High-Throughput Sequencing Indicates a Novel Marafivirus in Grapevine Showing Vein-Clearing Symptoms
Abstract
:1. Introduction
2. Results
2.1. Analyses of the High-Throughput Sequencing (HTS) Data
2.2. Sequence and Phylogenetic Analyses of the GaMV Genome
2.3. Graft-Transmission of GaMV
2.4. Detection of GaMV in the Field
2.5. Sequence Identities of CP Genes and Phylogenetic Relationships between Different GaMV Isolates
3. Discussion
4. Materials and Methods
4.1. Plant Material for HTS
4.2. HTS and Bioinformatics Analyses
4.3. Amplification and Analyses of the GaMV Genome
4.4. Sequence Analyses
4.5. Graft-Transmission Assays
4.6. Survey of GaMV in the Field Samples
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dreher, T.W.; Edwards, M.C.; Gibbs, A.J.; Haenni, A.L.; Hammond, R.W.; Jupin, I.; Koenig, R.; Sabanadzovic, S.; Martelli, G.P. Tymoviridae. In Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses; King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E., Eds.; Academic Press: Cambridge, MA, USA, 2012; pp. 944–952. [Google Scholar]
- Cretazzo, E.; Velasco, L. High-throughput sequencing allowed the completion of the genome of grapevine Red Globe virus and revealed recurring co-infection with other tymoviruses in grapevine. Plant Pathol. 2017, 66, 1202–1213. [Google Scholar] [CrossRef]
- Martelli, G.P. Directory of virus and virus-like diseases of the grapevine and their agents. J. Plant Pathol. 2014, 96, 1–136. [Google Scholar]
- Hewitt, W.B. Some virus and virus-like diseases of grapevines. Bull. Calif. Dep. Agric. 1954, 43, 47–64. [Google Scholar]
- Boscia, D.; Sabanadzovic, S.; Savino, V.; Kyriakopoulou, P.E.; Martelli, G.P. A non mechanically transmissible virus associated with asteroid mosaic of the grapevine. Vitis 1994, 33, 101–102. [Google Scholar]
- Sabanadzovic, S.; Abou-Ghanem, N.; Digiaro, M.; Castellano, M.; Martelli, G.P. Grapevine fleck virus-like viruses in Vitis. Arch. Virol. 2000, 145, 553–565. [Google Scholar] [CrossRef] [PubMed]
- Abou Ghanem-Sabanadzovic, N.A.; Sabanadzovic, S.; Martelli, G.P. Sequence analysis of the 3′end of three grapevine fleck virus-like viruses from grapevine. Virus Genes 2003, 27, 11–16. [Google Scholar] [CrossRef]
- Vargas-Asencio, J.; Wojciechowska, K.; Baskerville, M.; Gomez, A.L.; Perry, K.L.; Thompson, J.R. The complete nucleotide sequence and genomic characterization of grapevine asteroid mosaic associated virus. Virus Res. 2017, 227, 82–87. [Google Scholar] [CrossRef]
- Hewitt, W.B.; Goheen, A.C.; Raski, D.J.; Gooding, G.V., Jr. Studies on virus diseases of the grapevine in California. Vitis 1962, 3, 57–83. [Google Scholar]
- Hewitt, W.B.; Goheen, A.C.; Cory, L.; Luhn, C. Grapevine fleck disease, latent in many varieties, is transmitted by graft inoculation. Ann. Phytopathol. 1972, 1972, 43–47. [Google Scholar]
- Boscia, D.; Martelli, G.P.; Savino, V.; Castellano, M.A. Identification of the agent of grapevine fleck disease. Vitis 1991, 30, 97–105. [Google Scholar]
- Zhang, Y.; Singh, K.; Kaur, R.; Qiu, W. Association of a novel DNA virus with the grapevine vein-clearing and vine decline syndrome. Phytopathology 2011, 101, 1081–1090. [Google Scholar] [CrossRef] [Green Version]
- Jakubiec, A.; Drugeon, G.; Camborde, L.; Jupin, I. Proteolytic Processing of Turnip Yellow Mosaic Virus Replication Proteins and Functional Impact on Infectivity. J. Virol. 2007, 81, 11402–11412. [Google Scholar] [CrossRef] [Green Version]
- Izadpanah, K.; Zhang, Y.P.; Daubert, S.; Masumi, M.; Rowhani, A. Sequence of the coat protein gene of Bermuda grass etched-line virus, and of the adjacent ‘marafibox’ motif. Virus Genes 2002, 24, 131–134. [Google Scholar] [CrossRef]
- Umer, M.; Liu, J.; You, H.; Xu, C.; Dong, K.; Luo, N.; Kong, L.; Li, X.; Hong, N.; Wang, G.; et al. Genomic, Morphological and Biological Traits of the Viruses Infecting Major Fruit Trees. Viruses 2019, 11, 515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maliogka, V.; Minafra, A.; Saldarelli, P.; Ruiz-García, A.; Glasa, M.; Katis, N.; Olmos, A. Recent advances on detection and characterization of fruit tree viruses using high-throughput sequencing technologies. Viruses 2018, 10, 436. [Google Scholar] [CrossRef] [Green Version]
- Bianchi, G.L.; De Amicis, F.; De Sabbata, L.; Di Bernardo, N.; Governatori, G.; Nonino, F.; Prete, G.; Marrazzo, T.; Versolatto, S.; Frausin, C. Occurrence of grapevine Pinot gris virus in Friuli Venezia Giulia (Italy): Field monitoring and virus quantification by real-time RT-PCR. EPPO Bull. 2015, 45, 22–32. [Google Scholar] [CrossRef]
- Fan, X.D.; Hong, N.; Zhang, Z.P.; Ren, F.; Hu, G.J.; Li, Z.N.; Zhou, J.; Dong, Y.F.; Wang, G.P. Identification of a divergent variant of grapevine berry inner necrosis virus in grapevines showing chlorotic mottling and ring spot symptoms. Arch. Virol. 2016, 161, 2025–2027. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Gao, S.; Padmanabhan, C.; Li, R.; Galvez, M.; Gutierrez, D.; Fuentes, S.; Ling, K.S.; Fei, Z.J. VirusDetect: An automated pipeline for efficient virus discovery using deep sequencing of small RNAs. Virology 2017, 500, 130–138. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Langmead, B.; Salzberg, S. HISAT: A fast spliced aligner with low memory requirements. Nat. Meth. 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- MacKenzie, D.J.; Mclean, M.A.; Mukerji, S.; Grenn, M. Improved RNA extraction from woody plants for the detection of viral pathogens by reverse transcription-polymerase chain reaction. Plant Dis. 1997, 81, 222–226. [Google Scholar] [CrossRef] [Green Version]
- Fan, X.D.; Hong, N.; Dong, Y.F.; Ma, Y.X.; Zhang, Z.P.; Ren, F.; Hu, G.J.; Zhou, J.; Wang, G.P. Genetic diversity and recombination analysis of grapevine leafroll-associated virus 1 from China. Arch. Virol. 2015, 160, 1669–1678. [Google Scholar] [CrossRef] [PubMed]
Virus | Genome | Met | Pep | Hel | RdRp | CP | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Length | %nt | %nt | %aa | %nt | %aa | %nt | %aa | %nt | %aa | %nt | %aa | |
BlVS | 6463 | 61.0 | 69.3 | 65.6 | 55.0 | 45.7 | 66.5 | 65.6 | 74.2 | 80.7 | 65.5 | 59.3 |
CSDaV | 6805 | 58.3 | 67.5 | 65.6 | 51.8 | 38.3 | 66.5 | 65.6 | 72.4 | 79.3 | 64.5 | 61.5 |
GAMaV | 6719 | 62.3 | 71.2 | 69.5 | 57.4 | 44.3 | 70.7 | 69.5 | 77.6 | 80.5 | 68.2 | 63.4 |
GSyV-1 | 6481 | 57.1 | 66.2 | 60.6 | 54.6 | 42.4 | 62.0 | 60.6 | 70.2 | 69.5 | 55.6 | 41.9 |
MRFV | 6337 | 60.5 | 66.9 | 64.5 | 56.3 | 43.5 | 63.0 | 64.5 | 72.3 | 76.8 | 61.8 | 48.0 |
NeVM | 6471 | 59.5 | 66.4 | 66.3 | 55.0 | 44.3 | 67.2 | 66.3 | 74.9 | 81.1 | 61.4 | 57.0 |
OBDV | 6509 | 62.0 | 70.2 | 70.2 | 54.3 | 41.2 | 67.2 | 70.2 | 76.8 | 81.1 | 66.7 | 56.7 |
OlV-3 | 7148 | 55.3 | 62.9 | 62.4 | 54.4 | 47.4 | 58.3 | 62.4 | 70.6 | 72.7 | 56.1 | 52.0 |
PeVD | 6573 | 56.6 | 66.9 | 63.5 | 54.6 | 44.4 | 63.0 | 63.5 | 72.8 | 80.2 | 54.3 | 39.6 |
GRVFV | 6577 | 54.7 | 64.3 | 60.5 | 52.1 | 42.6 | 61.6 | 60.5 | 71.4 | 74.3 | 55.3 | 41.8 |
GFkV | 7564 | 55.4 | 63.7 | 50.0 | 55.8 | 25.0 | 63.2 | 50.0 | 69.0 | 64.7 | 51.9 | 34.0 |
GRGV | 6850 | 52.2 | 65.0 | 58.2 | 56.3 | 40.7 | 63.7 | 58.2 | 66.5 | 63.8 | 49.8 | 31.7 |
APLV | 6337 | 51.2 | 60.5 | 55.9 | 51.4 | 37.2 | 59.1 | 55.9 | 63.5 | 63.8 | 40.5 | 28.0 |
TYMV | 6318 | 52.5 | 57.2 | 54.3 | 53.1 | 36.5 | 57.3 | 54.3 | 63.4 | 64.4 | 39.8 | 22.0 |
Isolate ID | Samples | location | GenBank Accession Number |
---|---|---|---|
BXWH1 | Bixiangwuhe | Liaoning | MZ422608 |
HM | Heimi | Liaoning | MZ422609 |
HFD | Hafude | Liaoning | MZ422610 |
ZZ | Zizao | Liaoning | MZ422611 |
JZJ | Jinzaojing | Liaoning | MZ422612 |
DWSMG | Dengwasimeigui | Liaoning | MZ422613 |
ThS1 | Thompson Seedless | Liaoning | MZ422614 |
MH | Muscat Hamburg | Liaoning | MZ422615 |
CrS | Crimson Seedless | Liaoning | MZ422616 |
RS1 | Ruby Seedless | Liaoning | MZ422617 |
MK | Muscat Kyoho | Liaoning | MZ422618 |
Ths2 | Thompson Seedless | Liaoning | MZ422619 |
JFYN | Jiafeiyinv | Liaoning | MZ422620 |
BXWH2 | Bixiangwuhe | Liaoning | MZ422621 |
RS2 | Ruby Seedless | Liaoning | MZ422622 |
OS | Otilia Seedless | Liaoning | MZ422623 |
LF | Lefu | Liaoning | MZ422624 |
XF | Xiagnfei | Liaoning | MZ422625 |
ML1 | Merlot | Shandong | MZ422626 |
ML2 | Merlot | Sichuan | MZ422627-28 |
Primer Name | Primer Sequence (5′→3′) | Position |
---|---|---|
GaMV-1F | ACCATCCACCGGGACACCATC | 38–58 |
GaMV-1R | ATGTAGGGGATGGAAGAGCTC | 1564–1544 |
GaMV-2F | ACCCGCCTTCCTCTGGGCTTG | 1450–1470 |
GaMV-2R | GTGGCGCGGAAGTTGAAGAAG | 2445–2425 |
GaMV-3F | GAGGATCTCTGGTCCGCTCTC | 2318–2338 |
GaMV-3R | GGCGGTCGAGAAGAATGTAGC | 3470–3450 |
GaMV-4F | ATCCTGACCAACTCGCAGAAC | 3350–3370 |
GaMV-4R | GGCTCGAAATCAAGGACGGAG | 5007–4987 |
GaMV-5F | CACTCACCTGCATGCGGCTCA | 4863–4883 |
GaMV-5R | GTAGAAGGAGGTTTCGGTGCC | 6001–5981 |
GaMV 5′-outer | TCTGAAGAAAGTCATGGCCGG | 180–160 |
GaMV 5′-inner | AACGATGAGGCGTTGATGCCG | 159–139 |
GaMV 3′-outer | TCCGCCTTCATCACCGACGAC | 5804–5824 |
GaMV 3′-inner | TCTGAAGAAAGTCATGGCCGG | 5842–5862 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fan, X.; Zhang, Z.; Li, C.; Ren, F.; Hu, G.; Zhang, B.; Dong, Y. High-Throughput Sequencing Indicates a Novel Marafivirus in Grapevine Showing Vein-Clearing Symptoms. Plants 2021, 10, 1487. https://doi.org/10.3390/plants10071487
Fan X, Zhang Z, Li C, Ren F, Hu G, Zhang B, Dong Y. High-Throughput Sequencing Indicates a Novel Marafivirus in Grapevine Showing Vein-Clearing Symptoms. Plants. 2021; 10(7):1487. https://doi.org/10.3390/plants10071487
Chicago/Turabian StyleFan, Xudong, Zunping Zhang, Chen Li, Fang Ren, Guojun Hu, Baodong Zhang, and Yafeng Dong. 2021. "High-Throughput Sequencing Indicates a Novel Marafivirus in Grapevine Showing Vein-Clearing Symptoms" Plants 10, no. 7: 1487. https://doi.org/10.3390/plants10071487
APA StyleFan, X., Zhang, Z., Li, C., Ren, F., Hu, G., Zhang, B., & Dong, Y. (2021). High-Throughput Sequencing Indicates a Novel Marafivirus in Grapevine Showing Vein-Clearing Symptoms. Plants, 10(7), 1487. https://doi.org/10.3390/plants10071487