Next Article in Journal
Two Origins, Two Functions: The Discovery of Distinct Secretory Ducts Formed during the Primary and Secondary Growth in Kielmeyera
Previous Article in Journal
Excessive Nitrogen Fertilization Favors the Colonization, Survival, and Development of Sogatella furcifera via Bottom-Up Effects
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Gene Expression Analysis of Microtubers of Potato Solanum tuberosum L. Induced in Cytokinin Containing Medium and Osmotic Stress

by
Lisset Herrera-Isidron
1,†,
Eliana Valencia-Lozano
2,†,
Pablo Yamild Rosiles-Loeza
1,
Maria Guadalupe Robles-Hernández
1,
Abigail Napsuciale-Heredia
1 and
Jose Luis Cabrera-Ponce
2,*
1
Unidad Profesional Interdisciplinaria de Ingeniería Campus Guanajuato (UPIIG), Instituto Politécnico Nacional, Av. Mineral de Valenciana 200, Puerto Interior, Silao de la Victoria, Guanajuato 36275, Mexico
2
Departamento de Ingeniería Genética, Centro de Investigación y de Estudios Avanzados del IPN, Unidad Irapuato, Irapuato 36824, Mexico
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Plants 2021, 10(5), 876; https://doi.org/10.3390/plants10050876
Submission received: 6 March 2021 / Revised: 12 April 2021 / Accepted: 22 April 2021 / Published: 27 April 2021
(This article belongs to the Section Plant Genetics, Genomics and Biotechnology)

Abstract

:
Potato microtuber productions through in vitro techniques are ideal propagules for producing high quality seed potatoes. Microtuber development is influenced by several factors, i.e., high content sucrose and cytokinins are among them. To understand a molecular mechanism of microtuberization using osmotic stress and cytokinin signaling will help us to elucidate this process. We demonstrate in this work a rapid and efficient protocol for microtuber development and gene expression analysis. Medium with high content of sucrose and gelrite supplemented with 2iP as cytokinin under darkness condition produced the higher quantity and quality of microtubers. Gene expression analysis of genes involved in the two-component signaling system (StHK1), cytokinin signaling, (StHK3, StHP4, StRR1) homeodomains (WUSCHEL, POTH1, BEL5), auxin signaling, ARF5, carbon metabolism (TPI, TIM), protein synthesis, NAC5 and a morphogenetic regulator of tuberization (POTH15) was performed by qPCR real time. Differential gene expression was observed during microtuber development. Gene regulation of two component and cytokinin signaling is taking place during this developmental process, yielding more microtubers. Further analysis of each component is required to elucidate it.

1. Introduction

Potato (Solanum tuberosum L.) is the fourth most important crop worldwide, with an average production of 388 million tons per year of tubers [1,2]. A potato tuber is a specialized stem that arises from the underground organ known as stolon [3]. Tubers are used for plant survival by vegetative propagation; they are sink organs in which surplus photosynthetic assimilates are stored [4], with starch [5,6], vitamins [7] and proteins [8,9] as the main storage components.
Plant biotechnology by means of in vitro tissue culture has been applied to produce potato tubers, called microtubers [10], minitubers [11,12] and vitrotubers [13].
Microtuber development has advantages provided by the handling, production and packaging of healthy seeds. The technique accelerates the multiplication process, producing more seed potato faster and cheaper than other methods. Researchers estimate that growers can earn 40% more from apical cuttings than from minitubers [14].
The induction of microtubers under in vitro conditions was first described by Baker [15]; Mes and Menge [16], using high content of sucrose in the medium, as plant pathology tool. An extensive number of articles since then have been published for basic and practical research [17,18,19,20].
The most critical factor for tuber development in potato plants is attributed to sucrose (SUC) [17]. SUC has been demonstrated to be essential for its osmotic effect [21], as an energy source, at higher content as signaling molecule [22], for review see. [17]. In microtuber development, growth rates depend on SUC availability [21] using radiolabeled sugars, and demonstrated that more sugar is translocated to microtubers when SUC, rather than glucose or fructose, is the carbon source. They concluded that SUC acts primarily as suitable carbon source for uptake and utilization by the plantlets, but, at 8%, it also provides a favorable osmolarity for the development of microtubers. Microtuber growth rate depends on SUC availability since SUC hydrolisis to glucose and fructose limited it [23]. SUC enhance tuber development, although it is unlikely that SUC itself is the tuber-inducing stimulus. It is considered that tuber development is induced rather by balance between inhibitory (i.e., gibberellins) and promoting plant growth regulators.
An extensive number of publications about potato microtuber induction using plant growth regulators have been made: auxins [24], gibberellins [25,26,27,28,29], strigolactones [30], abscisic acid [31], ethylene [32], jasmonate [3,33,34,35,36].
Cytokinins (CKs) are plant growth regulators (plant hormones) that promote potato tuber development; vascularity and root induction of potatoes is the effect of cytokinins (CKs) [37,38,39,40,41,42,43].
Furthermore, overexpression of POTH1 and StBEL5 (transcriptional factors, that regulate tuberization by targeting genes that control growth) increases cytokinin levels at the tips of stolons and promotes tuberization [44].
StBEL5 induces the activity of three LOG genes of potato, which encode for enzymes involved in cytokinin activation. Overexpression of LOG1 in tomato (Solanum lycopersicum) generated tubers from axillary buds [45], suggesting that this enzyme is a critical component of the tuberization pathway.
In addition, CKs participate in plant defense against biotic and abiotic adverse factors [46,47,48]. All the above indicates the important role of CKs in both the formation of tubers and the general development and resistance of potato plants [49,50,51,52,53].
CKs’ perception and signal transduction in Arabidopsis thaliana involves a His-Asp phosphorelay (MSP) similar to that found in bacterial two component signaling systems (TCS), major routes to sense and respond environmental stimuli. TCS has been implicated in control of the stem cell pool of the shoot apical meristem (SAM), leaf and root differentiation (root apical meristem, RAM), vasculature patterning, chloroplast biogenesis, photomorphogenesis, apical dominance, gravitropism, fertility, seed development, senescence and stress tolerance [54,55,56,57,58,59,60].
Cheng et al. [61], proposed from a physiological and proteomic analysis, a molecular mechanism model of metabolic pathways activated by exogenous cytokinins during tuber development (metabolism, bioenergy, storage, redox homeostasis, cell defense, rescue, transcription, translation, chaperones, signaling, and transport-related proteins).
Lomin et al. [52] published a detailed analysis of all basic elements of CK signal transduction in potato (Phureja genome). They found that potato contains all molecular elements for CK signaling via multistep phosphorelay (MSP), multiple alleles of histidine kinase genes (StHK), typical CK-binding, with StHK exhibiting organ-specific expression pattern and promoter activity hardly affected by CKs. Authors pointed out that peculiarities in CK perception apparatus might be associated with tuber development.
In this study, we used a dynamic network to propose a minimal model of the osmotic-protein regulatory network that integrates the previously reported cross-talk between the CK signaling pathways, with transcriptional regulators that have been shown to be important in tuber development. We described microtuber formation in potato S. tuberosum cv. Alpha, under osmotic stress in the presence of cytokinins, and analyzed gene expression by qPCR of the coding genes involved in the two-component signaling system (StHK1), cytokinin signaling, (StHK3, StHP4, StRR1) homeodomains (WUSCHEL, POTH1, BEL5), auxin signaling, ARF5, carbon metabolism (TPI, TIM), protein synthesis, NAC5 and a morphogenetic regulator of tuberization (POTH15).

2. Results

2.1. Microtuber Induction

Microtuberization was induced from explants derived from in vitro propagated shoots of potato cv. Alpha in solid osmotic stress medium, MR8-G6-2iP (medium MS [62], sucrose 8%, gelrite 6 g/L, 2iP 10 mg/L, −1.5 Mpa) after one month of incubation in darkness condition (Figure 1A). Microtubers were 7 mm in diameter, 2.3 per explant and 126.3 mg fresh weight. Explants cultured in non-osmotic medium developed only small swellings in the tip of shoot explants (Figure 1B).

2.2. Interaction Analysis of Proteins Directly Involved in Microtuberization

To understand a possible regulatory interaction, network of a STRING-based bioinformatic analysis with confidence (0.500) was made based on potato S. tuberosum genome (Figure 2).
A set of two component and cytokinin signaling-related coding genes were evaluated (StHK1, StHK3, StHP4 and StRR1) and according with the theoretical gene network in S. tuberosum, those proteins interact with WUSCHEL, POTH1 and BEL5 homeodomains and with morphogenic genes, such as POTH15, ARF5 (MP), carbon metabolism (TIM, TPI) and protein synthesis (NAC5) whose expression underwent significant changes during the tuberization of S. tuberosum.
Interestingly, StHK1 and POTH15 were pivotal in this network interaction, suggesting a greater importance for those proteins in the theoretical regulatory network in the tuberization of S. tuberosum.
This interaction network represents the first report of theoretical and preliminary evidence in the microtuberization process involving the two component and cytokinin signaling coupled with STBEL5, POTH1.

2.3. Gene Expression Analysis during Microtuberization

Genes involved in two component and cytokinin signaling, homeodomains, auxin signaling, master regulators of tuberization and carbon metabolism, were analyzed in non-osmotic conditions MR1-G3-2iP (MS medium supplemented with 1% sucrose, gelrite 3 g/L) and osmotic stress (MR8-G6-2iP) (MS medium supplemented with 8% sucrose, gelrite 6 g/L); both media with presence of 2iP (N6-(2-Isopentenyl adenine) 10 mg/L as cytokinin.
Expression levels of StHK1 (histidine kinase 1), that functions as an osmosensor that detects water stress, salinity, control stomatal, and it is related to signaling cascade of MAP Kinases (MAPK), was upregulated (Log2) in MR8-G6-2iP (osmotic stress) having as control MR1-G3-2iP (non-osmotic stress) medium, 5.44 at 8 days, 3.30 at 15 days and downregulated −1.56 at 23 days and −0.18 at 31 days (Figure 3, Table 1).
StHK3 (histidine kinase 3) is a negative regulator of the adaptive response to osmotic stress; it was downregulated in MR8-G6-2iP (osmotic stress) medium −2.32 to 8 days, −0.43 to 15 days, −1.62 to 23 days, 0.71 to 31 days (Figure 3, Table 1).
Levels of expression of the histidine-containing phosphotransferase, AHP4, was downregulated in the 8 and 31 days, expression level to −3.78 and −0.83 respectively in 15 to 23 days, expression level was 0.53 and 0.43 (Figure 3, Table 1).
A response regulator type B, StRR1 was downregulated −1.34 to 8 days and −1.77 to 23 days in MR8-G6-2iP (osmotic stress) and upregulated 0.14 to 15 days and 3.79 in 31 days (Figure 3, Table 1).
WUSCHEL and POTH1, related homeobox were upregulated in MR8-G6-2iP (osmotic stress), in three times, 8, 15, 31 dayss, and downregulated in 23 days; this suppresses the differentiation, allows the maturation of the tubers and prevents the emergence of shoots in the newly formed tuber; expression level 2.76, 3.31, −0.48, 0.74 and 0.28, 0.87, −3.02, 0.98 (Figure 3, Table 1).
POTH15, orthologue of STM (shoot meristem less), was found downregulated −0.83 at 8 days, −1.47 at 23 days and upregulated 2.10 at 15 days and 1.34 at 31 days (Figure 3, Table 1).
BEL5, bell-like homeodomain protein 5, was downregulated −1.39 at 8 days, −0.48 at 23 days and upregulated 0.64 at 15 dayss and 1.35 at 31 days (Figure 3, Table 1).
NAC5, nascent chain-associated complex is a highly conserved protein complex, and was upregulated 2.08 at 15 dayss, 0.89 at 23 dayss and downregulated −0.41 at 8 days, −0.89 at 31 days (Figure 3, Table 1).
TIM and TPI, triosephosphate isomerase, were expressly opposed. TIM was upregulated in three first times, 1.11, 2.58, 3.51, and downregulated in 31 days −4.17. TPI was downregulated in three first times, −0.44, −0.37, −1.78 and upregulated 0.88 at 31 days (Figure 3, Table 1).
ARF5, an auxin response factor 5, was downregulated −0.32 at 8 days, −1.08 at 23 days and upregulated 1.22 at 15 days and 31 days in osmotic stress medium (Figure 3, Table 1).

3. Discussion

Potato tuber formation is a complex developmental process that requires the interaction of environmental, biochemical and genetic factors. It involves many important biological processes, including carbon partitioning, signal transduction and meristem determination [47,48,49]. Under optimal crop field conditions, tuberization in potato is activated by signals that function in the leaf and move down into stolon tips to induce and activate tuber formation. The major signals that regulate the onset of tuber formation in potato are: CYCLING DOF FACTOR (StCDF1), StBEL5 and SELF-PRUNING6A (StSP6A) as mobile signals originating in the leaf [63,64,65].
In plant tissue culture medium with 2–3% sucrose lacking plant growth regulators, microtubers can be induced after 4–5 months in culture. However, microtubers are significantly accelerated and improved by using plant growth regulators or by changing culture conditions.
The most efficient factors for microtuber induction are increased sucrose concentrations (5–8%) [15,37,38,39,40,41,42,43] and the addition of cytokinins. Wakasa et al. [20] analyzed gene expression using microtubers and were found to be an excellent tool for the analysis of potato genes that are expressed in normal tubers. In our protocol, potato microtuberization was achieved in osmotic stress conditions using sucrose (8%) and high content of gelrite (6 g/L) compared to non-osmotic stress (MS, sucrose 1%, gelrite 3 g/L) MR1-G3-2iP after four weeks of incubation.
Gelrite is a bacterial (Pseudomonas elodea) polysaccharide composed of glucuronic acid, rhamnose and glucose, and has been used routinely to promote somatic embryo maturation of several plant species with concentrations exceeding the standard 3 g/L up to 12 g/L. It has been reported that high gel strength was associated with reduced water availability from the medium to the explants [66]. Gelrite influences cytokinin-sensitivity in the moss Physcomitrella patens inducing a bud protonema differentiation in the mutant cytokinin-sensitive PC22 [67]. The gelrite effect is attributable to physical and chemical properties of the gelling agent [68]. We found a positive effect on number, size and germination of microtubers induced in gelrite 6 g/L, compared in non-osmotic conditions. Our results demonstrate a synergism between gelrite concentration and cytokinin signaling, in addition to other genes strongly involved in tuber formation. Furthermore, the cytokinin 2iP was the best to induce microtuber development in our protocol. Lomin et al. [52] found that the highest affinity with potato histidine kinases was 2iP and trans-zeatin, compared with cis-zeatin, BAP, kinetin and thidiazuron.
In the present work, we propose a model of the osmotic-protein regulatory network that integrates the previously reported cross-talk between the CK signaling pathways, with transcriptional regulators that have been shown to be important in tuber development (Figure 4).
TCS is considered as one of the most crucial signal transduction systems in plants. Evidence suggests that TCS pathways are involved in sensing the environmental stimuli, ethylene signaling, light perception, circadian rhythm and cytokinin-dependent processes which include shoot and root development, vascular differentiation and leaf senescence [54,55,69]. Cytokinin signaling has been associated with the variety of stress response [70]. Histidine kinase of the TCS is known to function as an oxidative stress sensor [71], involved in the primary cell wall [72]. The genome of potato S. tuberosum contains 4 genes encoding histidine kinases (HK), 7 genes involved in phosphotransferase (HPT), 8 B-type response regulators (B-ARR), 8 A-type response regulators (A-ARR) and 4 C-type response regulators (C-ARR) [52].
These genes were devised in STRING database and are involved in the two-component signaling system (StHK1), cytokinin signaling, (StHK3, StHP4, StRR1) homeodomains (WUSCHEL, POTH1, BEL5), auxin signaling, ARF5, carbon metabolism (TPI, TIM), protein synthesis, NAC5 and a morphogenetic regulator of tuberization (POTH15).
Differential gene expression was found between TCS and cytokinin signaling genes (HK1, HP4), auxin signaling gene (ARF5), a homeodomain (WUSCHEL), carbon metabolism (TPI, TIM), protein synthesis (NAC5) and master regulators of tuberization (BEL5, POTH1, POTH15) during microtuber development.
According to our results derived from gene expression analysis and the network developed in STRING database, the molecular mechanisms can be interpreted as follows: 1.—Histidine-kinase1 (StHK1) is part of the two-component signaling system and was upregulated in MR8-G6-2iP (osmotic stress) treatment during the first two weeks of microtuber induction. This finding correlates with microtuber development in the first two weeks. Downregulation of StHK1 occurred when potato microtubers were already formed, in the third and fourth week of induction. AtHK1 is induced by cytokinins [73], functions as an osmosensor, a positive regulator of drought in Arabidopsis [74,75,76], salt stress [75,76], ABA signaling [77,78,79,80,81], ethylene [82,83] and stomatal control [84], and is related to MAPK cascade signaling [74] as well as conferring drought tolerance, by regulating levels of ABA accumulation [78,79,80,81]. AtHK1 is required in the regulation of desiccation process during seed formation. AHK1 mutation in Arabidopsis causes a decrease in storage proteins [83]. 2.—AHK1 interact and feeds phosphate to phosphorelay-integrating histidine protein AHP4; in our analysis, it was upregulated in osmotic stress (MR8-G6-2iP) treatment in the second and third week of incubation. Singh et al. [85] found that AHP4 was upregulated in root tissue of Arabidopsis under osmotic stress whereas other members of this family (AHP1, AHP2 and AHP3) were downregulated. 3.—Histidine kinase 3 (StHK3) interacts with AHP4. It was found downregulated in three consecutive weeks (1 to 3) in osmotic stress condition MR8-G6-2iP and upregulated in the fourth week of incubation. AHK3 is a negative regulator of the adaptive response to osmotic stress in Arabidopsis [75]. 4.—The response regulator type B, StRR1, was upregulated in the fourth week of incubation. In the two-component signaling system, phosphate is transferred to an aspartate residue within the receptor domain of the response regulator and this functions as a transcription factor. StRR1 is involved in DNA repair, oxidative stress response, drought tolerance and low temperatures [76,77,86,87,88], and as a transcriptional activator of WUSCHEL [89] through a cytokinin-dependent signaling, which demonstrates its relevance and confirms its role in the tuberization signaling system. Lomin et al. [52] verified the rapid activation of type A response regulators in the presence of cytokinins in potatoes. 5.—Following the network, WUSCHEL interacts with AHP4. In our analysis, WUSCHEL was upregulated in the first and second week of incubation and downregulated from third to fourth week of incubation. WUSCHEL plays a central role during the specialization of stem cells in meristems [60,90,91]. Upregulation of WUS allows us to infer that this is essential for the initiation of microtuberization and its downward regulation can promote microtubers’ dormancy. 6.—WUSCHEL interacts with POTH1. It was found upregulated in the first and second week of incubation similar than WUSCHEL in MR8-G6-2iP medium. This indicates that POTH1 is important in the regulation of the initiation and maturation of tubers. In potato, overexpression of POTH1 results in improved tuberization rate in light and dark conditions [92]. POTH1 has been largely analyzed during tuber development. When overexpressed along with BEL5, it increases cytokinin levels at the tips of stolons and promotes tuberization [44]. In addition, their homeodomain KNOX allows them to form dimers for the suppression of other genes [93]. Interaction of POTH1 protein with seven members of the BEL family has been analyzed in the potato plant. Using mutant analysis, multiple BEL proteins that bind POTH1 were identified, which implies that they are involved in a complex development control system in potato [44]. 7.—Next in the network, POTH1 interacts with BEL5, a bell-like homeodomain protein 5, that was upregulated only in the second week of incubation. BEL5 has the POX homeodomain, which allows it to form heterodimers with POTH1 and these dimers are determining factors in the maintenance of the inflorescence meristem in Arabidopsis [94]. BEL5 is a mobile long-range signaling molecule that promotes tuberization in potato [65]. BEL5 is induced by light and has a primary role in tuber maturation [95]. 8.—WUSCHEL also interacts with POTH15, an ortholog of STM in Arabidopsis. In our analysis, POTH15 was upregulated in the second and fourth week of incubation. POTH15 (STM) mutant causes defects in the formation and maintenance of SAM [96]. According to Endrizzi et al. [97], STM regulates the expression of WUS. Scofield et al. [96] showed that STM prevents the meristem organizing center cells by adopting specific lateral destinations. WUSCHEL and STM gene regulation converge in suppression of differentiation, coexpression of both genes produces a synergistic effect [98]. 9.—ARF5, an auxin response factor 5, interacts with AHP4, POTH15, WUSCHEL, CLAVATA1 and PIN1. ARF5 was upregulated in the second and fourth week of incubation in MR8-G6-2iP (osmotic stress) medium. ARF5 mediate organ formation and vascular tissues throughout the Arabidopsis life cycle, and its expression is gradually restricted to the vasculature as the organs mature [99,100]. Upregulation in the second week is coincident with tuber enlargement. 10.—Alfa-nascent chain-associated (NAC5) complex is a highly conserved protein complex and was upregulated in the second and third week of incubation. αNAC plays an important role in conjunction with its heterodimer βNAC as regulator and as a chaperone in protein synthesis during translation, joining newly synthesized polypeptides to protect them from proteolysis and facilitate their folding in ribosome biogenesis and protein assembly; and in transport to other organelles, there is evidence that translation is less intense when NAC is absent from the ribosome [101]. The substantial increase in αNAC expression at the second week is attributed to cell division and growth in tuber formation. In the network, αNAC interacts with S10 ribosomal protein, that interacts with THY-1 and thereby indirectly to the isoforms TIM and TPI. Furthermore, THY-1 interacts with two histidine-kinase proteins, HK1, part of a two-component signaling system and HK4 (WOL/CRE1) which is a primary cytokinin receptor [102]. 11.—In the interaction network, triosephosphate isomerase (TPI and TIM) interacts with the bifunctional dihydrofolate reductase-thymidylate synthase, THY-1, involved in the de novo biosynthesis of dTMP nucleotide, and metabolism of folate [103]. TIM and TPI were found expressed opposed. TIM was upregulated in the first three weeks and TPI downregulated. Both TPI and TIM play crucial roles in glycolysis and glycogenesis [104]. TIM was found to be upregulated in a proteomic analysis of rice roots under hydric stress, due mainly to the supply of additional energy in form of ATP required to maintain homeostasis under these conditions [105]. Similar regulation pattern under hydric stress conditions was reported in maize (cytosolic) [106] and rice leaves (cytosolic) [107]. Upregulation during induction, initiation and enlargement of the tuber in the transcriptional analysis of TIM, and the primary interactions of TIM and TPI in the network, indicate its importance to carry out the primary mechanisms of tuber induction, initiation and enlargement, and the enzymes are essential in carbohydrate metabolism and energy generation.
Further analysis of each component is required to validate this network. Transcriptomic analysis, overexpression and downregulation of these genes are currently in evaluation.

4. Materials and Methods

4.1. Plant Material

4.1.1. Potato Shoot Micropropagation

Potato cv. Alpha plantlets were propagated by shoot proliferation under in vitro conditions in MS medium [62], supplemented with 30 g/L sucrose (CAT 57-50-1 Sigma-Aldrich, St. Louis, MO, USA), activated charcoal (CAT: 242276 Sigma-Aldrich, St. Louis, MO, USA) (0.3%), pH 5.8 and solidified with 3 g/L gelrite (GELZAN CAT. G1910 Sigma-Aldrich, St. Louis, MO, USA). Shoots were incubated at 25/17 °C under fluorescent light at 25 µmol/m2/s of irradiance.

4.1.2. Potato Microtuber Induction

Potato microtuber induction was induced by culture of stem segments containing two internodes and leaves, about 3 cm length, in flasks containing MR8-G6-2iP medium: MS medium, supplemented with 2iP 10 mg/L, 8 % sucrose, 6 g/L gelrite, activated charcoal (0.3%), pH 5.8. As control medium, MR1-G3-2iP (MS medium supplemented with 1% sucrose, 3 g/L gelrite and 10 mg/L 2iP) was used. Containers were sealed with plastic and incubated in dark at 25/17 °C for 31 dayss of incubation.

4.1.3. Isolation of RNA and qPCR Analysis

Total RNA derived from four times (8, 15, 23, 31 dayss) was isolated using Trizol (Invitrogen, Carlsbad, CA, USA), RNA concentration was measured by its absorbance at 260 nm, ratio 260 nm/280 nm was assessed, and its integrity confirmed by electrophoresis in agarose 1% (w/v) gels. Samples of cDNA were amplified by PCR using SYBRTM Green (ThermoFisher CAT: 4312704, Waltham, MA, USA) in Real-Time PCR Systems (CFX96 BioRad, Herules, CA, USA). The expression of EF1 and SEC3 was used as reference for calculating the relative amount of target gene expression using the 2−ΔΔCT method [108,109]. qPCR analysis was based on at least five biological replicates for each sample with three technical replicates.

4.1.4. Interaction Analysis of Proteins Directly Involved in Tuberization

A gene network with a confidence (0.500) was performed with STRING [110]; based on S. tuberosum, homologous genes present in S. tuberosum genome in Sol genomics network [111]. The selected genes were involved in cytokinin signaling, AHK1, AHK3, AHP4, ARR1, auxin signaling; ARF5 (monopteros), homeodomains; WUSCHEL, BEL5, POTH1; master regulator POTH15, carbon metabolism TIM, TPI and protein folding NAC5. Gene identifier (Id) was made according to UNIPROT [112], NCBI [113] database. Homologous in S. tuberosum greater than 60% in protein sequence with A. thaliana were considered. Oligonucleotides were designed to qPCR (2ΔΔCT method analysis) gene expression or transcriptional analysis (Table 1).

5. Conclusions

  • Microtubers were suitable plant material for the analysis of gene expression.
  • High content of sucrose (8%) and gelrite (6 g/L) enhances microtuber number, size and germination compared to non-osmotic medium.
  • Differential gene expression of genes analyzed in microtubers induced under osmotic stress confirmed the hypothesis that TCS and cytokinin signaling are coupled with genes that have been associated in tuberization.
  • Improvement of the understanding in molecular mechanisms involved in potato microtuberization was achieved by STRING database bioinformatic tool.

Author Contributions

L.H.-I. and E.V.-L. conceived and designed the research, performed the experiments, analyzed the data and wrote the manuscript; P.Y.R.-L., M.G.R.-H. and A.N.-H. performed experiments as bachelor students; J.L.C.-P. conceived and designed the research, performed the experiments, supervision, analyzed the data and wrote and edited the final manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded, in part, by IPN (project SIP 20202226).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Acknowledgments

We thank Rosalia Vuelvas-Nolasco for her excellent technical assistance of plant tissue culture of potato and medium preparation. We also thank Ossiel Recoder, who was involved at the beginning of potato micropropagation and microtuberization assays. This manuscript is dedicated to the memory of Rosa Maria Rangel-Cano, who was involved with potato tissue culture for many years, and unfortunately, passed away in 2017.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Birch, P.R.; Bryan, G.; Fenton, B.; Gilroy, E.M.; Hein, I.; Jones, J.T.; Prashar, M.A.; Taylor, M.A.; Torrance, L.; Toth, I.K. Crops that feed the world 8: Potato: Are the trends of increased global production sustainable? Food Secur. 2012, 4, 477–508. [Google Scholar] [CrossRef]
  2. Food and Agriculture Organization of the United Nations, Land Resources. FAO. 2017. Available online: http://www.fao.org/nr/land/databasesinformation-systems/en/ (accessed on 15 June 2017).
  3. Jackson, S.D. Multiple signaling pathways control tuber induction in potato. Plant Physiol. 1999, 119, 1–8. [Google Scholar] [CrossRef] [Green Version]
  4. Fernie, A.; Willmitzer, L. Molecular and Biochemical Triggers Development of Potato Tuber. Plant Physiol. 2001, 127, 1459–1465. [Google Scholar] [CrossRef] [PubMed]
  5. Visser, R.G.F.; Vreugdenhil, D.; Hendricks, T.; Jacobsen, E. Gene expression and carbohydrate content during stolon to tuber transition in potatoes (Solanum tuberosum). Physiol. Plant. 1994, 90, 285–292. [Google Scholar] [CrossRef]
  6. Farre, E.M.; Geigenberger, P.; Willmitzer, L.; Trethewey, R.N. A possible role for pyrophosphate in the coordination of cytosolic and plastidial carbon metabolism within the potato tuber. Plant Physiol. 2000, 123, 681–688. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Maharishi Tomar, R.; Changan, S.S. Potato Vitamins 7. In Potato: Nutrition and Food Security; Springer Nature Singapore Pte Ltd.: Singapore, 2020; p. 113. [Google Scholar]
  8. Hendriks, T.; Vreugdenhil, D.; Stiekema, W.J. Patatin and four serine proteinase inhibitor genes are differentially expressed during potato tuber development. Plant Mol. Biol. 1991, 17, 385–394. [Google Scholar] [CrossRef] [PubMed]
  9. Shewry, P.R. Tuber storage proteins. Ann. Bot. 2003, 91, 755–769. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Wattimena, G.A. Micropropagation as an Alternative Technology for Potato Production in Indonesia. Ph.D. Thesis, University of Wisconsin-Madison, Madison, WI, USA, 1983; 202p. [Google Scholar]
  11. Abbott, A.J.; Belcher, A.R. Potato tuber formation in vitro. In Plant Tissue Culture and It’s Agricultural Application; Withers, L.A., Alderson, P.G., Eds.; Butterworths: London, UK, 1986; pp. 113–122. [Google Scholar]
  12. Lewis, C.E.; Walker, J.R.L.; Lancaster, J.E.; Conner, A.J. Light regulation of anthocyanin, flavonoid and phenolic acid biosynthesis in potato minitubers in vitro. Anst. J. Plant Physiol. 1998, 125, 915–922. [Google Scholar] [CrossRef]
  13. Mandolino, G.; de Marco, V.S.; Faeti, M.; Bagatta, A.; Carboni, P.; Ranalli, P. Stability of fingerprints of Solanum tuberosum plants derived from conventional tubers and vitrotubers. Plant Breed. 1996, 115, 439–444. [Google Scholar] [CrossRef]
  14. International Potato Center. CIP. 2018. Available online: https://cipotato.org/es/ (accessed on 15 March 2018).
  15. Baker, W.G. A method for the in vitro culturing of potato tuber. Science 1953, 118, 384. [Google Scholar] [CrossRef]
  16. Mes, M.G.; Menge, I. Potato shoot and tuber cultures in vitro. Physiol. Plant. 1954, 7, 637–649. [Google Scholar] [CrossRef]
  17. Donnelly, D.J.; Coleman, W.K.; Coleman, S.E. Potato microtuber production and performance: A review. Am. J. Potato Res. 2003, 80, 103–115. [Google Scholar] [CrossRef]
  18. Hannapel, D.J. Signalling the induction of tuber formation. In Potato Biology and Biotechnology: Advances and Perspectives; Vreug-denhil, D., Ed.; Elsevier: Amsterdam, The Netherlands, 2007; pp. 237–256. [Google Scholar]
  19. Vinterhalter, D.; Dragićević, I.; Vinterhalter, B. Potato in vitro culture techniques and biotechnology. In Fruit, Vegetable and Cereal Science and Biotechnology; Benkeblia, N., Tennant, P., Potato, I., Eds.; (Special Issue 1); Global Science Books; Kagawa University: Kagawa, Japan, 2008; Volume 2, pp. 16–45. [Google Scholar]
  20. Wakasa, Y.; Kasai, A.; Yamazaki, M.; Tabei, Y.; Tsuyama, M.; Igarashi, T.; Akada, S. Rapid analysis of GBSS1 and Vinv genes expressed in potato tubers using microtubers produced in liquid culture medium. Plant Cell Rep. 2020, 39, 1415–1424. [Google Scholar] [CrossRef] [PubMed]
  21. Khuri, S.; Moorby, J. Investigations into the role of sucrose in potato cv. Estima microtuber production in vitro. Ann. Bot. 1995, 75, 295–303. [Google Scholar] [CrossRef]
  22. Perl, A.; Aviv, D.; Willmitzer, L.; Galun, E. In vitro tuberization in transgenic potatoes harboring ß-glucoronidase linked to a patatin promoter: Effects of sucrose levels and photoperiods. Plant Sci. 1991, 73, 87–95. [Google Scholar] [CrossRef]
  23. Yu, W.C.; Joyce, P.J.; Cameron, D.C.; McCown, B.H. Sucrose utilization during potato microtuber growth in bioreactors. Plant Cell Rep. 2000, 19, 407–413. [Google Scholar] [CrossRef] [PubMed]
  24. Sauer, M.; Robert, S.; Kleine-Vehn, J. Auxin: Simply complicated. J. Exp. Bot. 2013, 64, 2565–2577. [Google Scholar] [CrossRef] [Green Version]
  25. El-Antably, H.M.M.; Wareing, P.F.; Hillman, J. Some physiological responses to DL-abscisin (dormin). Planta 1967, 73, 74–90. [Google Scholar] [CrossRef]
  26. Abdullah, Z.U.N.; Ahmad, R. Effect of ABA and GA3 on tuberization and some chemical constituents of potato. Plant Cell Physiol. 1980, 21, 1343–1346. [Google Scholar]
  27. Menzel, C.M. Tuberization in potato (Solanum tuberosum cultivar Sebago) at high temperatures: Responses to gibberellin and growth inhibitors. Anna Bot. 1980, 46, 259–266. [Google Scholar] [CrossRef]
  28. Suttle, J.C. Involvement of endogenous gibberellins in potato tuber dormancy and early sprout growth: A critical assessment. J. Plant Physiol. 2004, 161, 157–164. [Google Scholar] [CrossRef] [PubMed]
  29. Yamaguchi, S. Gibberellin metabolism and its regulation. Annu. Rev. Plant Biol. 2008, 59, 225–251. [Google Scholar] [CrossRef]
  30. Roumeliotis, E.; Kloosterman, B.; Oortwijn, M.; Kohlen, W.; Bouwmeester, H.J.; Visser, R.G.; Bachem, C.W. The effects of auxin and strigolactones on tuber initiation and stolon architecture in potato. J. Exp. Bot. 2012, 63, 4539–4547. [Google Scholar] [CrossRef]
  31. Xu, X.; Van Lammeren, A.M.M.; Vermeer, E.; Vreugdenhil, D. The role of gibberellin, absciscic acid, and sucrose in the regulation of potato tuber formation in vitro. Plant Physiol. 1998, 117, 575–584. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Melis, R.J.M.; van Staden, J. Tuberization and hormones. Z. Pflanz. Physiol. 1984, 11, 271–283. [Google Scholar] [CrossRef]
  33. Koda, Y.; Kikuta, Y.; Tazaki, H.; Tsujino, Y.; Sakamura, S.; Yoshihara, T. Potato tuber-inducing activities of jasmonic acid and related compounds. Phytochemistry 1991, 30, 1435–1438. [Google Scholar] [CrossRef]
  34. Pelacho, A.M.; Mingo-Castel, A.M. Jasmonic acid induces tuberization of potato stolons cultured in vitro. Plant Physiol. 1991, 97, 1253–1255. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Van den Berg, J.H.; Ewing, E.E. Jasmonates and their role in plant growth and development, with special reference to the control of potato tuberization: A review. Am. Potato J. 1991, 68, 781–794. [Google Scholar] [CrossRef]
  36. Koda, Y. Possible involvement of jasmonates in various morphogenic events. Physiol. Plant. 1997, 100, 639–646. [Google Scholar] [CrossRef]
  37. Barker, J.; Mapson, L.W. Studies in the respiratory and carbohydrate metabolism of plant tissues-Experimental studies of the formation of carbon dioxide and of the changes in lactic acid, sucrose and in certain fractions of keto-acids in potato tubers in air following anaerobic conditions. Proc. R. Soc. Lond. B. 1953, 141, 321–337. [Google Scholar]
  38. Palmer, C.E.; Smith, O.E. Cytokinins and tuber initiation in the potato Solanum tuberosum. Nature 1969, 221, 279–280. [Google Scholar] [CrossRef]
  39. Palmer, C.E.; Smith, O.E. Effect of kinetin on tuber formation on isolated stolons of Solanum tuberosum L. cultured in vitro. Plant Cell Physiol. 1970, 11, 303–314. [Google Scholar] [CrossRef]
  40. Van Staden, J.; Dimalla, G.G. Endogenous cytokinins and tuberization in the potato (Solanum tuberosum L.). Ann. Bot. 1976, 40, 1117–1119. [Google Scholar] [CrossRef]
  41. Sugiyama, T.; Hashizume, T. Cytokinins in developing tuberous roots of sweet potato. Agric. Biol. Chem. 1989, 53, 49–52. [Google Scholar]
  42. Frugier, F.; Kosuta, S.; Murray, J.D.; Crespi, M.; Szczyglowski, K. Cytokinin: Secret agent of symbiosis. Trends Plant Sci. 2008, 13, 115–120. [Google Scholar] [CrossRef]
  43. Miri, M.; Janakirama, P.; Held, M.; Ross, L.; Szczyglowski, K. Into the root: How cytokinin controls rhizobial infection. Trends Plant Sci. 2016, 21, 178–186. [Google Scholar] [CrossRef]
  44. Chen, H.; Rosin, F.M.; Prat, S.; Hannapel, D.J. Interacting transcription factors from the three-amino acid loop extension superclass regulate tuber formation. Plant Physiol. 2003, 132, 1391–1404. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Eviatar-Ribak, T.; Shalit-Kaneh, A.; Chappell-Maor, L.; Amsellem, Z.; Eshed, Y.; Lifschitz, E. A cytokinin-activating enzyme promotes tuber formation in tomato. Curr. Biol. 2013, 23, 1057–1064. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Zwack, P.J.; Rashotte, A.M. Interactions between cytokinin signalling and abiotic stress responses. J. Exp. Bot. 2015, 66, 4863–4871. [Google Scholar] [CrossRef] [Green Version]
  47. Brütting, C.; Schäfer, M.; Vanková, R.; Gase, K.; Baldwin, I.T.; Meldau, S. Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata. Plant J. 2017, 89, 15–30. [Google Scholar] [CrossRef] [Green Version]
  48. Thu, N.B.A.; Hoang, X.L.T.; Truc, M.T.; Sulieman, S.; Thao, N.P.; Tran, L.P. Cytokinin signaling in plant response to abiotic stresses. In Mechanism of Plant Hormone Signaling Under Stress; Pandey, G., Ed.; John Wiley and Sons, Inc.: New Delhi, India, 2017; Volume 1, pp. 71–100. [Google Scholar]
  49. Kolachevskaya, O.O.; Alekseeva, V.V.; Sergeeva, L.I.; Rukavtsova, E.B.; Getman, I.A.; Vreugdenhil, D.; Buryanov, Y.I.; Romanov, G.A. Expression of auxin synthesis gene tms1 under control of tuber-specific promoter enhances potato tuberization in vitro. J. Int. Plant Biol. 2015, 57, 734–744. [Google Scholar] [CrossRef] [PubMed]
  50. Kolachevskaya, O.O.; Sergeeva, L.I.; Floková, K.; Getman, I.A.; Lomin, S.N.; Alekseeva, V.V.; Rukavtsova, E.B.; Buryanov, Y.I.; Romanov, G.A. Auxin synthesis gene tms1 driven by tuber-specific promoter alters hormonal status of transgenic potato plants and their responses to exogenous phytohormones. Plant Cell Rep. 2017, 36, 419–435. [Google Scholar] [CrossRef]
  51. Wang, D.; Cheng, L.; Wang, Y.; Zhang, F. Comparative proteomic analysis of potato (Solanum tuberosum L.) tuberization in vitro regulated by IAA. Am. J. Potato Res. 2018, 18, 440–446. [Google Scholar] [CrossRef]
  52. Lomin, S.N.; Myakushina, Y.A.; Kolachevskaya, O.O.; Getman, I.A.; Arkhipov, D.V.; Savelieva, E.M.; Romanov, G.A. Cytokinin perception in potato: New features of canonical players. J. Exp. Bot. 2018, 69, 3839–3853. [Google Scholar] [CrossRef] [PubMed]
  53. Arkhipov, D.V.; Lomin, S.N.; Myakushina, Y.A.; Savelieva, E.M.; Osolodkin, D.I.; Romanov, G.A. Modeling of Protein–Protein Interactions in Cytokinin Signal Transduction. Int. J. Mol. Sci. 2019, 20, 2096. [Google Scholar] [CrossRef] [Green Version]
  54. Hwang, I.; Chen, H.C.; Sheen, J. Two-component signal transduction pathways in Arabidopsis. Plant Physiol. 2002, 129, 500–515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Kakimoto, T. Perception and signal transduction of cytokinins. Ann. Rev. Plant Biol. 2003, 54, 605–627. [Google Scholar] [CrossRef] [PubMed]
  56. Heyl, A.; Schmülling, T. Cytokinin signal perception and transduction. Curr. Opin. Plant Biol. 2003, 6, 480–488. [Google Scholar] [CrossRef]
  57. Mizuno, T. Plant response regulators implicated in signal transduction and circadian rhythm. Curr. Opin. Plant Biol. 2004, 7, 499–505. [Google Scholar] [CrossRef]
  58. Ferreira, F.J.; Kieber, J.J. Cytokinin signaling. Curr. Opin. Plant Biol. 2005, 8, 518–525. [Google Scholar] [CrossRef]
  59. Aloni, R.; Aloni, E.; Langhans, M.; Ullrich, C.I. Role of cytokinin and auxin in shaping root architecture: Regulating vascular differentiation, lateral root initiation, root apical dominance and root gravitropism. Ann. Bot. 2006, 97, 883–893. [Google Scholar] [CrossRef]
  60. Müller, B.; Sheen, J. Advances in cytokinin signaling. Science 2007, 318, 68–69. [Google Scholar] [CrossRef]
  61. Cheng, L.; Wang, D.; Wang, Y.; Xue, H.; Zhang, F. An integrative overview of physiological and proteomic changes of cytokinin-induced potato (Solanum tuberosum L.) tuber development in vitro. Physiol. Plant. 2020, 168, 675–693. [Google Scholar] [CrossRef]
  62. Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
  63. Sarkar, B.; Mondal, S.S.; Nayek, S.S.; Saha, M.; Biswas, S. Integrated nutrient management for the productivity and quality improvement of potato under irrigated condition. Potato J. 2007, 34, 1–2. [Google Scholar]
  64. Dutt, S.; Manjul, A.S.; Raigond, P.; Singh, B.; Siddappa, S.; Bhardwaj, V.; Kardile, H.B. Key players associated with tuberization in potato: Potential candidates for genetic engineering. CRC Crit. Rev. Biotechnol. 2017, 37, 942–957. [Google Scholar] [CrossRef]
  65. Hannapel, D.J.; Sharma, P.; Lin, T.; Banerjee, A.K. The multiple signals that control tuber formation. Plant Physiol. 2017, 174, 845–856. [Google Scholar] [CrossRef] [Green Version]
  66. Klimaszewska, K.; Cyr, D.R.; Sutton, B.C.S. Influence of gelling agents on culture medium gel strength, water availability, tissue water potential, and maturation response in embryogenic cultures of Pinus strobus L. In Vitro Cell. Dev. Biol. Anim. 2000, 36, 279–286. [Google Scholar] [CrossRef]
  67. Hadeler, B.; Scholz, S.; Reski, R. Gelrite and agar differently influence cytokinin-sensitivity of a moss. J. Plant Physiol. 1995, 146, 369–371. [Google Scholar] [CrossRef]
  68. Scherer, P.A.; Müller, E.; Lippert, H.; Wolff, G. Multielement analysis of agar and gelrite impurities investigated by inductively coupled plasma emission spectrometry as well as physical properties of tissue culture media prepared with agar or the gellan gum gelrite. Acta Hortic. 1988, 226, 655–658. [Google Scholar] [CrossRef]
  69. Tran, L.S.P.; Nishiyama, R.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Potential utilization of NAC transcription factors to enhance abiotic stress tolerance in plants by biotechnological approach. GM Crops 2010, 1, 32–39. [Google Scholar] [CrossRef] [PubMed]
  70. Hare, P.D.; Cress, W.A. Metabolic implications of stress-induced proline accumulation in plants. Plant Growth Regul. 1997, 21, 79–102. [Google Scholar] [CrossRef]
  71. Singh, K.K. The Saccharomyces cerevisiae Sln1p-Ssk1p two-component system mediates response to oxidative stress and in an oxidant-specific fashion. Free Radic. Biol. Med. 2000, 29, 1043–1050. [Google Scholar] [CrossRef]
  72. Bacete, L.; Hamann, T. The role of mechanoperception in plant cell wall integrity maintenance. Plants 2020, 9, 574. [Google Scholar] [CrossRef]
  73. Kiba, T.; Aoki, K.; Sakakibara, H.; Mizun, T. Arabidopsis response regulator, ARR22, ectopic expression of which results in phenotypes similar to the wol cytokinin-receptor mutant. Plant Cell Physiol. 2004, 45, 1063–1077. [Google Scholar] [CrossRef]
  74. Urao, T.A. Transmembrane Hybrid-Type in Arabidopsis Histidine Kinase Functions as an osmosensor. Plant Cell 1999, 11, 1743–1754. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  75. Tran, P.; Urao, T.; Qin, F.; Maruyama, K.; Kakimoto, T.; Shinozaki, K.; Shinozaki-Yamaguchi, K. Functional analysis of AHK1/ATHK1 and cytokinin receptor histidine kinases in response to abscisic acid, drought, and salt stress in Arabidopsis. Proc. Natl. Acad. Sci. USA 2007, 104, 20623–20628. [Google Scholar] [CrossRef] [Green Version]
  76. Nguyen, K.; Ha, C.; Nishiyama, A.; Watanabe, Y.; Leyva-Gonzalez, M.; Fujita, Y.; Tran, U.; Li, W.; Tanaka, M.; Seki, M.; et al. Arabidopsis cytokinin type B response regulators ARR1, ARR10, and ARR12 negatively regulate plant responses to drought. Proc. Natl. Acad. Sci. USA 2007, 113, 3090–3095. [Google Scholar] [CrossRef] [Green Version]
  77. Nishiyama, R.; Watanabe, Y.; Fujita, Y.; Le, D.T.; Kojima, M.; Werner, T.; Tran, L.S.P. Analysis of cytokinin mutants and regulation of cytokinin metabolic genes reveals important regulatory roles of cytokinins in drought, salt and abscisic acid responses, and abscisic acid biosynthesis. Plant Cell 2011, 23, 2169–2183. [Google Scholar] [CrossRef] [Green Version]
  78. Vahdati, K.; Bayat, S.; Ebrahimzadeh, H.; Jariteh, M.; Mirmasoumi, M. Effect of exogenous ABA on somatic embryo maturation and germination in Persian walnut (Juglans regia L.). Plant Cell Tiss. Org. 2008, 93, 163–171. [Google Scholar] [CrossRef]
  79. Wang, R.S.; Pandey, S.; Li, S.; Gookin, T.E.; Zhao, Z.; Albert, R.; Assmann, S.M. Common and unique elements of the ABA-regulated transcriptome of Arabidopsis guard cells. BMC Genom. 2011, 12, 1–24. [Google Scholar]
  80. Hwang, H.; Hong, J.W.; Lee, Y.N.; Ahn, I.P.; Yoon, I.S.; Kim, B.G. A rice orthologue of the ABA receptor, OsPYL/RCAR5, is a positive regulator of the ABA signal transduction pathway in seed germination and early seedling growth. J. Exp. Bot. 2012, 63, 1013–1024. [Google Scholar]
  81. Ochatt, S.J.; Revilla, M.A. From stress to embryos: Some of the problems for induction and maturation of somatic embryos. In In Vitro Embryogenesis in Higher Plants; Humana Press: New York, NY, USA, 2016; Volume 1, pp. 523–536. [Google Scholar]
  82. Bleecker, A.B.; Kende, H. Ethylene: A gaseous signal molecule in plants. Ann. Rev. Cell Dev. Biol. 2000, 16, 1–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  83. Wohlbach, D.J.; Quirino, B.F.; Sussman, M.R. Analysis of the Arabidopsis histidine kinase ATHK1 reveals a connection between vegetative osmotic stress sensing and seed maturation. Plant Cell 2008, 20, 1101–1117. [Google Scholar] [CrossRef] [Green Version]
  84. Kumar, M.N.; Jane, W.N.; Verslues, P.E. Role of the putative osmosensor Arabidopsis histidine kinase1 in dehydration avoidance and low-water-potential response. Plant Physiol. 2013, 161, 942–953. [Google Scholar] [CrossRef] [Green Version]
  85. Singh, M.; Kumar, J.; Singh, S.; Singh, V.P.; Prasad, S.M. Roles of osmoprotectants in improving salinity and drought tolerance in plants: A review. Rev. Environ. Sci. Biol./Technol. 2015, 14, 407–426. [Google Scholar] [CrossRef]
  86. Jeon, J.; Kim, J. Arabidopsis response Regulator1 and Arabidopsis histidine phosphotransfer Protein2 (AHP2), AHP3, and AHP5 function in cold signaling. Plant Physiol. 2013, 161, 408–424. [Google Scholar] [CrossRef] [Green Version]
  87. Jeon, J.; Cho, C.; Lee, M.R.; Van Binh, N.; Kim, J. CYTOKININ RESPONSE FACTOR2 (CRF2) and CRF3 regulate lateral root development in response to cold stress in Arabidopsis. Plant Cell 2016, 28, 1828–1843. [Google Scholar] [CrossRef] [Green Version]
  88. Cortleven, A.; Leuendorf, J.E.; Frank, M.; Pezzetta, D.; Bolt, S.; Schmülling, T. Cytokinin action in response to abiotic and biotic stresses in plants. Plant Cell Environ. 2019, 42, 998–1018. [Google Scholar] [CrossRef]
  89. Meng, W.J.; Cheng, Z.J.; Sang, Y.L.; Zhang, M.M.; Rong, X.F.; Wang, Z.W. Type-B ARABIDOPSIS RESPONSE REGULATORS specify the shoot stem cell niche by dual regulation of WUSCHEL. Plant Cell 2017, 29, 1357–1372. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  90. Hakman, I.; Hallberg, H.; Palovaara, J. The polar auxin transport inhibitor NPA impairs embryo morphology and increases the expression of an auxin efflux facilitator protein PIN during Picea abies somatic embryo development. Tree Physiol. 2009, 29, 483–496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  91. Su, Y.H.; Liu, Y.B.; Bai, B.; Zhang, X.S. Establishment of embryonic shoot-root axis is involved in auxin and cytokinin response during Arabidopsis somatic embryogenesis. Front. Plant Sci. 2015, 5, 792–801. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  92. Rosin, F.M.; Hart, J.K.; Horner, H.T.; Davies, P.J.; Hannapel, D.J. Overexpression of a knotted-like homeobox gene of potato alters vegetative development by decreasing gibberellin accumulation. Plant Physiol. 2003, 132, 106–117. [Google Scholar] [CrossRef] [Green Version]
  93. Nagasaki, H.; Sakamoto, T.; Sato, Y.; Matsuoka, M. Functional analysis of the conserved domains of a rice KNOX homeodomain protein, OSH15. Plant Cell 2001, 13, 2085–2098. [Google Scholar] [CrossRef] [Green Version]
  94. Bellaoui, M.; Pidkowich, M.S.; Samach, A.; Kushalappa, K.; Kohalmi, S.E.; Modrusan, Z.; Crosby, W.L.; Haughn, T.G.W. The Arabidopsis BELL1 and KNOX TALE homeodomain proteins interact through a domain conserved between plants and animals. Plant Cell 2001, 13, 2455–2470. [Google Scholar] [CrossRef] [Green Version]
  95. Chatterjee, M.; Banerjee, A.K.; Hannapel, D.J.A. BELL1-like gene of potato is light activated and wound inducible. Plant Physiol. 2007, 145, 1435–1443. [Google Scholar] [CrossRef] [Green Version]
  96. Scofield, S.; Dewitte, W.; Murray, J.A.H. STM sustains stem cell function in the Arabidopsis shoot apical meristem and controls KNOX gene expression independently of the transcriptional repressor AS1. Plant Sign. Behav. 2014, 9, e28934-1. [Google Scholar] [CrossRef] [Green Version]
  97. Endrizzi, K.; Moussian, B.; Haecker, A.; Levin, J.Z.; Laux, T. The SHOOT MERISTEMLESS gene is required for maintenance of undifferentiated cells in Arabidopsis shoot and floral meristems and acts at a different regulatory level than the meristem genes WUSCHEL and ZWILLE. Plant J. 1996, 10, 967–979. [Google Scholar] [CrossRef]
  98. Lenhard, M.; Jürgens, G.; Laux, T. The WUSCHEL and SHOOTMERISTEMLESS genes fulfil complementary roles in Arabidopsis shoot meristem regulation. Development 2002, 129, 3195–3206. [Google Scholar] [CrossRef]
  99. Berleth, T.; Jürgens, G. The role of the gene in monopteros Organizing the basal body region of the Arabidopsis embryo. Development 1993, 118, 575–587. [Google Scholar] [CrossRef]
  100. Przemeck, G.; Mattsson, J.; Hardtke, C.S. Studies on the role of the Arabidopsis gene monopteros in vascular development and plant cell axialization. Planta 1996, 200, 229–237. [Google Scholar] [CrossRef] [PubMed]
  101. Kirstein-Miles, J.; Scior, A.; Deuerling, E.; Morimot, R.I. The nascent polypeptide-associated complex is a key regulator of Proteostasis. EMBO J. 2013, 32, 1451–1468. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  102. Yamada, H.; Suzuki, T.; Terada, K.; Takei, K.; Ishikawa, K.; Miwa, K.; Mizuno, T. The Arabidopsis Histidine Kinase AHK4 is a Cytokinin-Binding Receptor Signals That transduces Cytokinin Across the Membrane. Plant Cell Physiol. 2001, 42, 1017–1023. [Google Scholar] [CrossRef] [PubMed]
  103. Lazar, G.; Zhang, H.; Goodman, H.M. The origin of the bifunctional dihydrofolate reductase-thymidylate synthase isogenes of Arabidopsis thaliana. Plant J. 1993, 3, 657–668. [Google Scholar] [CrossRef] [PubMed]
  104. Sharma, S.; Mustafiz, A.; Singla-Pareek, S.; Shankar Srivastava, P.; Sopory, S. Characterization of inducible stress and methylglyoxal triose phosphate isomerase (OscTPI) from rice. Plant Signal. Behav. 2012, 7, 1337–1345. [Google Scholar] [CrossRef] [Green Version]
  105. Yan, S.; Tang, Z.; Su, W.; Sun, W. Proteomic analysis of salt stress-responsive proteins in rice root. Proteomics 2005, 5, 235–244. [Google Scholar] [CrossRef]
  106. Riccardi, F.; Gazeau, P.; de Vienne, D.; Zivy, M. Protein Changes in Response to Water Deficit in Maize Progressive. Plant Physiol. 1998, 117, 1253–1263. [Google Scholar] [CrossRef] [Green Version]
  107. Salekdeh, G.; Siopongco, J.; Wade, L.; Ghareyazie, B.; Bennett, J. Proteomic analysis of rice drought stress and leaves During recovery. Proteomics 2002, 2, 1131–1145. [Google Scholar] [CrossRef]
  108. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression usingreal-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  109. Bustin, S.A.; Beaulieu, J.F.; Huggett, J.; Jaggi, R.; Kibenge, F.S.; Olsvik, P.A.; Penning, L.C.; Toegel, S. MIQE precis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR exp. BMC Mol. Biol. 2010, 11, 74–80. [Google Scholar] [CrossRef] [Green Version]
  110. Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Jensen, L.J. STRINGv11: Protein-protein association networks with increased coverage supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019, 47, D607–D613. [Google Scholar] [CrossRef] [Green Version]
  111. Bombarely, A.; Menda, N.; Tecle, I.Y.; Buels, R.M.; Strickler, S.; Fischer-York, T.; Pujar, A.; Leto, J.; Gosselin, J.; Mueller, L.A. The Sol Genomics Network (solgenomics.net): Growing tomatoes using Perl. Nucleic Acids Res. 2010, 39, D1149–D1155. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  112. UniProt Consortium. UniProt: A hub for protein information. Nucleic Acids Res. 2014, 43, D204–D212. [Google Scholar]
  113. Sherry, S.T.; Ward, M.H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E.M.; Sirotkin, K. dbSNP: The NCBI database of genetic variation. Nucleic Acids Res. 2011, 29, 308–311. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Figure 1. (A). Microtuber development of potato S. tuberosum cv. Alpha in medium with 8% sucrose, 6 g/L gelrite and activated charcoal after four weeks of incubation in darkness. (B). Shoot explants of potato in medium with low content of sucrose (1%), gelrite 3 g/L and activated charcoal after four weeks of incubation in darkness. Bar represents 1 cm.
Figure 1. (A). Microtuber development of potato S. tuberosum cv. Alpha in medium with 8% sucrose, 6 g/L gelrite and activated charcoal after four weeks of incubation in darkness. (B). Shoot explants of potato in medium with low content of sucrose (1%), gelrite 3 g/L and activated charcoal after four weeks of incubation in darkness. Bar represents 1 cm.
Plants 10 00876 g001
Figure 2. Gene network derived from STRING database of potato S. tuberosum (0.500 confidence) analyzed using qPCR. Homologous sequences of A. thaliana are written in rows. Numbers in the bubble indicate the gene identifier of each gene derived from the potato genome. The figure represents a full network, the edges indicate both functional and physical protein associations.
Figure 2. Gene network derived from STRING database of potato S. tuberosum (0.500 confidence) analyzed using qPCR. Homologous sequences of A. thaliana are written in rows. Numbers in the bubble indicate the gene identifier of each gene derived from the potato genome. The figure represents a full network, the edges indicate both functional and physical protein associations.
Plants 10 00876 g002
Figure 3. Gene expression analysis by qPCR during microtuber induction in osmotic stress medium (MR8-G6-2iP) after 8, 15, 23 and 31 dayss of incubation in darkness. Control medium was non-osmotic medium (MR1-G3-2iP). Relative expression levels plotted based on Log2. Normalized with EF1 α (elongation factor 1 α) and SEC3 (exocyst complex component 3).
Figure 3. Gene expression analysis by qPCR during microtuber induction in osmotic stress medium (MR8-G6-2iP) after 8, 15, 23 and 31 dayss of incubation in darkness. Control medium was non-osmotic medium (MR1-G3-2iP). Relative expression levels plotted based on Log2. Normalized with EF1 α (elongation factor 1 α) and SEC3 (exocyst complex component 3).
Plants 10 00876 g003
Figure 4. A model of microtuberization regulatory network in two conditions; osmotic stress (MR8-G6-2iP) and non-osmotic stress (MR1-G3-2iP).
Figure 4. A model of microtuberization regulatory network in two conditions; osmotic stress (MR8-G6-2iP) and non-osmotic stress (MR1-G3-2iP).
Plants 10 00876 g004
Table 1. Primer design of genes that were analyzed during microtuber induction of potato S. tuberosum cv. Alpha.
Table 1. Primer design of genes that were analyzed during microtuber induction of potato S. tuberosum cv. Alpha.
Gen IDSequencesTm (°C)%GCAmpliconID NCBI
StHK1L: TCGGAAAGCTCTGAATTCGT
R: ATTCCATCCTTGACGAGACG
64.4
64.3
45%
50%
169 pbXM_006340693.2
StHK3L: GTTCATGCAGGTTGGTCCTT
R: TCATGCCATGGAAATCTGAA
64.5
64.5
50%
40%
242 pbXM_006352114.2
StRR1L: TGTTGGGTCAGTGGTGAAAA
R: CTCCGCTCGATTAGACTTGG
64.2
64
45%
55%
199 pbXM_006345914.1
StHP4L: AAACGCCAAGCTGCTTACAT
R: TAGGGTCCATTTTCCAATGC
64
63.9
45%
45%
188 pbXM_015315420.1
StWUSL: TTTCACATGGGTTGGTGTTG
R: CTTCATGCATGGGGAAAAGT
64.2
64.8
45%
45%
180 pbXM_006340669.2
StBEL5L: AACGCGAAAAAGCAAAGAAA
R: GAAAATTCGCGGTCATTTGT
63.9
64
55%
55%
187 pbNM_001287992.1
POTH15L: CTCGTCTCTTGGCTGCTTATC
R: CTACTACTGTTACGGCCCATTG
62.6
64.3
52%
50%
115 pbXM_006348098.2
POTH1L: AGAGACGATTACGCGGATAAAG
R: GTCAAGATGGACGAGTTGGTATAG
63.5
62.9
45%
45%
101 pbNM_001288425.1
NAC5L: GAGCAGGAGCGAGAAGAAGA
R: TCCTCAATCTTTGCCTCACC
64.3
64.5
55%
50%
183 pbXM_006340649.2
TIML: GCCTGTTTGGGCTATTGGTA
R: TCAGCAGCCTTGATGATGATGTC
64
64
50%
50%
249 pbCP055237.1
TPIL: CGGTGAACCAAACACATTGA
R: GAGAAGCTAAAGAAGTTGCCATT
64.9
62
45%
39%
153 pbNM_001318582.1
MPL: TGGAAAGATGGGTTCTTTGG
R: CCTGCATTCCCTTCAACAAT
64.1
64.2
45%
45%
157 pbXM_006341964.2
SEC3L: GATCTGCGGAAGGTGGTAAA
R: CAGCAACTCCTCTGAGGTTAAG
62.3
64.3
57%
58%
102 pbXM_006342542.2
Ef1-alphaL: GCACTGGAGCATATCCGTTT
R: TTTGGCCCTACTGGTTTGAC
64.2
64.1
58%
58%
244 pbNM_001288491.1
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Herrera-Isidron, L.; Valencia-Lozano, E.; Rosiles-Loeza, P.Y.; Robles-Hernández, M.G.; Napsuciale-Heredia, A.; Cabrera-Ponce, J.L. Gene Expression Analysis of Microtubers of Potato Solanum tuberosum L. Induced in Cytokinin Containing Medium and Osmotic Stress. Plants 2021, 10, 876. https://doi.org/10.3390/plants10050876

AMA Style

Herrera-Isidron L, Valencia-Lozano E, Rosiles-Loeza PY, Robles-Hernández MG, Napsuciale-Heredia A, Cabrera-Ponce JL. Gene Expression Analysis of Microtubers of Potato Solanum tuberosum L. Induced in Cytokinin Containing Medium and Osmotic Stress. Plants. 2021; 10(5):876. https://doi.org/10.3390/plants10050876

Chicago/Turabian Style

Herrera-Isidron, Lisset, Eliana Valencia-Lozano, Pablo Yamild Rosiles-Loeza, Maria Guadalupe Robles-Hernández, Abigail Napsuciale-Heredia, and Jose Luis Cabrera-Ponce. 2021. "Gene Expression Analysis of Microtubers of Potato Solanum tuberosum L. Induced in Cytokinin Containing Medium and Osmotic Stress" Plants 10, no. 5: 876. https://doi.org/10.3390/plants10050876

APA Style

Herrera-Isidron, L., Valencia-Lozano, E., Rosiles-Loeza, P. Y., Robles-Hernández, M. G., Napsuciale-Heredia, A., & Cabrera-Ponce, J. L. (2021). Gene Expression Analysis of Microtubers of Potato Solanum tuberosum L. Induced in Cytokinin Containing Medium and Osmotic Stress. Plants, 10(5), 876. https://doi.org/10.3390/plants10050876

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop