Mining of Leaf Rust Resistance Genes Content in Egyptian Bread Wheat Collection
Abstract
:1. Introduction
2. Results
2.1. Field Evaluation of Leaf Rust Resistance
2.2. Screening for Leaf Rust Resistance Genes within Egyptian Wheat Collection
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Inoculation and Disease Assessment
4.3. Molecular Analysis
4.3.1. DNA Extraction
4.3.2. Molecular Detection of Lr Genes
4.3.3. PCR amplification and Gel Analysis
4.4. Data Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Chaves, M.S.; Martinelli, J.A.; Wesp-guterres, C.; Andre’, F.; Graichen, S.; Brammer, S.P. The importance for food security of maintaining rust resistance in wheat. Food Secur. 2013, 5, 157–176. [Google Scholar] [CrossRef] [Green Version]
- Igrejas, G.; Ikeda, T.M.; Branlard, G. The importance of wheat. In Wheat Quality for Improving Processing and Human Health; Springer: Cham, Switzerland, 2020; pp. 1–7. [Google Scholar]
- FAO. Agricultural Commodities Profiles and Relevant WTO Negotiations Isssues. Economic and Social Development Department, 2016. Available online: http://www.fao.org/economic/ess/ess-home/en (accessed on 1 September 2016).
- Raza, A.; Ali, R.; Sundas, S.M.; Xiling, Z.; Xuekun, Z.; Yan, L.; Jinsong, X. Impact of Climate Change on Crops Adaptation and Strategies to Tackle Its Outcome: A Review. Plants 2019, 8, 34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdelbacki, A.M.; Omara, R.I.; Najeeb, M.A.; Soliman, N.E. Identification of leaf rust resistant genes Lr9, Lr25, Lr28, Lr29 and Lr67 in ten Egyptian wheat cultivars using molecular markers. Biotechnol. Res. Int. 2014, 2, 89. [Google Scholar]
- Singh, R.P.; Huerta-Espino, J.; William, H.M. Genetics and breeding of durable resistance to leaf and stripe rusts in wheat. Turkish J. Agric. Forestry. 2005, 29, 121–127. [Google Scholar]
- Singla, J.; Linda, L.; Thomas, W.; Urmil, B.; Simon, G.K.; Beat, K. Characterization of Lr75: A partial, broad-spectrum leaf rust resistance gene in wheat. Theor. Appl. Genet. 2017, 130, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Kumar, D.; Animesh, K.; Vinod, C.; Om Prakash, G.; Subhash, C.B.; Sivasamy, M.; Sai Prasad, S.V.; Prakasha, T.L.; Hanif, K.; Rajender, S.; et al. Genome-Wide Association Studies in Diverse Spring Wheat Panel for Stripe, Stem, and Leaf Rust Resistance. Front. Plant Sci. 2020, 11, 748. [Google Scholar] [CrossRef]
- Kolmer, J.A. Tracking wheat rust on a continental scale. Genet. Plant Biol. 2005, 8, 441–449. [Google Scholar]
- Fatima, F.; McCallum, B.D.; Pozniak, C.J.; Hiebert, C.W.; McCartney, C.A.; Fedak, G.; You, F.M.; Cloutier, S. Identification of New Leaf Rust Resistance Loci in Wheat and Wild Relatives by Array-Based SNP Genotyping and Association Genetics. Front. Plant Sci. 2020, 11, 1728. [Google Scholar] [CrossRef]
- Chakraborty, S.; Newton, A.C. Climate change, plant diseases and food security: An overview. Plant Pathol. 2011, 60, 2–14. [Google Scholar] [CrossRef]
- Shahin, S.I.; El-Orabey, W.M. Assessment of grain yield losses caused by Puccinia triticina in some Egyptian wheat genotypes. Minufiya J. Agric. Res. 2016, 41, 29–37. [Google Scholar]
- Kassem, M.; El-Ahmed, A.; Hakim, M.S.; El-Khaliefa, M.; Nachit, M. Identification of prevalent races of Puccinia triticina Eriks. in Syria and Lebanon. Arab. J. Plant Prot. 2011, 29, 7–13. [Google Scholar]
- Yahyaoui, A.; Hakim, S.; Al-Naimi, M.; Nachit, M.M. Multiple disease resistance in durum wheat (Triticum turgidum L. var. durum). In Durum Wheat Improvement in the Mediterranean Region: New Challenges; CIHEAM: Zaragoza, Spain, 2000. [Google Scholar]
- Chen, W.Q.; Kang, Z.S.; Ma, Z.H.; Xu, S.C.; Jin, S.L.; Liu, T.; Jiang, Y.Y.; Gao, L. Integrated management. Suppression of wheat stripe rust caused by Puccinia striiformis f. sp. tritici in China. Sci. Agric. Sin. 2013, 46, 4254–4262. [Google Scholar]
- Kolmer, J.A. Leaf rust of wheat: Pathogen biology, variation and host resistance. Forests 2013, 4, 70–84. [Google Scholar] [CrossRef] [Green Version]
- Huerta-Espino, J.; Singh, R.P.; Germán, S.; McCallum, B.D.; Park, R.F.; Chen, W.Q.; Bhardwaj, S.C.; Goyeau, H. Global status of wheat leaf rust caused by Puccinia triticina. Euphytica 2011, 179, 143–160. [Google Scholar] [CrossRef]
- McCallum, B.D.; Hiebert, C.; Huerta-Espino, J.; Cloutier, S. Wheat leaf rust. Dis. Resist. Wheat 2012, 1, 33. [Google Scholar]
- Skowrońska, R.; Michał, K.; Agnieszka, T.; Jerzy, N. Development of multiplex PCR to detect slow rust resistance genes Lr34 and Lr46 in wheat. J. Appl. Genet. 2019, 60, 301–304. [Google Scholar] [CrossRef] [Green Version]
- Muthe, S.T.; Kulwal, P.L.; Gadekar, D.A.; Jadhav, A.S. Molecular marker based marker based detection of leaf rust resistance gene Lr34 in gene Lr34 in Indian bread wheat (Triticum aestivum L.). Australas. Plant Pathol. 2016, 45, 369–376. [Google Scholar] [CrossRef]
- Ali, M.; Zhang, L.; De Lacy, I.; Arief, V.; Dieters, M.; Pfeiffer, W.H.; Wang, J.; Li, H. Modeling and simulation of recurrent phenotypic and genomic selections in plant breeding under the presence of epistasis. Crop J. 2020, 8, 866–877. [Google Scholar] [CrossRef]
- Riaz, A.; Periyannan, S.; Aitken, E.; Hickey, L. A Rapid phenotyping method for adult plant resistance to leaf rust in wheat. Plant Methods. 2016, 12, 17. [Google Scholar] [CrossRef] [Green Version]
- Aktar-Uz-Zaman, M.; Tuhina-Khatun, M.; Hanafi, M.M.; Sahebi, M. Genetic Analysis of Rust Resistance Genes in Global Wheat Cultivars: An Overview. Biotechnol. Biotechnol. Equip. 2017, 31, 431–445. [Google Scholar] [CrossRef] [Green Version]
- Kou, Y.J.; Wang, S.P. Broad-spectrum and durability: Understanding of quantitative disease resistance. Curr. Opin. Plant Biol. 2010, 13, 181–185. [Google Scholar] [CrossRef]
- Flor, H.H. The complementary genetic systems in flax and flax rust. Adv. Genet. 1956, 8, 29–54. [Google Scholar] [CrossRef]
- Urbanovich, O.Y.; Malyshev, S.V.; Dolmatovich, T.V.; Kartel, N.A. Identification of Leaf Rust Resistance Genes in Wheat (Triticum aestivum L.) Cultivars Using Molecular Markers. Russ. J. Genet. 2006, 42, 546–554. [Google Scholar] [CrossRef]
- Kokhmetova, A.; Madenova, A.; Kampitova, G.; Urazaliev, R.; Yessimbekova, M.; Morgounov, A.; Purnhauser, L. Identification of Leaf Rust Resistance Genes in Wheat Cultivars Produced in Kazakhstan. Cereal Res. Commun. 2015, 44, 240–250. [Google Scholar] [CrossRef] [Green Version]
- Bolton, M.D.; Kolmer, J.A.; Garvin, D.F. Wheat leaf rust caused by Puccinia triticina. Mol. Plant Pathol. 2008, 9, 563–575. [Google Scholar] [CrossRef]
- McCallum, B.D.; Fetch, T.; Chong, J. Cereal rust control in Canada. Aust. J Agric. Res. 2007, 58, 639–647. [Google Scholar] [CrossRef]
- Leonova, I.N.; Ekaterina, S.S.; Elena, A.S. Genome-wide association study of leaf rust resistance in Russian spring wheat varieties. BMC Plant Biol. 2020, 20, 135. [Google Scholar] [CrossRef]
- McIntosh, R.A.; Dubcovsky, J.; Rogers, W.J.; Morris, C.; Appels, R.; Xia, X.C. Catalogue of gene symbols for wheat: 2015–2016 supplement. Komugi Wheat Genetic Resources Database. 2016. Available online: https://shigen.nig.ac.jp/wheat/komugi/genes/symbolClassList.jsp (accessed on 30 January 2018).
- Kolmer, J.A.; Singh, R.P.; Garvin, D.F.; Viccars, L.; William, H.M.; Huerta-Espino, J.; Ogbonnaya, F.C.; Raman, H.; Orford, S.; Bariana, H.S.; et al. Analysis of the Lr34/Yr18 rust resistance region in wheat germplasm. Crop Sci. 2008, 48, 1841–1852. [Google Scholar] [CrossRef] [Green Version]
- Soliman, N.E.K.; Abdelbacki, A.M.M.; Najeeb, M.A.A.; Omara, R.I. Geographical distribution of physiologic races of Puccinia triticina and postulation of resistance genes in new wheat cultivars in Egypt. Sci. J. Plant Pathol. 2012, 1, 73–80. [Google Scholar] [CrossRef]
- Abdelbacki, A.M.; Soliman, N.; Najeeb, M.; Omara, R. Postulation and identification of resistance genes against Puccinia triticina in new wheat cultivars in Egypt using molecular markers. Int. J. Chem. Environ. Biol. Sci. 2013, 1, 104–109. [Google Scholar]
- Cloutier, S.; McCallum, B.D.; Loutre, C.; Banks, T.W.; Wicker, T.; Feuillet, C.; Keller, B.; Jordan, M.C. Leaf rust resistance gene Lr1, isolated from bread wheat (Triticum aestivum L.) is a member of the large psr567 gene family. Plant Mol. Biol. 2007, 65, 93–106. [Google Scholar] [CrossRef] [PubMed]
- Schachermayr, G.; Siedler, H.; Gale, M.D.; Winzeler, H.; Winzeler, M.; Keller, B. Identification and localization of molecular markers linked to the Lr 9 leaf rust resistance gene of wheat. Theor. Appl. Genet. 1994, 88, 110–115. [Google Scholar] [CrossRef] [PubMed]
- Schachermayr, G.; Feuillet, C.; Keller, B. Molecular markers for the detection of the wheat leaf rust resistance gene Lr10 in diverse genetic backgrounds. Mol. Breed. 1997, 3, 65–74. [Google Scholar] [CrossRef]
- Seyfarth, R.; Feuillet, C.; Schachermayr, G.; Messmer, M.; Winzeler, M.; Keller, B. Molecular mapping of the adult-plant leaf rust resistance gene Lr13 in wheat (Triticum aestivum L.). J. Genet. Plant Breed. 2000, 54, 193–198. [Google Scholar]
- Prins, R.; Groenewald, J.Z.; Marais, G.F.; Snape, J.W.; Koebner, R.M.D. AFLP and STS tagging of Lr19, a gene conferring resistance to leaf rust in wheat. Theor. Appl. Genet. 2001, 103, 618–624. [Google Scholar] [CrossRef]
- Neu, C.; Stein, N.; Keller, B. Genetic mapping of the Lr20 Pm1 resistance locus reveals suppressed recombination on chromosome arm 7AL in hexaploid wheat. Genome 2002, 45, 737–744. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, L.; Gill, B.S. An RGA–like marker detects all known Lr21 leaf rust resistance gene family members in Aegilops tauschii and wheat. Theor. Appl. Genet. 2001, 103, 1007–1013. [Google Scholar] [CrossRef]
- Thind, A.K.; Wicker, T.; Šimková, H.; Fossati, D.; Moullet, O.; Brabant, C.; Vrána, J.; Doležel, J.; Krattinger, S.G. Rapid cloning of genes in hexaploid wheat using cultivar-specific long-range chromosome assembly. Nat. Biotechnol. 2017, 35, 793–796. [Google Scholar] [CrossRef]
- Schachermayr, G.M.; Messmer, M.M.; Feuillet, C.; Winzeler, H.; Winzeler, M.; Keller, B. Identification of molecular markers linked to the Agropyron elongatum-derived leaf rust resistance gene Lr24 in wheat. Theor. Appl. Genet. 1995, 90, 982–990. [Google Scholar] [CrossRef]
- Mohler, V.; Hsam, S.L.K.; Zeller, F.J.; Wenzel, G. An STS marker distinguishing the rye-derived powdery mildew resistance alleles at the Pm8/Pm17 locus of common wheat. Plant Breed. 2001, 120, 448–450. [Google Scholar] [CrossRef]
- Röder, M.S.; Korzun, V.; Wendehake, K.; Plaschke, J.; Tixier, M.H.; Leroy, P.; Ganal, M.W. A microsatellite map of wheat. Genetics 1998, 149, 2007–2023. [Google Scholar] [CrossRef]
- Naik, S.; Gill, K.S.; Rao, V.P.; Gupta, V.S.; Tamhankar, S.A.; Pujar, S.; Gill, B.S.; Ranjekar, P.K. Identification of a STS marker linked to the Aegilops speltoides-derived leaf rust resistance gene Lr28 in wheat. Theor. Appl. Genet. 1998, 97, 535–540. [Google Scholar] [CrossRef]
- Imbaby, I.A.; Mahmoud, M.A.; Hassan, M.E.M.; Abd-El-Aziz, A.R.M. Identification of leaf rust resistance genes in selected Egyptian wheat cultivars by molecular markers. Sci. World J. 2014, 2014, 574285. [Google Scholar] [CrossRef]
- Gold, J.; Harder, D.; Townley-Smith, F.; Aung, T.; Procunier, J. Development of a molecular marker for rust resistance genes Sr39 and Lr35 in wheat breeding lines. Electron. J. Biotechnol. 1999, 2, 1–2. [Google Scholar]
- Dadkhodaie, N.A.; Karaoglou, H.; Wellings, C.R.; Park, R.F. Mapping genes Lr53 and Yr35 on the short arm of chromosome 6B of common wheat with microsatellite markers and studies of their association with Lr36. Theor. Appl. Genet. 2011, 122, 479–487. [Google Scholar] [CrossRef]
- Bariana, H.S.; McIntosh, R.A. Cytogenetic studies in wheat. XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A. Genome 1993, 36, 476–482. [Google Scholar] [CrossRef]
- Raupp, W.J.; Brown-Guedira, G.L.; Gill, B.S. Cytogenetic and molecular mapping of the leaf rust resistance gene Lr39 in wheat. Theor. Appl. Genet. 2001, 102, 347–352. [Google Scholar] [CrossRef]
- Singh, R.P.; Mujeeb-Kazi, A.; Huerta-Espino, J. Lr46: A gene conferring slow-rusting resistance to leaf rust in wheat. Phytopathology 1998, 88, 890–894. [Google Scholar] [CrossRef] [Green Version]
- Helguera, M.; Khan, I.A.; Dubcovsky, J. Development of PCR markers for the wheat leaf rust resistance gene Lr47. Theor. Appl. Genet. 2000, 100, 1137–1143. [Google Scholar] [CrossRef] [Green Version]
- Hiebert, C.W.; Thomas, J.B.; McCallum, B.D.; Somers, D.J. Genetic mapping of the wheat leaf rust resistance gene Lr60 (LrW2). Crop Sci. 2008, 48, 1020–1026. [Google Scholar] [CrossRef]
- Kolmer, J.A.; Anderson, J.A.; Flor, J.M. Chromosome location, linkage with simple sequence repeat markers, and leaf rust resistance conditioned by gene Lr63 in wheat. Crop Sci. 2010, 50, 2392–2395. [Google Scholar] [CrossRef] [Green Version]
- Vida, G.; Gál, M.; Uhrin, A.; Veisz, O.; Syed, N.H.; Flavell, A.J.; Wang, Z.; Bedő, Z. Molecular markers for the identification of resistance genes and marker-assisted selection in breeding wheat for leaf rust resistance. Euphytica 2009, 170, 67–76. [Google Scholar] [CrossRef]
- Sayre, K.D.; Singh, R.P.; Huerta-Espino, J.; Rajaram, S. Genetic Progress in Reducing Losses to Leaf Rust in CIMMYT-Derived Mexican Spring Wheat Cultivars. Crop Sci. 1998, 38, 654–659. [Google Scholar] [CrossRef]
- Gessese, M.K. Description of Wheat Rusts and Their Virulence Variations Determined through Annual Pathotype Surveys and Controlled Multi-Pathotype Tests. J. Adv. Agric. 2019, 2019, 2673706. [Google Scholar] [CrossRef]
- Fahmi, A.I.; El-Shehawi, A.M.; El-Orabey, W.M. Leaf rust resistance and molecular identification of Lr 34 gene in Egyptian wheat. J. Microb. Biochem. Technol. 2015, 7, 338–343. [Google Scholar]
- Pathan, A.K.; Park, R.F. Evaluation of seedling and adult plant resistance to leaf rust in European wheat cultivars. Euphytica 2006, 149, 327–342. [Google Scholar] [CrossRef]
- Lagudah, E.S. Molecular genetics of race non-specific rust resistance in wheat. Euphytica 2011, 179, 81–91. [Google Scholar] [CrossRef]
- Park, R.F.; Mohler, V.; Nazari, K.; Singh, D. Characterization and mapping of gene Lr73 conferring seedling resistance to Puccinia triticina in common wheat. Theor. Appl. Genet. 2014, 127, 2041–2049. [Google Scholar] [CrossRef]
- McIntosh, R.A.; Wellings, C.R.; Park, R.F. Wheat Rusts: An Atlas of Resistance Genes; CSIRO Publishing: Clayton, VIC, Australia, 1995. [Google Scholar]
- Winzeler, M.; Mesterházy, Á.; Park, R. Resistance of European winter wheat germplasm to leaf rust. Agronomie 2000, 20, 783–792. [Google Scholar] [CrossRef]
- Singh, R.P.; Rajaram, S. Breeding for resistance in wheat. In Bread Wheat Improvement and Production; FAO: Rome, Italy, 2002; pp. 317–330. [Google Scholar]
- Singh, R.P.; Rajaram, S. Genetics of adult-plant resistance of leaf rust in ‘Frontana’ and three CIMMYT wheats. Genome 1992, 35, 24–31. [Google Scholar] [CrossRef]
- Hanzalová, A.; Dumalasová, V.; Zelba, O. Wheat leaf rust (Puccinia triticina Eriks.) virulence frequency and detection of resistance genes in wheat cultivars registered in the Czech Republic in 2016–2018. Czech J. Genet. Plant Breed. 2020, 56, 87–92. [Google Scholar] [CrossRef] [Green Version]
- Long, D.L.; Roelfs, A.P.; Leonard, K.J.; Roberts, J.J. Virulence and diversity of Puccinia recondita f. sp. tritici in the United States in 1992. Plant Dis. 1994, 78, 901–906. [Google Scholar]
- Tervet, I.; Cassell, R.C. The use of cyclone separation in race identification of cereal rusts. Phytopathology 1951, 4, 282–285. [Google Scholar]
- Roelfs, A.P.; Singh, R.P.; Saari, E.E. Rust Diseases of Wheat: Concepts and Methods of Disease Management; CIMMYT: Mexico City, Mexico, 1992. [Google Scholar]
- Peterson, R.F.; Campbell, A.B.; Hannah, A.E. A Diagrammatic Scale for Estimating Rust Intensity on Leaves and Stems of Cereals. Can. J. Res. 1948, 26c, 496–500. [Google Scholar] [CrossRef]
- Das, M.K.; Rajaram, S.; Kronstad, W.E.; Mundt, C.C.; Singh, R.P. Associations and genetics of three components of slow rusting in leaf rust of wheat. Euphytica 1993, 68, 99–109. [Google Scholar] [CrossRef]
- Pandey, H.N.; Menon, T.C.M.; Rao, M.V. A simple formula for calculating area under disease progress curve. Rachis 1989, 8, 38–39. [Google Scholar]
- Van der Plank, T.E. Plant Diseases. Epidemics and Control; Academic Press: New York, NY, USA, 1963; 349p. [Google Scholar]
- Snedecor, G.W.; Cochran, W.G. Statistics Methods, 6th ed.; The Iowa State University Press: Iowa City, IA, USA, 1967; 593p. [Google Scholar]
- Abouseadaa, H.H.; Atia, M.A.M.; Younis, I.Y.; Issa, M.Y.; Ashour, H.A.; Saleh, I.; Osman, G.H.; Arif, I.A.; Mohsen, E. Gene-Targeted Molecular Phylogeny, Phytochemical Profiling, and Antioxidant Activity of Nine Species Belonging to Family Cactaceae. Saudi J. Biol. Sci. 2020, 27, 1649–1658. [Google Scholar] [CrossRef]
- Abdeldym, E.A.; El-Mogy, M.M.; Abdellateaf, H.R.L.; Atia, M.A.M. Genetic Characterization, Agro-Morphological and Physiological Evaluation of Grafted Tomato under Salinity Stress Conditions. Agronomy 2020, 10, 1948. [Google Scholar] [CrossRef]
- Jaccard, P. Étude comparative de la distribution florale dans une portion des Alpes et des Jura. Bull. Soc. Vaudoise Sci. Nat. 1901, 37, 547–579. [Google Scholar]
- Hammer, Ø.; Harper, D.A.; Ryan, P.D. PAST: Paleontological statistics software package for education and data analysis. Palaeontol. Electron. 2001, 4, 9. [Google Scholar]
- Liu, B.H. Statistical Genomics: Linkage, Mapping, And QTL Analysis; CRC Press: Boca Raton, FL, USA, 1998. [Google Scholar]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314. [Google Scholar]
- Powell, W.; Morgante, M.; Andre, C.; Hanafey, M.; Vogel, J.; Tingey, S.; Rafalski, A. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol. Breed. 1996, 2, 225–238. [Google Scholar] [CrossRef]
- Tessier, C.; David, J.; This, P.; Boursiquot, J.M.; Charrier, A. Optimization of the choice of molecular markers for varietal identification in Vitis vinifera L. Theor. Appl. Genet. 1999, 98, 171–177. [Google Scholar] [CrossRef]
- Prevost, A.; Wilkinson, M.J. A new system of comparing PCR primers applied to ISSR fingerprinting of potato cultivars. Theor. Appl. Genet. 1999, 98, 107–112. [Google Scholar] [CrossRef]
- Metsalu, T.; Vilo, J. ClustVis: A web tool for visualizing clustering of multivariate data using Principal Component Analysis and heatmap. Nuc. Acids Res. 2015, 43, W566–W570. [Google Scholar] [CrossRef]
- Alzahrani, O.; Abouseadaa, H.; Abdelmoneim, T.; Alshehri, M.; El-Beltagi, H.; El-Mogy, M.; Atia, M. Agronomical, physiological and molecular evaluation reveals superior salt-tolerance in bread wheat through salt-induced priming approach. Not. Bot. Horti. Agrobot. Cluj. Napoca. 2021, 49, 1–21. [Google Scholar] [CrossRef]
- Mokhtar, M.; Hussein, E.; El-Assal, S.; Atia, M. VfODB: A comprehensive database of ESTs, EST-SSRs, mtSSRs, microRNA-target markers and genetic maps in Vicia faba. AoB Plants. 2020, 12, plaa064. [Google Scholar] [CrossRef]



| Code | Varieties | FRS | AUDPC | r-Value | |||
|---|---|---|---|---|---|---|---|
| 18/19 | 19/20 | 18/19 | 19/20 | 18/19 | 19/20 | ||
| 1 | Mabrok | 0.33 | 1.67 | 5.00 | 40.00 | 0.050 | 0.060 |
| 2 | Sakha 95 | 1.67 | 2.00 | 2.50 | 63.00 | 0.060 | 0.050 |
| 3 | Montana | 0.67 | 0.67 | 23.50 | 70.50 | 0.080 | 0.080 |
| 4 | Sohag 5 | 1.67 | 1.00 | 37.50 | 5.00 | 0.030 | 0.030 |
| 5 | Misr 2 | 1.00 | 0.67 | 21.50 | 33.50 | 0.030 | 0.070 |
| 6 | Giza 168 | 1.67 | 2.32 | 22.50 | 24.50 | 0.000 | 0.000 |
| 7 | Nubaria 1 | 11.67 | 13.00 | 103.00 | 119.50 | 0.180 | 0.180 |
| 8 | Giza 144 | 18.33 | 26.67 | 370.00 | 382.00 | 0.120 | 0.120 |
| 9 | Giza 155 | 7.33 | 8.67 | 162.50 | 89.50 | 0.140 | 0.150 |
| 10 | Giza 156 | 7.00 | 8.33 | 157.50 | 169.50 | 0.130 | 0.140 |
| 11 | Giza 157 | 25.67 | 26.00 | 368.50 | 310.00 | 0.120 | 0.120 |
| 12 | Giza 160 | 18.00 | 22.33 | 261.50 | 259.00 | 0.120 | 0.120 |
| 13 | Giza 167 | 3.00 | 9.00 | 210.00 | 179.00 | 0.110 | 0.110 |
| 14 | Giza 171 | 22.00 | 26.33 | 310.00 | 317.50 | 0.120 | 0.130 |
| 15 | Sakha 8 | 8.33 | 8.00 | 180.00 | 187.50 | 0.110 | 0.120 |
| 16 | Sakha 61 | 15.00 | 15.00 | 101.50 | 131.50 | 0.130 | 0.150 |
| 17 | Sakha 88 | 11.00 | 7.00 | 102.50 | 109.00 | 0.090 | 0.090 |
| 18 | Sakha 92 | 4.00 | 6.33 | 105.00 | 100.50 | 0.090 | 0.080 |
| 19 | Sakha 94 | 9.00 | 13.00 | 106.50 | 106.50 | 0.090 | 0.090 |
| 20 | Sids 8 | 4.00 | 4.00 | 115.00 | 132.50 | 0.110 | 0.120 |
| 21 | Sids 5 | 5.00 | 5.00 | 108.50 | 137.50 | 0.140 | 0.140 |
| 22 | Sids 6 | 10.67 | 18.67 | 140.00 | 171.50 | 0.120 | 0.130 |
| 23 | Sids 7 | 10.00 | 21.67 | 137.50 | 156.00 | 0.110 | 0.130 |
| 24 | Gemmeiza 7 | 22.33 | 22.00 | 278.00 | 232.50 | 0.090 | 0.080 |
| 25 | Sids 14 | 11.00 | 11.67 | 158.00 | 194.50 | 0.120 | 0.140 |
| 26 | Romana | 11.33 | 12.00 | 102.50 | 109.50 | 0.090 | 0.090 |
| 27 | Hendy 62 | 22.33 | 17.00 | 122.33 | 106.50 | 0.110 | 0.110 |
| 28 | Giza 139 | 28.33 | 30.00 | 334.00 | 390.00 | 0.174 | 0.169 |
| 29 | Gemmeiza 5 | 7.33 | 15.00 | 117.50 | 194.50 | 0.140 | 0.140 |
| 30 | Gemmeiza 3 | 10.00 | 21.67 | 274.50 | 294.00 | 0.130 | 0.150 |
| 31 | Gemmeiza 11 | 8.67 | 7.00 | 275.00 | 324.50 | 0.130 | 0.130 |
| 32 | Gemmeiza 12 | 8.00 | 7.00 | 109.50 | 194.50 | 0.110 | 0.120 |
| 33 | BanySwif 1 | 22.33 | 17.00 | 260.50 | 296.00 | 0.080 | 0.090 |
| 34 | BanySwif 5 | 20.33 | 19.00 | 294.50 | 278.00 | 0.112 | 0.102 |
| 35 | BanySwif 6 | 30.00 | 19.00 | 311.00 | 345.00 | 0.104 | 0.114 |
| 36 | BanySwif 7 | 22.67 | 22.33 | 315.00 | 330.50 | 0.104 | 0.106 |
| 37 | Sohag 4 | 22.33 | 22.00 | 343.00 | 305.50 | 0.126 | 0.105 |
| 38 | Gemmeiza 1 | 61.67 | 65.00 | 646.50 | 666.00 | 0.215 | 0.218 |
| 39 | Gemmeiza 9 | 75.00 | 60.00 | 708.50 | 701.00 | 0.200 | 0.218 |
| 40 | Giza162 | 65.00 | 65.00 | 760.00 | 811.50 | 0.213 | 0.215 |
| 41 | Giza 163 | 60.00 | 61.67 | 698.50 | 729.50 | 0.216 | 0.226 |
| 42 | Giza 164 | 70.00 | 65.00 | 905.00 | 996.50 | 0.213 | 0.250 |
| 43 | Giza 165 | 70.00 | 66.67 | 805.50 | 848.00 | 0.270 | 0.218 |
| 44 | Sids 1 | 85.00 | 88.33 | 725.50 | 738.00 | 0.237 | 0.217 |
| 45 | Sids 2 | 80.00 | 78.33 | 910.00 | 1003.50 | 0.202 | 0.237 |
| 46 | Sids 3 | 88.33 | 85.00 | 1008.00 | 1008.00 | 0.219 | 0.219 |
| 47 | Sakha 62 | 55.00 | 70.00 | 610.00 | 693.00 | 0.216 | 0.214 |
| 48 | Sakha 69 | 60.00 | 68.33 | 709.50 | 888.50 | 0.217 | 0.217 |
| 49 | Sohag 3 | 75.00 | 68.33 | 888.50 | 858.50 | 0.217 | 0.217 |
| 50 | BanySwif 4 | 85.00 | 86.67 | 1016.50 | 1111.00 | 0.219 | 0.219 |
| Mean | 27.48 | 28.37 | 336.79 | 358.87 | 0.14 | 0.14 | |
| LSD 0.05 | 0.85 | 2.741 | 0.009 | ||||
| LSD 0.01 | 1.112 | 3.609 | 0.005 | ||||
| Mean Squares | ||||
|---|---|---|---|---|
| SOV | d.f | FRS | AUDPC | ACI |
| Replications | 2 | 152.043 ** | 193.363 | 0.000 * |
| Treatments | 99 | 2298.145 ** | 289,775.3 ** | 0.008 ** |
| Genotypes (G) | 49 | 4592.258 ** | 580,801.9 ** | 0.004 ** |
| Years (Y) | 1 | 39.603 | 45,534.72 ** | 0.002 ** |
| G × Y | 49 | 50.139 ** | 3733.289 ** | 0.002 |
| Error | 198 | 14.103 | 146.796 | 0.004 |
| No. | Primer | Forward (5′-3′) | Reverse (5′-3′) | Ta (°C) | Product Size | Ref. |
|---|---|---|---|---|---|---|
| 1 | Lr1 | GGGACAGAGACCTTGGTGGA | GACGATGATGATTTGCTGCTGG | 65 | 760 b.p. | [35] |
| 2 | Lr 9 | TCCTTTTATTCCGCACGCCGG | CCACACTACCCCAAAGAGACG | 63 | 300 b.p. | [36] |
| 3 | Lr10 | GAAGCCCTTCGTCTCATCTG | TTGATTCATTGCAGATGAGATCACG | 61 | 282 b.p. | [37] |
| 4 | Lr 13 | GTGCCTGTGCCATCGTC | CGAAAGTAACAGCGCAGTGA | 58 | 130–280 b.p. | [38] |
| 5 | Lr19 | CATCCTTGGGGACCTC | CCAGCTCGCATACATCCA | 57 | 300 b.p. | [39] |
| 6 | Lr20 | ACAGCGATGAAGCAATGAAA | GTCCAGTTGGTTGATGGAAT | 55 | 300–430–542 b.p. | [40] |
| 7 | Lr21 | CCAAAGAGCATCCATGGTGT | CGCTTTTACCGAGATTGGTC | Touchdown “56–65” | 885 b.p. | [41] |
| 8 | Lr22a | AAGCTGACTTGTGCAGAGCT | AAACCCTTCTGCAACCCACA | Touchdown “56–65” | 600 b.p. | [42] |
| 9 | Lr 24 | TCTAGTCTGTACATGGGGGC | TGGCACATGAACTCCATACG | Touchdown “56–65” | 110–199–280 b.p. | [43] |
| 10 | Lr25 | CCACCCAGAGTATACCAGAG | CCACCCAGAGCTCATAGAA | Touchdown “56–65” | 250 b.p. | [26] |
| 11 | Lr26 | CATCCTTGGGGACCTC | CCAGCTCGCATACATCCA | Touchdown “56–65” | 260 b.p. | [44] |
| 12 | Lr27 | TTCCCATAACTAAAACCGCG | GGAACATCATTTCTGGACTTTG | 57 | 160–180–200 b.p. | [45] |
| 13 | Lr28 | CCCGGCATAAGTCTATGG TT | CAATGAATGAGATACGTGAA | Touchdown “56–65” | 380 b.p. | [46] |
| 14 | Lr29 | GTGACCTCAGGCAAT GCACACAGT | GTGACCTCAGAACCGATG TCCATC | Touchdown “56–65” | 160 b.p. | [26] |
| 15 | Lr32 | ATCGCCATCTCC TCT ACCA | GCGAACCCATGTGCTAAG | Touchdown “56–65” | 240–273 b.p. | [43] |
| 16 | Lr34 | GTGAAGCAGACCCAGAACAC | GACGGCTGCGACGTAGAG | Touchdown “56–65” | 270 b.p | [47] |
| 17 | Lr35 | AGAGAGAGTAGAAGAGCTGC | AGAGAGAGAGCATCCACC | Touchdown “56–65” | 252 b.p. | [48] |
| 18 | Lr36 | GCTGCATGAGCTCTGCAAT | TCTGTGAGGCATGACAGAA | 55 | 480 b.p. | [49] |
| 19 | Lr37 | AGGGGCTACTGACCAAGGCT | TGCAGCTACAGCAGTATGTACACAAAA | 64 | 190–250 b.p. | [50] |
| 20 | Lr39 | CCTGCTCTGCCCTAGATACG | ATGTGAATGTGATGCATGCA | Touchdown “56–65” | 180–240–260 b.p. | [51] |
| 21 | Lr46 | AGG GAAAAGACATCTTTTTTTTC | CGACCGACTTCGGGTTC | Touchdown “56–65” | 335 b.p. | [52] |
| 22 | Lr47 | AACTGGAAGCTGTACTCAGAG | GATGAACAATATGGGCAGG | Touchdown “56–65” | 400–480 b.p. | [53] |
| 23 | Lr48 | AATGGTTGTTCCCTCGACCT | CAAAAGGGAGAAAGGCGCAC | 60 | - | Unpublished |
| 24 | Lr50 | GTCAGATAACGCCGTCCAAT | CTACGTGCACCACCATTTTG | 60 | - | [45] |
| 25 | Lr52 | GGGTCTTCATCCGGAACTCT | CCATGATTTATAAATTCCACC | Touchdown “56–65” | 140 b.p. | [45] |
| 26 | Lr60 | ATTCACTTGCCCCTTTTAAACTCT | GAGCCGTAGGAAGGACATCTAGTG | Touchdown “56–65” | 120 b.p. | [54] |
| 27 | Lr63 | TGCACTTCCCACAAC ACATC | TTGCCACGTAGGTGATTTATGA | Touchdown “56–65” | 180–200 b.p. | [55] |
| 28 | Lr67 | GTGACCTCAGAACCGATGTCCATC | GCAAGGAAGAGTGTTCAGCC | Touchdown “56–65” | 200–450 b.p. | [56] |
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | 32 | 33 | 34 | 35 | 36 | 37 | 38 | 39 | 40 | 41 | 42 | 43 | 44 | 45 | 46 | 47 | 48 | 49 | 50 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Lr1 | − | + | − | − | − | − | − | − | + | + | + | − | + | − | − | − | − | + | − | − | + | + | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | + | + | − | − | − | − | − | − | − | − | − | − |
| Lr10 | − | − | + | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| Lr13−1 | − | − | − | − | − | − | − | − | + | + | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| Lr13−2 | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | − | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| Lr19 | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | − | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| Lr20−1 | + | + | + | + | + | + | + | + | + | + | − | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | − | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| Lr20−2 | − | + | − | − | − | + | − | − | − | − | − | + | + | + | + | + | + | + | + | + | + | + | + | + | + | − | + | − | + | + | + | + | + | − | − | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| Lr20−3 | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | + | + | + | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| Lr22a | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| Lr24−1 | + | + | + | − | + | + | + | + | − | + | − | + | + | − | + | + | + | − | + | + | + | − | + | − | − | − | − | + | − | − | + | + | − | + | + | + | + | − | + | − | + | + | + | + | + | + | + | − | − | + |
| Lr24−2 | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | + | − | − | − | − | − | − | − | − | − | + | − | − | − | − | + | − | − | − | − | + | − | − | − | + | − | − | + | − | − | − | − | − | − | + |
| Lr24−3 | − | − | − | − | − | − | − | − | − | − | − | − | − | + | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | + | − | − | − | + | + | + | + | − | + | − | + | + | + | + | − | − | + | − | − |
| Lr25 | − | + | + | − | − | − | − | − | − | − | − | − | − | − | − | − | − | + | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| Lr27−1 | − | − | + | + | − | + | + | + | + | + | + | − | + | − | − | − | − | − | − | + | + | − | − | + | + | + | + | − | − | − | − | − | − | − | + | − | + | − | + | − | − | − | − | − | − | − | − | − | − | − |
| Lr27−2 | + | + | − | − | + | − | + | − | − | − | − | + | − | + | + | + | + | + | + | − | − | + | + | − | − | − | − | + | + | + | − | − | − | + | − | + | − | + | − | + | + | − | − | − | − | − | − | − | + | − |
| Lr27−3 | − | − | − | + | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | + | + | + | + | − | − | − | − | − | − | − | + | + | + | + | + | + | + | − | + |
| Lr28 | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| Lr29 | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| Lr32 | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| Lr34 | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| Lr36 | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | − | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| Lr37−1 | + | + | − | − | − | − | − | − | − | + | − | − | + | + | − | − | − | − | − | + | + | − | − | + | − | + | − | + | + | − | − | − | + | − | + | − | − | − | − | − | + | − | − | − | + | + | − | − | − | + |
| Lr37−2 | − | + | − | + | + | + | + | + | + | + | − | + | + | + | − | − | + | − | − | − | + | − | + | + | − | − | + | + | + | − | + | + | − | − | − | − | + | + | − | + | + | − | + | + | − | + | + | + | − | + |
| Lr39−1 | − | − | + | − | − | − | + | + | + | + | − | − | − | + | − | − | − | − | − | − | − | − | − | − | + | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − |
| Lr39−2 | + | + | + | + | + | + | + | + | + | + | + | − | + | + | + | − | − | + | + | + | + | + | + | + | + | + | + | + | − | − | + | + | + | − | + | − | − | − | + | + | − | − | − | − | − | − | − | − | + | − |
| Lr39−3 | − | − | − | − | − | − | − | − | − | − | − | + | − | − | − | + | + | − | − | − | − | − | − | − | − | − | − | − | + | + | − | − | − | + | − | + | + | + | − | − | + | − | − | − | − | − | − | − | − | − |
| Lr47−1 | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| Lr47−2 | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | − | + | + | + | − | − | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + |
| Lr52 | + | + | + | + | + | + | + | + | + | + | + | + | − | − | + | − | − | − | − | + | + | + | − | − | + | − | + | − | − | − | + | − | − | + | + | + | + | + | + | + | + | − | − | − | − | − | + | − | + | − |
| Lr60 | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | − | + | + | + | + | − |
| Lr63−1 | + | − | + | + | + | + | − | + | − | − | − | − | − | + | + | + | + | − | + | − | − | + | + | − | − | − | − | + | + | + | − | − | − | − | + | − | − | − | + | + | − | − | − | − | − | − | − | − | + | − |
| Lr63−2 | − | + | − | − | − | − | + | − | + | + | + | + | + | − | − | − | − | + | − | − | − | − | − | + | − | + | + | − | − | − | + | + | + | − | − | + | + | + | − | − | + | + | + | + | + | + | + | + | − | + |
| Lr67−1 | + | + | + | + | + | + | + | − | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | − | + | + | − | − | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | − | + | + | + | + | + |
| Lr67−2 | − | − | − | + | − | − | − | − | − | − | − | + | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | + | − | − | − | − | − | − | + | + |
| Primer | NMB * | NPB ** | % § Polymorph. | H | PIC | E | H. av | MI | D | R |
|---|---|---|---|---|---|---|---|---|---|---|
| Lr1 | 0 | 1 | 100% | 0.32 | 0.269 | 0.2 | 0.0064 | 0.0013 | 0.9633 | 0.4 |
| Lr10 | 0 | 1 | 100% | 0.039 | 0.03843168 | 0.02 | 0.000784 | 0.0000157 | 1 | 0.04 |
| Lr13 | 0 | 2 | 100% | 0.499 | 0.37489998 | 1.02 | 0.004998 | 0.005098 | 0.7424242 | 0.12 |
| Lr19 | 0 | 1 | 100% | 0.039 | 0.03843168 | 0.98 | 0.000784 | 0.0007683 | 0.04 | 0.04 |
| Lr20 | 0 | 3 | 100% | 0.485 | 0.367376055 | 1.76 | 0.003233 | 0.0056904 | 0.6574497 | 0.72 |
| Lr22a | 1 | 0 | 0% | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| Lr24 | 0 | 3 | 100% | 0.453 | 0.350383 | 1.04 | 0.00302 | 0.003141 | 0.881342 | 1.44 |
| Lr25 | 0 | 1 | 100% | 0.113 | 0.106438 | 0.06 | 0.002256 | 0.000135 | 0.997551 | 0.12 |
| Lr27 | 0 | 3 | 100% | 0.457 | 0.352563433 | 1.06 | 0.003047 | 0.0032293 | 0.8766890 | 2.12 |
| Lr28 | 1 | 0 | 0% | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| Lr29 | 1 | 0 | 0% | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| Lr32 | 1 | 0 | 0% | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| Lr34 | 1 | 0 | 0% | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| Lr36 | 0 | 1 | 100% | 0.039 | 0.038432 | 0.98 | 0.000784 | 0.000768 | 0.04 | 0.04 |
| Lr37 | 0 | 2 | 100% | 0.498 | 0.374098 | 0.94 | 0.004982 | 0.004683 | 0.781616 | 1.48 |
| Lr39 | 0 | 2 | 100% | 0.44 | 0.34315 | 0.98 | 0.002933 | 0.002874 | 0.894765 | 1.4 |
| Lr47 | 1 | 1 | 50% | 0.058 | 0.056506 | 1.94 | 0.000582 | 0.001129 | 0.059394 | 0.12 |
| Lr52 | 0 | 1 | 100% | 0.487 | 0.368518 | 0.58 | 0.009744 | 0.005652 | 0.668571 | 0.84 |
| Lr60 | 0 | 1 | 100% | 0.077 | 0.073851 | 0.96 | 0.001536 | 0.001475 | 0.079184 | 0.08 |
| Lr63 | 0 | 2 | 100% | 0.497 | 0.373395 | 0.92 | 0.004968 | 0.004571 | 0.790909 | 1.76 |
| Lr67 | 0 | 2 | 100% | 0.5 | 0.375 | 1 | 0.005 | 0.005 | 0.752525 | 0.4 |
| Code | Verity | Pedigree | Year | Yield/Hectare (T/H) |
|---|---|---|---|---|
| 1 | BanySwif 1 | JO’’S’’/AA’’S’’//FG’’S’’ | 1987 | 6.3 |
| 2 | BanySwif 4 | AUSL/5/CANDO/4/BY*2/TAC//II27655/3/TME//ZB/W*2.ICD88-1120-ABL-0TR-1BR-0TR-6AP-0AP-OSD | 2007 | 6.3 |
| 3 | BanySwif 5 | DIPPERZ/BUSHEN3.CDSS92B128-1M-0Y-3B-0Y-0SD. | 2007 | 6.4 |
| 4 | BanySwif 6 | BOOMER-21/BUSCA-3.CDSS95Y01185-8Y-OM-0Y-0B-1Y-0B0SD | 2010 | 6.5 |
| 5 | BanySwif 7 | CBC509CHILE//sooty_9/RASCON_37/9/USDA595/3/D67.3/RABI//CRA/4/ALO/5/HUI/YAV_1/6/ARDENTE/7/HUI/YAV79/8/POD_9CDSS02Y01233T-0OTOPB-0Y-0M-26Y-0Y-0SD | 2017 | 6.8 |
| 6 | Gemmeiza 1 | Maya74/0n//1160-147/3/Bb/1991 Gall/4/chat “S”CM58924-IGM-OGM | 1991 | 5.83 |
| 7 | Gemmeiza 11 | BOW’’S’’/KVZ’’S’’//7C/SERI82/3/GIZA168/SKHA61. | 2011 | 6.59 |
| 8 | Gemmeiza 12 | OTUS/3/SARA/THB//VEE.CCMSS97Y00227S-5Y-010M-010Y-010M-2Y-1M-0Y-0GM | 2018 | 6.65 |
| 9 | Gemmeiza 3 | Bb/7C*2//Y50/KaL*3//Sakha8/4/Prv/WW/5/3/Bg/”S” ONCGM.4024 -IGM-13GM-2GM-0GM. | 1997 | 6.08 |
| 10 | Gemmeiza 5 | Vee”S”/SWM6525CGM.4017-1GM-6GM-3GM-0GM. | 1998 | 6.08 |
| 11 | Gemmeiza 7 | CMH74A.630/5X//Seri 82/3 Agent CGM.4611-2GM.-3GM.-1GM.-0CM. | 1999 | 6.55 |
| 12 | Gemmeiza 9 | Ald”S”/Huas//CMH74A.630/SxCGM4583-5GM-1GM-0GM. | 1999 | 6.55 |
| 13 | Giza 139 | HINDI90/KENYA256G. | 1947 | 2.14 |
| 14 | Giza 144 | REGENT/G.139 | 1958 | 2.61 |
| 15 | Giza 155 | REGENT/2∗GIZA139//MICADET/2∗HIND162 | 1968 | 3.08 |
| 16 | Giza 156 | RIO NEGRO/2∗MENATANE//KENYA/3∗2GIZA135/LTNE950 | 1972 | 3.08 |
| 17 | Giza 157 | GIZA155//PIT62/LR64/3/TZPP/KNOTT | 1977 | 4.99 |
| 18 | Giza 160 | Chenab 70/Giza 155 | 1982 | 5 |
| 19 | Giza 162 | Vcm//Cno 67/7C/3/Kal/Bb CM8399-D-4M-3Y-1M-1Y-1M-0Y | 1987 | 5.62 |
| 20 | Giza 163 | T. aestivum/Bon//Cno/7C CM33009-F-15M-4Y-2M-1M-1M-1Y-0M | 1987 | 5.62 |
| 21 | Giza 164 | KVZ/Buha “s”//Kal/Bb CM33027-F-15M-500y-0M | 1987 | 5.62 |
| 22 | Giza 165 | 0MCno/Mfd//Mon “S” CM43339-C-1Y-1M-2Y-1M-2Y-0B | 1991 | 5.83 |
| 23 | Giza 167 | Au/UP301//G11/SX/Pew”S”/4/Mai”S”/May”S”//Pew”S” CM67245-C-1M-2Y-1M-7Y-1M-0Y | 1995 | 6.08 |
| 24 | Giza 168 | Au/UP301//G11/SX/Pew”S”/4/Mai”S”/May”S”//Pew”S” CM67245-C-1M-2Y-1M-7Y-1M-0Y | 1995 | 6.55 |
| 25 | Giza 171 | Sakha 93/Gemmeiza 9 S.6-1GZ-4GZ-1GZ-2GZ-0S | 2013 | 6.61 |
| 26 | Hendy 62 | selectable from local cultivars | 1926 | 1.56 |
| 27 | Mabrok | GIZA7/BALADI42. | 1921 | 1.73 |
| 28 | Misr 2 | SKAUZ/BAV92. CMSS96M03611S-1M-010SY010M-010SY-8M-0Y-0S. | 2011 | 6.4 |
| 29 | Montana | selectable from local cultivars | - | 2.4 |
| 30 | Nubaria 1 | OASIS/5*BOR95/5/CNDO/R143//ENTE/MEX175/3/CNDO/R143 | - | 6.02 |
| 31 | Romana | selectable from local cultivars | - | 2.3 |
| 32 | Sakha 61 | Inia–RL4220//7C/YR”S” CM15430-25-55-0S-OS | 1980 | 5 |
| 33 | Sakha 62 | GIZA7/BALADI42. | 1980 | 5 |
| 34 | Sakha 69 | Inia–RL4220’7C/YR”S”CM15430- 25 -65-0S-0S | 1980 | 5 |
| 35 | Sakha 8 | Indus66*Norteno”S”-PK348 | 1976 | 5 |
| 36 | Sakha 88 | KVZ/TI/3/MAYA74 “S”//BB/TNTA | 1985 | 6.1 |
| 37 | Sakha 92 | NAPO63/TNT1A66//WERN “S” | 1987 | 5.62 |
| 38 | Sakha 94 | Opata/Rayon//Kauz CMBW9043180-OTOPM-3Y-010M-010M-010Y-10M-015Y-0Y | 2004 | 6.55 |
| 39 | Sakha 95 | POSTOR//SITE/MO/3/CHEN/AEGILOPS/SQUARROSA(TAUS) | 2018 | 6.55 |
| 40 | Sids 1 | HD2172/Pavon “S”//1158.57/Maya74 “S” SD46-4Sd-2SD-1SD-0SD | 1996 | 6.08 |
| 41 | Sids 14 | KAUZ”S”//TSI/SNB”S”. ICW94-0375-4AP-2AP-030AP-0APS-3AP. | 2014 | 6.65 |
| 42 | Sids 2 | HD2206/HORK “S”/3/NAPO63/NAPO63/INIA66//WREN “S” | 1996 | 6.08 |
| 43 | Sids 3 | SAKA69/GIZA155 | 1996 | 6.08 |
| 44 | Sids 5 | MAYA “S”/MON “S”/MON “S”//CMH74.592/3/GIZA157∗2 | 1996 | 6.09 |
| 45 | Sids 6 | Maya”s”/Mon “s”/CMH74.A592/3/Sakha 8*2SD10002-4SD-3SD- 1SD -0SD | 1996 | 6.08 |
| 46 | Sids 7 | Maya “S”/Mon “S”//CMH74A.592/3/Sakha8∗2 | 1996 | 6.03 |
| 47 | Sids 8 | Maya “S” Mon “S”/CMH74. A592/3/Sakha 8*2SD10002-14SD-3SD-1SD-0SD. | 1996 | 6.08 |
| 48 | Sohag 3 | MIEX’’ S’’/M G HA/51792//D URUM6. | 1991 | 6.3 |
| 49 | Sohag 4 | Ajaia-16//Hora/Jor/3/Gan/4/Zar/5/Souk-7/6/Stot//Altar84/aLdCDSS99B00778S-0TPY-0M-0Y-129Y-0M-0Y-1B-0SH | 1998 | 6.4 |
| 50 | Sohag 5 | Ajaia-16//Hora/Jro/3/Gan/4/Zar/5/Suok-7/6/Stot//Altar84/AldCDSS99B00778S-OTOPY-0M-0Y-129Y-0M-0Y-1B-0SH | 2016 | 6.6 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Atia, M.A.M.; El-Khateeb, E.A.; Abd El-Maksoud, R.M.; Abou-Zeid, M.A.; Salah, A.; Abdel-Hamid, A.M.E. Mining of Leaf Rust Resistance Genes Content in Egyptian Bread Wheat Collection. Plants 2021, 10, 1378. https://doi.org/10.3390/plants10071378
Atia MAM, El-Khateeb EA, Abd El-Maksoud RM, Abou-Zeid MA, Salah A, Abdel-Hamid AME. Mining of Leaf Rust Resistance Genes Content in Egyptian Bread Wheat Collection. Plants. 2021; 10(7):1378. https://doi.org/10.3390/plants10071378
Chicago/Turabian StyleAtia, Mohamed A. M., Eman A. El-Khateeb, Reem M. Abd El-Maksoud, Mohamed A. Abou-Zeid, Arwa Salah, and Amal M. E. Abdel-Hamid. 2021. "Mining of Leaf Rust Resistance Genes Content in Egyptian Bread Wheat Collection" Plants 10, no. 7: 1378. https://doi.org/10.3390/plants10071378
APA StyleAtia, M. A. M., El-Khateeb, E. A., Abd El-Maksoud, R. M., Abou-Zeid, M. A., Salah, A., & Abdel-Hamid, A. M. E. (2021). Mining of Leaf Rust Resistance Genes Content in Egyptian Bread Wheat Collection. Plants, 10(7), 1378. https://doi.org/10.3390/plants10071378

