acid [55]
50.Hydroxyoleanonic acid/Lantabetulic acid22.78C30H48O4470.0257452.2639, 434.261, 396.2762, 307.0825-17.92Triterpene[37,42,56]
51.Isonuomioside A23.01C28H34O15610.2413591.4889, 531.5561, 447.2902, 389.2357, 339. 1718, 243.048449.2948.15Phenolic acid [42]
52.Cistanoside C23.31C30H38O15639.2013621.2913, 552.4019, 505.355, 447.296744.4144.59Phenolic acid [55]
53.Lipedoside A25.42C29H36O14609.6940591.3207, 559.3793, 531.3948, 515.34449.2948.15Phenolic acid [55]
54.Apigenin-6,8-di-C-glycoside (Vicenin 2)25.48 C27H30O15594.9509576.4872, 534.3077, 474.3816, 642.376, 317.2311, 236.241310054.74Flavonoid [55]
55.Camarinic acid26.57C35H62O3529.1427283.2026, 256.3454, 246.3058, 242.3309, 163.1626, 149.154915.616.3Triterpene[57]
56.Pheophorbide A26.59C35H36N4O5593.9152533.391, 473.4104, 461.4372, 433.451930.6154.74Chlorophyll derivative[35]
57.Pectolinarigenin-O-rutinoside
(Pectolinarin)
27.88C29H34O15623.886605.3220, 545.3717, 459.3893, 395.3564, 367.300814.189.35Flavonoid [37]
58.Verbascoside/Forsythoside A27.89C29H36O15624.8313606.2446, 546.3597, 397.3595, 284.3636, 266.33779.166.87Phenolic acid [52,58]
59.Vanillic acid 31.12C12H6O4169.8434150.9395, 140.9568, 123.0144, 108.983316.9912.36Phenolic acid[44]
Table 2. The effects of Lantana extracts on the release of lactate dehydrogenase (LDH) in human neutrophils.
Table 2. The effects of Lantana extracts on the release of lactate dehydrogenase (LDH) in human neutrophils.
ExtractCell Viability (%)
L. camara95.88 ± 4.60
L. montevidensis97.11 ± 2.89
Percentage of cell viability (%) at 10 μg/mL. Results are presented as mean ± SEM (n = 3).
Table 3. Effects of Lantana extracts on superoxide anion generation in fMLF/CB-induced human neutrophils.
Table 3. Effects of Lantana extracts on superoxide anion generation in fMLF/CB-induced human neutrophils.
ExtractIC50 aInhibition%
(1 μg/mL)
Inhibition%
(3 μg/mL)
Inhibition%
(10 μg/mL)
L. camara1.57 ± 0.19 μg/mL24.80 ± 4.53 **91.94 ± 4. 90 ***100.49 ± 1.14 ***
L. montevidensis1.31 ± 0.14 μg/mL29.90 ± 4.28 ***97.70 ± 0.26 ***100.92 ± 0.29 ***
LY294002 b2.41 ± 0.26 μM
Results are presented as mean ± SEM (n = 3–5). ** p < 0.01, *** p < 0.001 compared to the control (DMSO). a Concentration necessary for 50% inhibition (IC50). b LY294002, the PI3K inhibitor, was used as a positive control with potent suppressive effects.
Table 4. Effects of Lantana extracts on elastase release in fMLF/CB-induced human neutrophils.
Table 4. Effects of Lantana extracts on elastase release in fMLF/CB-induced human neutrophils.
ExtractIC50 aInhibition%
(1 μg/mL)
Inhibition%
(3 μg/mL)
Inhibition%
(10 μg/mL)
L. camara2.40 ± 0.16 μg/mL9.95 ± 2.32 *64.22 ± 6.33 ***109.24 ± 5.15 ***
L. montevidensis1.90 ± 0.07 μg/mL16.68 ± 0.04 ***80.82 ± 4.68 ***115.84 ± 2.02 ***
LY294002 b3.18 ± 0.57 μM
Results are presented as mean ± SEM (n = 3–5). * p < 0.05, *** p < 0.001 compared to the control (DMSO). a Concentration necessary for 50% inhibition (IC50). b LY294002, the PI3K inhibitor, was used as the positive control with potent suppressive effects.
Table 5. Primer sequences used for qRT-PCR.
Table 5. Primer sequences used for qRT-PCR.
GeneForward Primer (/5–/3)Reverse Primer (/5–/3)
p53TAACAGTTCCTGCATGGGCGGCAGGACAGGCACAAACACGCACC
GSK-3βCCGACTAACACCACTGGAAGCTAGGATGGTAGCCAGAGGTGGAT
PI3KGCTCTCTCACTGCATACATTGTAGTCACAGCTGTATTGGTCG
GAPDHTGTGTCCGTCGTGGATCTGACCTGCTTCACCACCTTCTTGA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

El-Din, M.I.G.; Fahmy, N.M.; Wu, F.; Salem, M.M.; Khattab, O.M.; El-Seedi, H.R.; Korinek, M.; Hwang, T.-L.; Osman, A.K.; El-Shazly, M.; et al. Comparative LC–LTQ–MS–MS Analysis of the Leaf Extracts of Lantana camara and Lantana montevidensis Growing in Egypt with Insights into Their Antioxidant, Anti-Inflammatory, and Cytotoxic Activities. Plants 2022, 11, 1699. https://doi.org/10.3390/plants11131699

AMA Style

El-Din MIG, Fahmy NM, Wu F, Salem MM, Khattab OM, El-Seedi HR, Korinek M, Hwang T-L, Osman AK, El-Shazly M, et al. Comparative LC–LTQ–MS–MS Analysis of the Leaf Extracts of Lantana camara and Lantana montevidensis Growing in Egypt with Insights into Their Antioxidant, Anti-Inflammatory, and Cytotoxic Activities. Plants. 2022; 11(13):1699. https://doi.org/10.3390/plants11131699

Chicago/Turabian Style

El-Din, Mariam I. Gamal, Nouran M. Fahmy, Fulin Wu, Maha M. Salem, Omar M. Khattab, Hesham R. El-Seedi, Michal Korinek, Tsong-Long Hwang, Ahmed K. Osman, Mohamed El-Shazly, and et al. 2022. "Comparative LC–LTQ–MS–MS Analysis of the Leaf Extracts of Lantana camara and Lantana montevidensis Growing in Egypt with Insights into Their Antioxidant, Anti-Inflammatory, and Cytotoxic Activities" Plants 11, no. 13: 1699. https://doi.org/10.3390/plants11131699

APA Style

El-Din, M. I. G., Fahmy, N. M., Wu, F., Salem, M. M., Khattab, O. M., El-Seedi, H. R., Korinek, M., Hwang, T.-L., Osman, A. K., El-Shazly, M., & Fayez, S. (2022). Comparative LC–LTQ–MS–MS Analysis of the Leaf Extracts of Lantana camara and Lantana montevidensis Growing in Egypt with Insights into Their Antioxidant, Anti-Inflammatory, and Cytotoxic Activities. Plants, 11(13), 1699. https://doi.org/10.3390/plants11131699

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop