Next Article in Journal
SPAD Leaf Greenness Index: Green Mass Yield Indicator of Maize (Zea mays L.), Genetic and Agriculture Practice Relationship
Next Article in Special Issue
Mycelium Dispersion from Fusarium oxysporum f. sp. dianthi Elicits a Reduction of Wilt Severity and Influences Phenolic Profiles of Carnation (Dianthus caryophyllus L.) Roots
Previous Article in Journal
Extracts of Poplar Buds (Populus balsamifera L., Populus nigra L.) and Lithuanian Propolis: Comparison of Their Composition and Biological Activities
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 10
Issue 5
10.3390/plants10050829
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Evaluation of Insecticidal Effects of Plants Essential Oils Extracted from Basil, Black Seeds and Lavender against Sitophilus oryzae

by
Nadi Awad Al-Harbi
1,
Nagy M. Al Attar
2,
Dalia M. Hikal
3,
Salwa E. Mohamed
4,
Arafat Abdel Hamed Abdel Latef
5,*,
Amira A. Ibrahim
6 and
Mohamed A. Abdein
7,*
1
Biology Department, University College of Tayma, University of Tabuk, Tabuk 71411, Saudi Arabia
2
Zoology Department, Faculty of Science, Al Azhar University, Cairo 11884, Egypt
3
Nutrition and Food Science, Home Economics Department, Faculty of Specific Education, Mansoura University, Mansoura 35516, Egypt
4
Department of Molecular Biology, Genetic Engineering and Biotechnology Research Institute (GEBRI), University of Sadat City, Sadat City 32897, Egypt
5
Biology Department, Turabah University College, Turabah Branch, Taif University, P.O. Box 11099, Taif 21944, Saudi Arabia
6
Plant Protection and Biomolecular Diagnosis Department, Arid Lands Cultivation Research Institute, City of Scientific Research and Technological Applications, New Borg El-Arab, Alexandria 21934, Egypt
7
Biology Department, Faculty of Arts and Science, Northern Border University, Rafha 91911, Saudi Arabia
*
Authors to whom correspondence should be addressed.
Plants 2021, 10(5), 829; https://doi.org/10.3390/plants10050829
Submission received: 23 February 2021 / Revised: 16 April 2021 / Accepted: 18 April 2021 / Published: 21 April 2021
(This article belongs to the Special Issue Plant Metabolites in Biotic Interactions)
Browse Figures
Versions Notes

Abstract

:
The risk of using synthetic insecticides to the environment, human health, and the emergence of new genera of pests resistant to that kind of drugs, have led to attention in natural compounds. The present study aimed at evaluating the insecticidal activity of 0.25–6 mg/cm2 of basil (Ocimum basilicum), black seeds (Nigella sativa), and lavender (Lavandula angustifolia) essential oils (EOs) against one of the major stored product pests, Sitophilus oryzae (L.). This was done by assessing mortality and repellent percentage assay in the adult stage, as well as analysing up and down-regulated genes associated with toxicity effect of selected EOs. The three studied EOs showed a toxic effect on S. oryzae; where O. basilicum and L. angustifolia EOs explicated 100% mortality at 6 mg/cm2 after 48 and 24 h, respectively. The highest repellence activity was recorded for O. basilicum EO at 0.75 mg/cm2 with value 82.3% after exposure time 5 h. In the highest dose (6 mg/cm2), the maximum up-regulated expression level of detoxification DEGs genes (CL1294 and CL 8) and cytochrome p45o gene (CYP4Q4) in Lavandula angustifolia EOs exhibited 8.32, 6.08, and 3.75 fold changes, respectively, as compared with 4.76 fold at 10 ppm malathion and 1.02 fold change in acetone control.

1. Introduction

In 2019, the latest forecast cereal production recorded an increase of 1.2% from 2018, to about 2.685 million tons, according to FAO [1]. Rice is one of the most important crops for almost all of the world especially developing countries [2]. Rice is considered a principal diet for more than two billion people because it has minerals, vitamins, fibers, and carbohydrates [3]. According to storage conditions, rice grains could be attacked by different insects and pests such as Sitophillus oryzoe L., which can be affected in quantity and nutritional quality [4].
In developing countries, loss of cereal foods is considered the major problem due to pest infections through storage [5,6,7]. Many insects, mites, and fungi attack stored cereals and led to a decrease its quality in addition to losses from 9 to 20% [8]. To overcome product losses by pests, synthetic pesticides were been used since 1960 [9]. Using these synthetic pesticides is a critical crisis especially in increasing insect resistance and the harmful impact on humans and the environment [10,11,12]. Additionally, insecticides have a dangerous impact on the malformation of food grains because of residues and harmfulness of synthetic chemicals to non-target organisms in surroundings. Besides, the use of these insecticides resulted in chromosomal aberration and genetic mutation in both plant and human [13,14,15]. As a result of this damage to the environment, researchers have recently thought about considered using safe alternatives for example plant extracts and plant essential oils [16].
Plant essential oils recently have been used as a biological control for insects and pests through their usages as anti-fungal, anti-microbial, and in allelopathic potentialities (herbicide uses) [11,17]. The importance of essential oils as insecticides and pesticides due to their valuable characteristics [18,19,20,21] less persistence of essential oils in air and environment due to their high volatility and degradation sensitivity to temperature and UV and sunlight [22]. Regarding their important characteristics, essential oils considered safer and more eco-friendly than synthetic pesticides and insecticides; additionally, essential oils are with a lower toxicity for mammalians [23]. Volatile plant essential oils have a mixture of 20–60 constituents which gave their characteristic odor and flavor [24]. A lot of essential oils have a toxicity effect against different types of stored food insects and pests [25]. Plant essential oils contain monoterpenoid compounds that toxic for insects through destroying the nervous system [26].
Basil (Ocimum basilicum) essential oil was used as a disinfectant against Ephestia kuehniella, Tribolium castaneum, and rice weevil (Sitophilus oryzae) [27], also basil oil had insecticidal properties and antifungal activity [28]. Black seeds (Nigella sativa) essential oil had a fumigant effect and repellence activity against Tribolium castaneum larva and adults, even with low concentrations [29]. Lavender (Lavandula angustifolia) essential oil chemical constituents had a wide range of toxicity against fungi, bacteria, insects, and pests [30]. [31] showed the repellence activity of L. angustifolia essential oil to Sitophilus oryzae L., Rhizopertha dominica F., and Tribolium castaneum Herbst. Different chemical compounds in Lavandula essential oil gave different efficiency and bioactivity control for pests and insects [32].
In recent years, there are a variety of detoxification enzymes encoded in insect genomes, including glutathione S-transferase (GST), cytochrome oxidase P450 (CYP), and carboxylesterase (CarE, also known as CCE/EST/CES) [33,34] that have potential activities in xenobiotic compounds detoxification. Furthermore, transcriptional regulation of gene expression of GST, CarE, and AchE enzymes in insects after insecticide application has been utilized for understanding the insect response and insecticidal mechanism to various xenobiotic compounds stresses [35,36]. However, molecular mechanisms remain unclear for the insecticidal activities of the essential oils from Ocimum basilicum, Nigella sativa, and Lavandula angustifolia medicinal plants against the stored product insect pest Sitophilus oryzae (L.). According to the economic importance of rice and its loss in quantity and quality by S. oryzae, the objective aim of this study was: (1) to assess the fumigant and insecticidal activity of three botanical essential oils from basil, black seeds, and lavender against Sitophilus oryzae adult stage; (2) screening chemical composition of the studied essential oils using GC-MS; and, finally (3) estimation significant roles of the three crucial detoxification enzymes related genes (Cl8, CYP 4Q4, and CL1294) in the response of Sitophilus oryzae insect to Ocimum basilicum, Nigella sativa, and Lavandula angustifolia essential oils.

2. Materials and Methods

2.1. Insect, Collection, Rearing and Treatment

Briefly, the insect strain utilized in this study (Sitophilus oryzae) was collected originally from a rice store bin in Beheira Governorate, Egypt. It has been reared at 28 °C on 95% corn seeds and 5% brewer′s yeast, 65% RH. Insects were sub-cultured from the laboratory colony, and specific life stages were removed. Mixed-sex adults were collected at 3–7 days post eclosion.

2.2. Isolation of Essential Oils

In this study, three herbal and medicinal plant species; basil flowers (Ocimum basilicum), seeds of black seeds (Nigella sativa), and lavender flowers (Lavandula angustifolia), were selected according to their ethnomedicinal importance and literature survey and were collected from Botanical Gardens and Ornamental Plants Department, Horticulture Research Institute (HRI) Institute, Agricultural Research Center, Egypt, and the botanical identification was conducted by Prof. Ibrahim Mashaly, Professor of Flora and plant Ecology at Department of Botany, Faculty of Science, Mansoura University, Egypt in July 2019. Plants were shadow dried at room temperature and 50 g were packed and stored at −4 °C. Oils were extracted through steam-distillation utilizing a Clevenger-type apparatus [37]. After a distillation time of 8 h, 50 g of each plant of the dried material yielded nearly 2 mL oil. The distillation was repeated to obtain the required oil quantity for research purposes.

2.3. Preliminary Phytochemical Analysis of EOs

Phytochemical characteristics of the essential oils isolated from the selected basil flowers, black seeds, and lavender leaves were illustrated using the following tests:

2.3.1. Screening for Carbohydrate Test

First, 1 mL of EOs of selected plants was added to 1 mL of Benedict’s reagent, and the mixture was then heated for 2 min in a boiling water bath. A green solution indicated the presence of reducing sugar.

2.3.2. Screening for Glycosides (Keller Kilianin Test)

Then, 5 mL of isolated essential oils were added with 2 mL of glacial acetic acid, few drops of ferric chloride solution and 1 mL of concentrated sulfuric acid, leading to brown ring formation at the interface, indicating the presence of glycosides.

2.3.3. Screening for Terpenoids (Salkowski Test)

Then, 5 mL of isolated essential oils were taken from the plants, and 2 mL of chloroform and 3 mL of concentrated sulfuric acid were then added. If a reddish-brown layer formed at the junction of the two solutions, the presence of terpenoids was indicated.

2.3.4. Screening for Steroids

Then, 1 mL of extracted essential oils was dissolved in 10 mL chloroform, followed by the addition of an equal volume of sulfuric acid. Red color appeared in the upper and yellow color with green fluorescence developed in the sulfuric acid layer, revealing the presence of steroids.

2.3.5. Screening for Tannins

Then, 2 mL of essential oils extracted from three selected plants were added to a few drops of 1% lead acetate. A yellowish precipitate was developed as a result of tannins presence in the solution.

2.4. Bioassay

2.4.1. Insect Mortality

To determine the mortality effect of the studied EOs against Sitophilus oryzae against Sitophilus oryzae, contact effect was evaluated on filter paper discs through treatment of a Whatman No.1, 8 cm diameter, area = 54.4 cm2). The filter paper discs were treated with 0.5 mL of acetonic solutions of EOs, and in the control treatment, the filter paper disc was treated with an equal volume of acetone. The four replicates for each treatment from different EOs solutions were tested corresponding to their doses (2, 4, and 6 mg/cm2) compared with positive control treatment and 10 ppm of the chemical standard malathion. Treated and control filter paper halves were air-dried for 1 h for solvent evaporation. Then, 10 unsexed adult beetles (3–7 days old) were released in the filter paper center, and the lid was then sealed with Parafilm. The experiment was run in the dark at 28 ± 2 °C and 65 ± 5% RH. The dead insects were counted at 3, 6, 12, 24, and 48 h post-application. Insects without response to the gentle touch of a small probe were considered dead [38] and data were corrected using Abbott’s formula [39].

2.4.2. Insect Repellence (Filter Paper Disc Bioassay)

A bioassay system was used to evaluate the activity of the three studied EOs using the area preference method [40]. A filter paper disk (Whatman No. 1, 8 cm diameter, area = 54.4 cm2) was divided into 2 halves, one of which was then treated with 0.5 mL of acetonic solutions of EOs, and the control half was treated with an equal volume of acetone. The four replicates from EOs acetone solutions were tested corresponding to the doses of 0.25, 0.5, and 0.75 mg/cm2 compared with the positive control treatment (malathion, 4 ppm) as chemical control. The treated and control filter paper half were air-dried for about 60 min, allowing solvent evaporation. After that, the paper disc was joined and fixed on the bottom of a Petri dish, and 10 3–7 days old, unsexed adults were then released in the center of both halves. The experiment was maintained at 28 ± 2 °C and 65 ± 5% RH in a dark place. Repellency percentage was recorded at 1, 2, 3, 4, and 5 h depending on the number of insects noticed on both treated and untreated halves. Percentage repellency was calculated by the following equation:
Repellence   ( % ) =   N c − N t / N c + N t   ×   100 ,
where Nc = the number of insects on the untreated half, and Nt = the number of insects on the treated half, after the time exposure.

2.5. Chemical Composition of EOs by GC-MS

For determination of the chemical composition of basil, black seeds, and lavender EOs, gas chromatography-mass spectrometry (GC-MS) analysis was conducted using GC-2010 Shimadzu capillary gas chromatography directly coupled to the mass spectrometer system (GC-MS–model QP 2010; (Shimadzu, Kyoto, Japan) DB-c18 column under following conditions: Injector temperature is 250 °C. Oven temperature program: initial temperature 30 °C for 2.0 min, ramp 2.0 °C/min to 250 °C, hold for 5.0 min. MS source temperature is 200 °C, electron energy is 70 eV; the carrier gas was helium at a flow rate 1.4 mL/min; 1 µL of each diluted sample in n-hexane (1:1, v/v) was injected. EI spectra were scanned from 43.00 to 600 m/z Identification of peaks through NIST mass data search libraries and the highest REV and for similarity indicators hits. The components of the sample were identified based on a comparison of their relative indices and mass spectra by computer matching with WILEY and National Institute of Standards and Technology (NIST08) libraries provided with the computer controlling GC-MS system [41].

2.6. Phytochemical Analysis of Three Selected EOs Antioxidant and Free Radical Scavenging Capacity

2.6.1. Estimation of Total Phenolic Content (TPC)

Total phenolic content in three studied essential oils was determined using the Folin Ciocalteu (FC) method of Su [38] method with slight modifications as prepared at a concentration of 1 mg/mL. A calibration curve was prepared using gallic acid (1–0.05 mg/mL). Then, 1 mL of O. basilicum, N. sativa, and L. angustifolia EOs or gallic acid was added to 0.5 mL of FC reagent and was vortexed well, followed by standing at room temperature for 5 min. Then, 1 mL, 7.5% w/v, of sodium carbonate, was added and maintained for 1 h at room temperature. The absorbance was measured at a wavelength of 760 nm. TPC was expressed as mg gallic acid equivalents (GAE)/g sample.

2.6.2. Estimation of Total Flavonoid Content (TFC)

Total flavonoid content in three studied EOs was determined by the colorimetric method [42]. About 300 μL of three studied EOs were mixed with 30 μL of 16% NaNO2. The mixture was then maintained at room temperature for 1 h, and 200 μL of NaOH solution (1 M) was added, followed by 60 μL of 10% AlCl3, and 700 μL H2O was then added to the mixture. The volume of the mixture was completed up to 1 mL with distilled water. The absorbance of the mixture was measured at 510 nm. The results were expressed as mg of rutin equivalent per gram of fresh weight (mg RE/g FW).

2.6.3. Antioxidant Activity by Free Radical Scavenging Capacity (DPPH)

To assay the free radical scavenging capacity of the investigated EOs on the stable free radical 1, 1-Diphenyl-2-picrylhydrazyl (DPPH) was determined according to [42]. Typically, 100 μL of DPPH (0.004% prepared in methanol) were mixed with 0.1 mL of tested EOs or vitamin C (reference). The plate was mixed by shaking, wrapped with aluminum foil, and then maintained for 30–60 min at 25 °C in a dark place. colors ranged from deep violet to light yellow, and the decrease in absorbance was measured at 517 nm. The DPPH was calculated from the following equation:
DPPH   scavenged   ( % ) = A C − A E A C   ×   100 ,
where AC: The mean of absorbance of the negative control; AE: The mean of absorbance of extract sample or standard.

2.7. Molecular Response of Insect to Botanical Pesticides

The molecular mechanism of botanical EOs pesticides and their mode of action was evaluated by studying the transcriptional expression levels for proteasome subunit alpha type-5 (CL8), arylalkylamine N-acetyltransferase (CL1294), and cytochrome (CYP 4Q4) gene in S. oryzae adult to the applied essential oils using the quantitative real-time polymerase chain reaction (qRT-PCR) analysis.

2.7.1. Total RNA Isolation from Sitophilus oryzae

The three replicates from S. oryzae adult samples (2–7 days) (without treatment as control and other treated with three selected EOs) after 1 and 2 h exposure time of treatment were used for total RNA extraction using about 0.1 g from each replicate through using Tripure total RNA extraction reagent, according to the manufacturer’s instructions. RNA concentration and purity were recorded by using NanoDrop™ 2000 (A260/A280).

2.7.2. cDNA Synthesis and Real-Time PCR

Reverse transcription reactions (RT-PCR) for the total RNA were performed. The volume of reaction was 20 μL contained 2.5 μL from oligo primer (10 pmL/μL), 2.5 μL
RNA (2 μg), 2.5 μL 5X buffer, 2.5 μL MgCl2, 2.5 μL dNTPs (2.5 mM), and 0.2 μL reverse transcriptase (MLV, Fermentas, USA) (5 Unit/μL). RT-PCR amplification was performed in a thermal cycler (Promega, Germany), programmed at 42 °C for 1 h and the enzyme was killed at 72 °C for 10 min. The cDNA was then stored for further studies at −20 °C [43].

2.7.3. Quantitative Real-Time –PCR (qRT-PCR)

qRT-PCR analysis was performed for three insecticidal detoxification genes (CL8, CL1294, and CYP4Q4) in S. oryzae adults treated with three selected EOs using SYBR Green Master Mix method utilizing a Rotor-Gene 6000 real-time PCR detection system (Qiagen, Germany). The primer sequences used in qRT- PCR mentioned in Table 1 were designed corresponding to the CL8, CL1294, and CYP4Q4 genes. β-Actin gene was used as an internal control gene. For each gene three replicates were used for qRT-PCR reaction; reaction volume of 25 μL contained 12.5 μL of 1×SYBR GREEN PCR mix (TaKaRa Code: RR041A), 1 μL 1:10 diluted cDNA templates, 1 μL sets of each primer and 9.5 μL Rnase free double distilled water according to the manufacturer’s protocol. RT-qPCR was amplified in 3-step and 45 cycles at 95 °C for 15 s, and 60 °C for 30 s and 70 °C for 30 s. Data of qRT-PCR were collected as CT (PCR cycle number where fluorescence is detected above the threshold). The CT of each sample was used to calculate ΔCT values (target gene CT subtracted from 18sRNA gene CT). The relative gene expression of studied genes was determined using the 2−ΔΔCt method [44,45]. Data from PCR runs were analyzed in the MyiQ optical system software version 1.0 (Bio Rad Laboratories Inc., Hercules, CA, USA). The expression quantity of expressed genes was calculated according to the Sigma Plot version 9.0 software (Systat Software Inc.: San Jose, CA, USA).

2.8. Statistical Analysis

The results are presented as means ± standard deviation (±SD). Data were analyzed using the statistical package for social sciences (SPSS) 16 and were evaluated by analysis of variance (ANOVA). Duncan’s test was used for comparisons among different treatments. Statistical differences were considered significant at the p < 0.05 level 3.

3. Results

3.1. Preliminary Phytochemical Screening Analysis of EOs

According to preliminary phytochemical screening results of O. basilicum, N. sativa and L. angustifolia EOs, Table 2 shows the presence of phytochemical constituents in the selected botanical EOs with antioxidant activities such as glycosides in O. basilicum, N. sativa extracts, steroids, terpenoids, tannins and sterols compounds in O. basilicum, N. sativa and L. angustifolia EOs.

3.2. GC-MS Analysis of Essential Oils

In this study, qualitative analyses of basil, black seeds, and lavender EOs by using GC-MS showed the presence of many bioactive gradients, which may have a role in insecticidal effects. The peak area (%) and the retention time of the chemical compounds in the analyzed oils were enumerated in its chromatogram.

3.2.1. Analysis of O. basilicum (basil) EOs

Chemical analysis performed by GC-MS analysis of O. basilicum EOs was demonstrated in Scheme 1 that is characterized by the presence of many biologically important compounds listed in Table 3 such as linalool Eugenol, (1S)-camphor, Octamethylcyclotetrasiloxane and linalyl acetate compounds that are referenced with insecticide properties constituents.

3.2.2. Analysis of N. sativa (Black Seeds) EOs

Chemical analysis performed by GC-MS analysis of N. sativa EOs was illustrated in Scheme 2, which is characterized by the presence of many biologically important compounds listed in Table 4 such as α-Thujene, p-cymene, Palmitic acid, Linoleic acid, Erucic acid, and Trielaidin compounds that referenced with insecticide properties constituents.

3.2.3. Analysis of L. angustifolia (Lavender) EOs

Chemical analysis performed by GC-MS analysis of L. angustifolia EOs was represented in Scheme 3, which is characterized by the presence of many biologically important compounds listed in Table 5 such as hexanal, Eucalyptol, Lavandulyl acetate, Eugenol, Bicyclo[10.1.0]tridec-1-ene, Linoleic acid, and cis-11-Eicosenoic acid compounds that referenced with insecticide properties constituents.

3.3. Antioxidant Activity and Free Radical Scavenging Capacity

Among the non-enzymatic antioxidants parameters, the levels of total phenolic content, total flavonoid content, and free radical scavenging capacity (DPPH) were measured in the study and the data in Table 6 show significant contents of TPC and TFC and DPPH capacity in three studied EOs. The highest content from total phenol and total flavonoid was 31.4 mg GAE/g and 17.6 mg QE/g in basil EOs. Additionally, a maximum DPPH capacity 18.9% was reported in basil essential oil.

3.4. Mortality Bioassay against Adult

Overall, mortality percentages in S. oryzae adult stage increased with increasing concentrations (2, 4, and 6 mg/cm2) and exposure time (3, 6, 12, 24, and 48 h) after using essential oils of basil, black seeds and lavender compared to control (10 ppm malathion).
For O. basilicum EOs, the obtained results represented in Figure 1 illustrated that the highest significant value of mortality 100% using concentration 6 mg/cm2 at 48 h exposure time, compared to control (10 ppm malathion), followed by 92.2% at 6 mg/cm2 after 24 h exposure time. On the other hand, there was no mortality in any of the untreated control.
For N. sativa EOs, the data presented in Figure 2 showed that the highest significant mortality of S. oryzae adult stages was recorded at concentration 6 mg/cm2 at all exposure times. The highest percentage of mortality of S. oryzae was reported at 6 mg/cm2 at 48 h with the value of 96.4% followed by the concentration 6 mg/cm2 at 24 h with the value of 70.3% compared to control with the value 98.2%.
For L. angustifolia EOs, the highest significant mortality of S. oryzae adult stages was represented in the highest concentration 6 mg/cm2 at all exposure times. The highest percentage of S. oryzae mortality 100% was recorded at 6 mg/cm2 after 48 and 24 h compared to their control values at 48 and 24 h were 100 and 98.2%, respectively, followed by 98.2 and 80.8% for 6 mg/cm2 at 24 and 12 h, respectively (Figure 3). Finally, after using three selected EOs against S. oryzae mortality; L. angustifolia EOs recorded the highest percentage of mortality 100% at exposure time 48 and 24 h, followed by O. basilicum recorded the percentage of mortality 100 and 98.2% at 48 and 24 h, respectively.

3.5. Repellant Bioassay against Adult

In general, the repellant percentage in S. oryzae adult stage increased with increasing the concentrations of three studied EOs and increasing exposure times. Regarding O. basilicum EOs results in Figure 4, the highest significant repellency of S. oryzae was recorded as 82.3% for 0.75 mg/cm2 at 5 h compared to control (4 ppm malathion) at 5 h with the value of 93.2%, followed by 78.3 and 69.7% for 0.75 mg/cm2 at 4 and 3 h, respectively, while the lowest significant repellency value was 54.2% at 0.25 mg/cm2 O. basilicum after 1 h.
For N. Sativa EOs, data represented in Figure 5 indicated that the highest significant repellency of S. oryzae adult stages was 77.5% at 0.75 mg/cm2 after 5 h compared to its control at the same exposure time with the value of 93.2%, followed by 74.6 and 67.7% for 0.75 mg/cm2 after 4 and 3 h, respectively, while the lowest significant repellency value was 45.6% at 0.25 mg/cm2 EO after 1 h.
For L. angustifolia EOs, obtained results in Figure 6 showed that the highest repellency percentage of S. oryzae adult stages increasing with increasing the concentration of EOs (0.25, 0.5, and at all exposure times). The highest significant repellence activity of L. angustifolia EO was recorded at 0.75 mg/cm2 after 5 h with the value of 77.5% after 5 h versus its control (4 ppm malathion) was 93.2% after the same exposure time, followed by 74.6 and 67.8% for 0.75 mg/cm2 after 4 and 3 h, respectively. While the lowest repellency value was 45.6% at 0.25 mg/cm2. On the other hand, the lowest significant repellency value was 45.6% at 0.25 mg/cm2 L. angustifolia after 1 h.
These results revealed that O. basilicum EOs recorded the highest repellence activity against S. oryzae with a value of 82.3% followed by L. angustifolia and N. sativa EOs.

3.6. Gene Expression Analysis

qRT-PCR analysis was performed at two different times after treatment (1 and 2 h) for three detoxification genes of Cytochrome P450 (CYP4Q4) and DEGs genes (CL8 and CL1294) in S. oryzae adult stage treated with O. basilicum, N. sativa, and L. angustifolia EOs as a natural insecticidal agent.
According to the qRT-PCR results in Figure 7, it showed maximum up-regulated expression level of CL8 gene exhibiting 6.08 fold changes in mRNA in S. oryzae adults treated with 6 mg/cm2 concentration of L. angustifolia EOs for 2 h, followed by 4.76 fold at 10 ppm malathion after 2 h. The minimum expression level reached 1.73 fold in adult insects treated with (6 mg/cm2) of N. sativa EOs for 1 h as compared with the reference gene (housekeeping gene, β-Actin).
According to the qRT-PCR results, Figure 8 shows the maximum up-regulated expression level of CYP4Q4 cytochrome gene as 4.76 at 10 ppm malathion after 2 h changes in mRNA in S. oryzae adult treated with (6 mg/cm2) for 2 h, followed by 3.75 fold change in adult insect treated with (6 mg/cm2) of L. angustifolia EOs, and the minimum expression level reached 1.73 fold in adult insect treated with (6 mg/cm2) of N. sativa EOs for 1 h as compared with reference gene (housekeeping gene, β-Actin).
According to the qRT-PCR results, Figure 9 reports that the maximum up-regulated expression level of CL 1294 gene exhibits 8.32 fold changes in mRNA in S. oryzae adult treated with (6 mg/cm2) of L. angustifolia EO for 2 h, followed by 4.76 at 10 ppm malathion after 2 h and the minimum expression level reached 2.08 fold in adult insect treated with (6 mg/cm2) concentration of N. sativa EO for 1 h as compared with reference gene (housekeeping gene, β-Actin).

4. Discussion

This study assesses the toxicity effect of three selected EOs (basil, black seeds, and Lavender) against S. oryzae. The highest insecticidal activity was recorded using basil and lavender EOs with 100% mortality effect. Pesticide disinfection is the most important method for the protection of the stored cereals and grains against insects [46]. Several research studies showed insecticides and repellence activities of many EOs extracted from different wild, spice, and herb plants against several stored-product insect pests [47,48,49,50,51,52]. In this study, Lavender EO had the highest toxicity activity for rice weevils with 100% mortality effect at 6 mg/cm2 at 12 and 48 h exposure time, in addition to the basil EO also had the highest mortality percentage 100% at 6 mg/cm2 at 12 h, this result was in agreed with [53], who reported the toxicity effect of basil, fennel, and geranium EOs against S. oryzae and C. maculatus through assessment of repellence and progeny production. Quick repellence activity in this study was highest for basil EO that recorded 61.2% for 0.75 mg/cm2 after 1 h against adult S. oryzae where repellence reached 82% after 5 h, theses result like results of [54], that reported repellence against S. oryzae after 1 h was 91.1%.
Active compounds in highest concentrations in basil EO were eugenol, linalool, estragole and methyl cinnamate, while active compounds in lavender were lavandulyl acetate, octacosane, and eugenol; black seeds characteristic by Limonene and 9, 12 Octadecadienoic acid active compounds. Eugenol active compound had repellent activity against Ixodes ricinus [55]. The estragole active compound had insecticide and pesticide activity against stored Vigna pest (Callosobruchus maculatus) [56]. Presences of estragole and t-anethole compounds in essential oil were an indicator for insecticide characters for this EO which had antimicrobial activity [57].
Eugenol is considered the important active compound in basil which had an effective effect against S. zeamais and T. castaneum, also had important fumigant activity with stored rice against the rice weevil [58]. The essential oils, especially basil and clove, can be used as an effective control agent for stored grain pests by fumigation. Active compounds in botanical EOs have some limitations such as low bioavailability, high volatility, and photodegradation that restrict their use on several occasions [59].
Previous reports are available on the fumigation activity related to various concentrations of plant EOs against pest insects S. zeamais [60] while the fumigant effect of investigated EOs in S. zeamais was enhanced by increasing the dose or exposure time of EOs, or different pest insects used [61,62]. The highest fumigant efficiency of clove and thyme EOs reported by [63], showed a 100% mortality of S. oryzae. Additionally, the results of [64] indicated that the EOs of clove caused 100% mortality similar to our result for basil and lavender Eos.
The repellant bioassay results in S. oryzae adults’ response to EOs using filter paper method show strong repellant effect (98.1%) after 48 h at a dose (0.75 mg/cm2) of L. angustifolia EOs, and 82.3% repellent after 48 h exposure to (0.75 mg/cm2) of O. basilicum EOs, as compared with 93.2% repellency after 48 h of exposure to (4 ppm) of chemical insecticide malathion. The essential oil of O. basilicum was principally composed of the monoterpenoid as terpinene and the terpene with alcohol group in O. basilicum and N. sativa Eos, such as linalool and linalyl acetate, which are known to have repellent and toxic activities against stored product insect [65]. The main components obtained in O. basilicum oil were similar to those described by [66,67,68]. Our results are similar to the previous study, the insecticidal toxicity in different pests by exposure to different concentrations of C. cyminum and L. angustifolia EOs [69,70,71,72,73]. According to phytochemical analysis data, the insecticidal activity related to the presence of linalyl acetate and linalool and other bioactive compounds in investigated O. basilicum, N. sativa, and L. angustifolia EOs, our phytochemical results were similar to previous studies, showing strong insecticides and repellent activities toxicity of C. cyminum and L. angustifolia EOs against different stored-product insects related to the presence of linalyl acetate and linalool [49,74,75]. Moreover, the fumigant toxicity of 1,8-cineole and linalool have been investigated against B. germanica (L.) and O. surinamensis by Abdelgaleil et al. [76]. In addition, [77] showed acetylcholine esterase inhibition in S. oryzae adults and T. castaneum larvae related to 1,8-cineole and linalool exposure.
The effective potentiality of studied plant EOs due to the presence of the most toxic components for insects such as linalool and linalyl acetate for O. basilicum, linalool, methyl ether, linoleic acid ethyl ester for N. sativa and lavandulyl acetate for L. angustifolia similar to previous studies proved major constituents in essential oils with toxic activity and insecticidal potentialities such as limonene, camphor, 1, 8-cineole, and g-terpinene [78,79]. Studied EOS resulted in death for S. oryzae adult pest, and this may be because of neurotoxic effect for these plants Eos, as revealed previously, which medicinal volatile and aromatic wild plants contain essential chemical constituents acting as inhibitors for S. oryzae and other insects [80,81]. In this study, toxicity against S. oryzae through detecting the mortality percentage was highest using L. angustifolia EO with the value of 100% at 48 and 24 h, this result agrees with the result of [82], who reported the highest mortality against Sitophilus oryzae and Callosobruchus chinensis with the value of 100% after two days using Cinnamomum sieboldii bark extract. The highest Inhibition activity and toxicity were recorded using EOs of L. angustifolia and O. basilicum due to their plants are aromatic and contain volatile oils. In the same context, [83] ensured that oils with high volatility led to the decay of insects through their fumigant and gaseous actions. Our results are in harmony with [84], who reported that cinnamon EO had the most toxic effect at 1 h against S. zeamais. Gene CYPs is a metabolic component in microorganisms and insects and plants; which released against any stresses as insecticides, pesticides, fungicides, and herbicides through increasing the activity of flavonoids compounds and increasing the antioxidant activity. Mode of action of CYPs occurs through increasing the content of CBT-ol which induces and exhibits resistance [85]. Results of qRT-PCR revealed the expression of selected genes CL8, CYP 4Q4, and CL1294 demonstrated the expression of these genes up and down in each treatment. Mode of action for detoxification genes inside insects has three pathways [86]. For pathway 1 functional group as nucleophilic was infused to the xenobiotic compound which active and considered as a water-soluble compound, the gene of cytochrome CYP 4Q4 is important in phase I. These genes have the main role in the detoxification and metabolization of insecticides leading to reduce toxic effect [87]. For phase II, enzymes increase solubility for water for the metabolite of Phase I through union with endogenous compound, which prevents tissue damage through combination with molecules of insecticides and CL1294 important in this phase [88]. Finally, in phase III, ABC enzyme transport xenobiotic compound out of the cell [89].

5. Conclusions

In conclusion, the highest repellence effects against S. oryzae were recorded by using basil EO with all concentrations and at different exposure times. This effect is related to the chemical composition of basil essential oil containing eugenol, linalool, and estragole. Lavender and basil EOs have the highest mortality effect against rice weevils. Expression of detoxification system of S. oryzae genes was increased in case of using lavender and basil EO. This study recommends using basil and lavender EOs as insecticides and pesticides against S. oryzae as biological control.

Author Contributions

Conceptualization, N.A.A.-H. and M.A.A.; methodology, All authors; validation, all authors; formal analysis, N.A.A.-H. and M.A.A; investigation, N.M.A.A.; resources, S.E.M. and A.A.I.; data curation, A.A.H.A.L.; writing—original draft preparation, All authors; writing, review and editing, A.A.I. and A.A.H.A.L; visualization, D.M.H., A.A.I., and M.A.A.; funding acquisition, A.A.H.A.L.; supervision, N.A.A.-H., A.A.H.A.L., and M.A.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Taif University Researchers Supporting Project number (TURSP-2020/72), Taif University, Taif, Saudi Arabia.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Relevant data applicable to this research are within the paper.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Food and Agriculture Organization (FAO). Cereal Supply and Demand Brief. 2019. Available online: http://www.fao.org/worldfoodsituation/csdb/en/ (accessed on 21 April 2021).
  2. Barr, B.A.; Koehler, C.S.; Smith, R.F. Crop Losses, Rice: Field Losses to Insects, Diseases, Weeds, and Other Pests; University of California/USAID Pest Management and Related Environmental Protection Project Berkeley: Berkeley, CA, USA, 1975; p. 64. [Google Scholar]
  3. Akhtar, M.; Raza, A.M.; Iram, N.; Chaudhry, M.I.; Azeem, W. Effect of Infestation of Sitophilus oryzae L. (Coleoptera: Curculiontdae) on Rrote1n Quality of Rice under Storage Conditions. lnt. J. Agric. Appl. Sci. 2015, 7, 43–45. [Google Scholar]
  4. Tabassum, S.; Noorka, L.R.; Afzal, M.; Ali, A. Screening best adopted wheat lines against aphid (Schizaphis graminum Rondanl) population. Pak. Entomol. 2012, 34, 51–53. [Google Scholar]
  5. Fornal, J.; Jeli’nski, T.; Sadowska, J.; Grundas, S.; Nawrot, J.; Niewiada, A.; Warchalewski, J.R.; Błaszczak, W. Detection of granary weevil Sitophilus granarius (L.) eggs and internal stages in wheat grain using soft X-ray and image analysis. J. Stored Prod. Res. 2007, 43, 142–148. [Google Scholar] [CrossRef]
  6. Haff, R.P.; Slaughter, D.C. Real-Time X-Ray Inspection of Wheat for Infestation by the Granary Weevil, Sitophilus granarius (L.). Trans. ASAE 2004, 47, 531–537. [Google Scholar] [CrossRef]
  7. Demeter, S.; Lebbe, O.; Hecq, F.; Nicolis, S.; Kemene, T.K.; Martin, H.; Fauconnier, M.-L.; Hance, T. Insecticidal Activity of 25 Essential Oils on the Stored Product Pest, Sitophilus granarius. Foods 2021, 10, 200. [Google Scholar] [CrossRef]
  8. Phillips, T.W.; Throne, J.E. Biorational approaches to managing stored-product insects. Annu. Rev. Èntomol. 2010, 55, 375–397. [Google Scholar] [CrossRef] [PubMed]
  9. Kljaji’c, P.; Peri’c, I. Susceptibility to contact insecticides of granary weevil Sitophilus granarius (L.) (Coleoptera: Curcu-lio-nidae) originating from different locations in the former Yugoslavia. J. Stored Prod. Res. 2006, 42, 149–161. [Google Scholar] [CrossRef]
  10. Kaan, P.; Ömer, C.K.; Yasemin, Y.Y.; Salih, G.; Betül, D.; Kemal, H.C.B.; Fatih, D. Insecticidal activity of edible Crithmum maritimum L. essential oil against Coleop-teran and Lepidopteran insects. Ind. Crops Prod. 2016, 89, 383–389. [Google Scholar]
  11. Elshafie, H.S.; Camele, I. An Overview of the Biological Effects of Some Mediterranean Essential Oils on Human Health. BioMed Res. Int. 2017, 2017, 1–14. [Google Scholar] [CrossRef] [PubMed]
  12. Ashton, D.; Hilton, M.; Thomas, K.V. Investigating the environmental transport of human pharmaceuticals to streams in the United Kingdom. Sci. Total Environ. 2004, 333, 167–184. [Google Scholar] [CrossRef]
  13. Aktar, W.; Sengupta, D.; Chowdhury, A. Impact of pesticides use in agriculture: Their benefits and hazards. Interdiscip. Toxicol. 2009, 2, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Al-Ahmadi, S. Effects of organic insecticides, Kingbo and Azdar 10 EC, on mitotic chromosomes in root tip cells of Allium cepa. Int. J. Genet. Mol. Biol. 2013, 5, 64–70. [Google Scholar] [CrossRef]
  15. Mesi (Dizdari), A.; Kopliku, D. Cytotoxic and Genotoxic Potency Screening of Two Pesticides on Allium cepa L. Procedia Technol. 2013, 8, 19–26. [Google Scholar] [CrossRef]
  16. Kostyukovsky, M.; Trostanetsky, A.; Quinn, E. Novel approaches for integrated grain storage management. Isr. J. Plant Sci. 2016, 63, 7–16. [Google Scholar] [CrossRef]
  17. Lins, L.; Maso, S.D.; Foncoux, B.; Kamili, A.; Laurin, Y.; Genva, M.; Jijakli, M.H.; De Clerck, C.; Fauconnier, M.L.; Deleu, M. Insights into the Relationships Between Herbicide Activities, Molecular Structure and Membrane Interaction of Cinnamon and Citronella Essential Oils Components. Int. J. Mol. Sci. 2019, 20, 4007. [Google Scholar] [CrossRef] [Green Version]
  18. Campolo, O.; Giunti, G.; Russo, A.; Palmeri, V.; Zappalà, L. Essential Oils in Stored Product Insect Pest Control. J. Food Qual. 2018, 2018, 1–18. [Google Scholar] [CrossRef] [Green Version]
  19. Della Pepa, T.; Elshafie, H.S.; Capasso, R.; De Feo, V.; Camele, I.; Nazzaro, F.; Scognamiglio, M.R.; Caputo, L. Antimicrobial and Phytotoxic Activity of Origanum heracleoticum and O. majorana Essential Oils Growing in Cilento (Southern Italy). Molecules 2019, 24, 2576. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  20. Camele, I.; Elshafie, H.S.; Caputo, L.; De Feo, V. Anti-quorum Sensing and Antimicrobial Effect of Mediterranean Plant Essential Oils Against Phytopathogenic Bacteria. Front. Microbiol. 2019, 10, 2619. [Google Scholar] [CrossRef] [PubMed]
  21. Elshafie, H.S.; Gruľová, D.; Baranová, B.; Caputo, L.; De Martino, L.; Sedlák, V.; Camele, I.; De Feo, V. Antimicrobial Activity and Chemical Composition of Essential Oil Extracted from Solidago canadensis L. Growing Wild in Slovakia. Molecules 2019, 24, 1206. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Elshafie, H.S.; Devescovi, G.; Venturi, V.; Camele, I.; Bufo, S.A. Study of the Regulatory Role of N-Acyl Homoserine Lactones Mediated Quorum Sensing in the Biological Activity of Burkholderia gladioli pv. agaricicola Causing Soft Rot of Agaricus spp. Front. Microbiol. 2019, 10, 2695. [Google Scholar] [CrossRef]
  23. Mossa, A.-T.H. Green Pesticides: Essential Oils as Biopesticides in Insect-pest Management. J. Environ. Sci. Technol. 2016, 9, 354–378. [Google Scholar] [CrossRef] [Green Version]
  24. Bakkali, F.; Averbeck, S.; Idaomar, M. Biological effects of essential oils—A review. Food Chem. Toxicol. 2008, 46, 446–475. [Google Scholar] [CrossRef]
  25. Regnault-Roger, C.; Vincent, C.; Arnason, J.T. Essential Oils in Insect Control: Low-Risk Products in a High-Stakes World. Annu. Rev. Èntomol. 2012, 57, 405–424. [Google Scholar] [CrossRef]
  26. Houghton, P.J.; Ren, Y.; Howes, M.J. Acetylcholinesterase inhibitors from plants and fungi. Nat. Prod. Rep. 2006, 23, 181–199. [Google Scholar] [CrossRef] [PubMed]
  27. Popović, Z.; Kostic, M.; Popovic, S.; Skoric, S. Bioactivities of essential oils from basil and sage to Sitophilus oryzae L. Biotechnol. Biotechnol. Equip. 2006, 20, 36–40. [Google Scholar] [CrossRef]
  28. Benayad, N.; Ebrahim, W.; Hakiki, A.; Mosaddak, M. Chemical characterization and Insecticidal evaluation of the essential oil of Mentha suaveolens L. and Mentha pulegium L. growing in Morocco. St. Cerc. St. CICBIA 2012, 13, 27–32. [Google Scholar]
  29. Chaubey, M.K. Insecticidal activity of Trachyspermum ammi (Umbelliferae), Anethum graveolens (Umbelliferae) and Nigella sativa (Ranunculaceae) against stored-product beetle Tribolium castaneum Herbst (Coleoptera: Tenebrionidae). Afr. J. Agric. Res. 2007, 2, 596–600. [Google Scholar]
  30. Conti, B.; Canale, A.; Cioni, P.L.; Flamini, G. Repellence of essential oils from tropical and Mediterranean Lamiaceae against Sitophilus zeamais. Bull. Insectology 2010, 63, 197–202. [Google Scholar]
  31. Pugazhvendan, R.; Ross, P.R.; Elumalai, K. Insecticidal and repellant activities of plants oil against stored grain pest, Tribolium castaneum (Herbst) (Coleoptera: Tenebrionidae). Asian Pac. J. Trop. Dis. 2012, 2, 412–415. [Google Scholar] [CrossRef]
  32. Touati, B.; Chogranib, H.; Hassenc, I.; Boussa, M.; Toumid, L.; Brahima, N.B. Chemical composition of the leaf and flower essential oils of Tunisian Lavandula dentata L. (Lamiaceae). Chem. Biodivers. 2011, 8, 1560–1569. [Google Scholar] [CrossRef]
  33. Shi, H.; Pei, L.; Gu, S.; Zhu, S.; Wang, Y.; Zhang, Y.; Li, B. Glutathione S-transferase (GST) genes in the red flour beetle, Tribolium castaneum, and comparative analysis with five additional insects. Genomics 2012, 100, 327–335. [Google Scholar] [CrossRef] [Green Version]
  34. Jin, Y.; Gao, Y.; Zhang, H.; Wang, L.; Yang, K.; Dong, H. Detoxification enzymes associated with butene-fipronil resistance in Epacromius coerulipes. Pest Manag. Sci. 2020, 76, 227–235. [Google Scholar] [CrossRef]
  35. Enayati, A.A.; Ranson, H.; Hemingway, J. Insect glutathione transferases and insecticide resistance. Insect Mol. Biol. 2005, 14, 3–8. [Google Scholar] [CrossRef] [Green Version]
  36. Yang, Y.-X.; Lin, R.-H.; Li, Z.; Wang, A.-Y.; Xue, C.; Duan, A.-L.; Zhao, M.; Zhang, J.-H. Function Analysis of P450 and GST Genes to Imidacloprid in Aphis craccivora (Koch). Front. Physiol. 2021, 11. [Google Scholar] [CrossRef] [PubMed]
  37. Périno, S.; Chemat-Djenni, Z.; Petitcolas, E.; Giniès, C.; Chemat, F. Downscaling of Industrial Turbo-Distillation to Laboratory Turbo-Clevenger for Extraction of Essential Oils. Application of Concepts of Green Analytical Chemistry. Molecules 2019, 24, 2734. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Su, H.F.C. Toxicity of a chemical component of Lemon oil to cowpea weevils. J. Geogian Soc. 1976, 11, 297–301. [Google Scholar]
  39. Abbott, W.S. A method of computing the effectiveness of an insecticide. J. Econ. Entomol. 1925, 18, 265–267. [Google Scholar] [CrossRef]
  40. Isman, M.B. Botanical insecticides, deterrents and repellents in modern agriculture and an increasingly regulated world. Annu. Rev. Entomol. 2006, 51, 45e66. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Elshafie, H.S.; Racioppi, R.; Bufo, S.A.; Camele, I. In vitro study of biological activity of four strains of Burkholderia gladioli pv. agaricicola and identification of their bioactive metabolites using GC–MS. Saudi J. Biol. Sci. 2017, 24, 295–301. [Google Scholar] [CrossRef] [Green Version]
  42. Sakr, S.H.; Elshafie, H.S.; Camele, I.; Sadeek, S.A. Synthesis, Spectroscopic, and Biological Studies of Mixed Ligand Complexes of Gemifloxacin and Glycine with Zn(II), Sn(II), and Ce(III). Molecules 2018, 23, 1182. [Google Scholar] [CrossRef] [Green Version]
  43. Schmittgen, T.D.; Zakrajsek, B.A.; Mills, A.G.; Gorn, V.; Singer, M.J.; Reed, M.W. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: Comparison of endpoint and real-time methods. Anal. Biochem. 2000, 285, 194–204. [Google Scholar] [CrossRef]
  44. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  45. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
  46. Rajendran, S.; Sriranjini, V. Plant products as fumigants for stored-product insect control. J. Stored Prod. Res. 2008, 44, 126–135. [Google Scholar] [CrossRef]
  47. Shaaya, E.; Ravid, U.; Paster, N.; Juven, B.; Zisman, U.; Pissarev, V. Fumigant toxicity of essential oils against four major stored-product insects. J. Chem. Ecol. 1991, 17, 499–504. [Google Scholar] [CrossRef]
  48. Shaaya, E.; Kostjukovski, M.; Eilberg, J.; Sukprakarn, C. Plant oils as fumigants and contact insecticides for the control of stored-product insects. J. Stored Prod. Res. 1997, 33, 7–15. [Google Scholar] [CrossRef]
  49. Tunç, I.; Berger, B.; Erler, F.; Dağlı, F. Ovicidal activity of essential oils from five plants against two stored-product insects. J. Stored Prod. Res. 2000, 36, 161–168. [Google Scholar] [CrossRef]
  50. Kim, S.-I.; Roh, J.-Y.; Kim, D.-H.; Lee, H.-S.; Ahn, Y.-J. Insecticidal activities of aromatic plant extracts and essential oils against Sitophilus oryzae and Callosobruchus chinensis. J. Stored Prod. Res. 2003, 39, 293–303. [Google Scholar] [CrossRef]
  51. Cosimi, S.; Rossi, E.; Cioni, P.L.; Canale, A. Bioactivity and qualitative analysis of some essential oils from Mediterranean plants against stored-product pests: Evolution of repellency against Sitophilus zeamais Motschulsky, Cryptolestes ferruginous (Stephens) and Tenebrio molitor (L.). J. Stored Prod. Res. 2009, 45, 125–132. [Google Scholar] [CrossRef]
  52. Pérez, S.G.; Ramos-López, M.A.; Zavala-Sánchez, M.A.; Cárdenas-Ortega, N.C. Activity of essential oils as a biorational alternative to control coleopteran insects in stored grains. J. Med. Plants Res. 2010, 4, 2827–2835. [Google Scholar]
  53. Seada, M.A.; Abo Arab, R.; Adel, I.; Seif, A.I. Bioactivity of Essential Oils of Basil, Fennel, and Geranium Against Sitophilus Oryzae and Callosobruchus Maculatus: Evaluation of Repellency, Progeny Production and Residual Activity. Egypt. J. Exp. Biol. (Zool.) 2016, 12, 1–12. [Google Scholar]
  54. Tripathi, A.; Upadhyay, S. Repellent and insecticidal activities of Hyptis suaveolens (Lamiaceae) leaf essential oil against four stored-grain coleopteran pests. Int. J. Trop. Insect Sci. 2009, 29, 219. [Google Scholar] [CrossRef]
  55. Abdel-Aziz, M.F.; El-Sayed, Y.A. Toxicity and biochemical efficacy of six essential oils against T. confusum (Du Val) (Coleoptera: Tenebrionidae). Egypt. Acad. J. Biol. Sci. 2009, 2, 1–11. [Google Scholar]
  56. Kéita, S.M.; Vincent, C.; Schmit, J.-P.; Arnason, J.T.; Bélanger, A. Efficacy of essential oil of Ocimum basilicum L. and O. gratissimum L. applied as an insecticidal fumigant and powder to control Callosobruchus maculatus (Fab.) [Coleoptera: Bruchidae]. J. Stored Prod. Res. 2001, 37, 339–349. [Google Scholar] [CrossRef]
  57. Friedman, M.; Henika, P.R.; Mandrell, R.E. Bactericidal Activities of Plant Essential Oils and Some of Their Isolated Constituents against Campylobacter jejuni, Escherichia coli, Listeria monocytogenes, and Salmonella enterica. J. Food Prot. 2002, 65, 1545–1560. [Google Scholar] [CrossRef]
  58. Lee, S.-E.; Lee, B.-H.; Choi, W.-S.; Park, B.-S.; Kim, J.-G.; Campbell, B.C. Fumigant toxicity of volatile natural products from Korean spices and medicinal plants towards the rice weevil, Sitophilus oryzae (L). Pest Manag. Sci. 2001, 57, 548–553. [Google Scholar] [CrossRef]
  59. Madhusudhanamurthya, J.; Rania, P.I.; USHA; Sambasiva, K.R.S.; RAOB. Organic-inorganic Hybrids of Nano Silica and Certain Botanical Compounds for their Improved Bioactivity Against Agricultural Pests. Cur. Trends Biotechnol. Pharm. 2013, 7, 615–624. [Google Scholar]
  60. Li, S.G.; Li, M.Y.; Huang, Y.Z.; Hua, R.M.; Lin, H.F.; He, Y.J. Fumigant activity of Illicium verum fruit extracts and their effects on the acetylcholinesterase and glutathione S-transferase activities in adult Sitophilus zeamais. J. Pest Sci. 2013, 86, 677–683. [Google Scholar] [CrossRef]
  61. Abdelgaleil, S.A.M.; Mohamed, M.I.E.; Shawir, M.S.; Abou-Taleb, H.K. Chemical composition, insecticidal and biochemical effects of essential oils of different plant species from Northern Egypt on the rice weevil, Sitophilus oryzae L. J. Pest Sci. 2016, 89, 219–229. [Google Scholar] [CrossRef]
  62. Tak, J.H.; Jovel, E.; Isman, M.B. Contact, fumigant, and cytotoxic activities of thyme and lemongrass essential oils against larvae and an ovarian cell line of the cabbage looper, Trichoplusiani. J. Pest Sci. 2016, 89, 183–193. [Google Scholar] [CrossRef]
  63. Rastegar, F.; Moharramipour, S.; Shojai, M.; Abbasipour, H. Chemical composition and insecticidal activity of essential oil of Zataria multiflora Boiss (Lamiaceae) against Callosobruchus maculates(F.) (Coleoptera: Bruchidae). IOBCWPRS Bull. 2011, 69, 281–288. [Google Scholar]
  64. Liao, M.; Xiao, J.-J.; Zhou, L.-J.; Yao, X.; Tang, F.; Hua, R.-M.; Wu, X.-W.; Cao, H.-Q. Chemical composition, insecticidal and biochemical effects of Melaleuca alternifolia essential oil on the Helicoverpa armigera. J. Appl. Èntomol. 2017, 141, 721–728. [Google Scholar] [CrossRef] [Green Version]
  65. Mondal, M.; Khalequzzaman, M. Toxicity of Naturally Occurring Compounds of Plant Essential Oil against Tribolium castaneum (Herbst). J. Biol. Sci. 2010, 10, 10–17. [Google Scholar] [CrossRef] [Green Version]
  66. Kim, K.-H.; Yi, C.-G.; Ahn, Y.-J.; Kim, S.I.; Lee, S.-G.; Kim, J.-R. Fumigant toxicity of basil oil compounds and related compounds to Thrips palmi and Orius strigicollis. Pest Manag. Sci. 2014, 71, 1292–1296. [Google Scholar] [CrossRef]
  67. Souza, V.N.; de Oliveira, C.R.F.; Cysneiros Matos, C.H.; de Almeida, D.K.F. Fumigation toxicity of essential oils against Rhyzopertha dominica(F.) in stored maize grain. Revista Caatinga 2016, 29, 435–440. [Google Scholar] [CrossRef] [Green Version]
  68. Rodríguez-González, Á.; Álvarez-García, S.; González-López, Ó.; Da Silva, F.; Casquero, P.A. Insecticidal Properties of Ocimum basilicum and Cymbopogon winterianus against Acanthoscelides obtectus, Insect Pest of the Common Bean (Phaseolus vulgaris, L.). Insects 2019, 10, 151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  69. Chaubey, M.K. Fumigant Toxicity of Essential Oils from Some Common Spices against Pulse Beetle, Callosobruchus chinensis (Coleoptera: Bruchidae). J. Oleo Sci. 2008, 57, 171–179. [Google Scholar] [CrossRef] [Green Version]
  70. Cardiet, G.; Fuzeau, B.; Barreau, C.; Fleurat-Lessard, F. Contact and fumigant toxicity of some essential oil constituents against a grain insect pest Sitophilus oryzae and two fungi, Aspergillus westerdijkiae and Fusarium graminearum. J. Pest Sci. 2012, 85, 351–358. [Google Scholar] [CrossRef]
  71. Manzoomi, N.; Ganbalani, G.N.; Dastjerdi, H.R.; Fathi, S.A.A. Fumigant Toxicity of Essential Oils of Lavandula officinalis, Artemisia dracunculus and Heracleum persicum on the Adults of Callosobruchus maculates(Coleoptera: Bruchidae). Munn. Entomol. Zool. 2010, 5, 118–122. [Google Scholar]
  72. Rozman, V.; Kalinovic, I.; Korunic, Z. Toxicity of naturally occurring compounds of Lamiaceae and Lauraceae to three stored-product insects. J. Stored Prod. Res. 2007, 43, 349–355. [Google Scholar] [CrossRef]
  73. Sfara, V.; Zerba, E.N.; Alzogaray, R.A. Fumigant insecticidal activity and repellent effect of five essential oils and seven monoterpenes on first-instar nymphs of Rhodnius prolixus. J. Med Èntomol. 2009, 46, 511–515. [Google Scholar] [CrossRef] [PubMed]
  74. Ayvaz, A.; Sagdic, O.; Karaborklu, S.; Ozturk, I. Insecticidal Activity of the Essential Oils from Different Plants Against Three Stored-Product Insects. J. Insect Sci. 2010, 10, 1–13. [Google Scholar] [CrossRef] [PubMed]
  75. Lee, S.; Peterson, C.; Coats, J. Fumigation toxicity of monoterpenoids to several stored product insects. J. Stored Prod. Res. 2003, 39, 77–85. [Google Scholar] [CrossRef]
  76. Abdelgaleil, S.A.M.; Mohamed, M.I.E.; Badawy, M.E.I.; El-Arami, S.A.A. Fumigant and Contact Toxicities of Monoterpenes to Sitophilus oryzae (L.) and Tribolium castaneum (Herbst) and their Inhibitory Effects on Acetylcholinesterase Activity. J. Chem. Ecol. 2009, 35, 518–525. [Google Scholar] [CrossRef]
  77. Chaubey, M. Fumigant Toxicity of Essential Oils Against Rice Weevil Sitophilus oryzae L. (Coleoptera: Curculionidae). J. Biol. Sci. 2011, 11, 411–416. [Google Scholar] [CrossRef] [Green Version]
  78. Nattudurai, G.; Paulraj, M.G.; Ignacimuthu, S. Fumigant toxicity of volatile synthetic compounds and natural oils against red flour beetle Tribolium castaneum (Herbst) (Coleopetera: Tenebrionidae). J. King Saud Univ. Sci. 2012, 24, 153–159. [Google Scholar] [CrossRef] [Green Version]
  79. Kathirvelu, C.; Mangayarkarasi, S.; Ayyasamy, R.; Kannan, R. Fumigant toxicity of synthetic volatile compounds and essential oils against coleopteran pests of stored produce. Int. J. Entomol. Res. 2020, 5, 93–97. [Google Scholar]
  80. Pandey, S. Phytochemical Constituents, Pharmacological and Traditional Uses of Ocimum gratissimum L in Tropics. IAJPS 2017, 4, 4234–4242. [Google Scholar]
  81. Owolabi, M.S.; Ogundajo, A.L.; Alafia, A.O.; Ajelara, K.O.; Setzer, W.N. Composition of the Essential Oil and Insecticidal Activity of Launaea taraxacifolia (Willd.) Amin ex C. Jeffrey Growing in Nigeria. Foods 2020, 9, 914. [Google Scholar] [CrossRef]
  82. Kim, S.-W.; Kang, J.; Park, I.-K. Fumigant toxicity of Apiaceae essential oils and their constituents against Sitophilus oryzae and their acetylcholinesterase inhibitory activity. J. Asia-Pacific Èntomol. 2013, 16, 443–448. [Google Scholar] [CrossRef]
  83. Ahn, Y.-J.; Lee, S.-B.; Lee, H.-S.; Kim, G.-H. Insecticidal and Acaricidal Activity of Carvacrol and β-Thujaplicine Derived from Thujopsis dolabrata var. hondai Sawdust. J. Chem. Ecol. 1998, 24, 81–90. [Google Scholar] [CrossRef]
  84. Yang, Y.; Isman, M.B.; Tak, J.-H. Insecticidal Activity of 28 Essential Oils and a Commercial Product Containing Cinnamomum cassia Bark Essential Oil against Sitophilus zeamais Motschulsky. Insects 2020, 11, 474. [Google Scholar] [CrossRef] [PubMed]
  85. Pandian, B.A.; Sathishraj, R.; Djanaguiraman, M.; Prasad, P.V.; Jugulam, M. Role of Cytochrome P450 Enzymes in Plant Stress Response. Antioxidants 2020, 9, 454. [Google Scholar] [CrossRef] [PubMed]
  86. Cunha, V.; Santos, M.M.; Moradas-Ferreira, P.; Ferreira, M. Simvastatin effects on detoxification mechanisms in Danio rerio embryos. Environ. Sci. Pollut. Res. 2016, 23, 10615–10629. [Google Scholar] [CrossRef] [PubMed]
  87. Gong, Y.; Shi, X.; Desneux, N.; Gao, X. Effects of spirotetramat treatments on fecundity and carboxylesterase expression of Aphis gossypii Glover. Ecotoxicology 2016, 25, 655–663. [Google Scholar] [CrossRef] [PubMed]
  88. Zhang, M.; Fang, T.; Pu, G.; Sun, X.; Zhou, X.; Cai, Q. Xenobiotic metabolism of plant secondary compounds in the English grain aphid, Sitobion avenae (F.) (Hemiptera: Aphididae). Pestic. Biochem. Physiol. 2013, 107, 44–49. [Google Scholar] [CrossRef]
  89. Inouye, S.; Takizawa, T.; Yamaguchi, H. Antibacterial activity of essential oils and their major constituents against respiratory tract pathogens by gaseous contact. J. Antimicrob. Chemother. 2001, 47, 565–573. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Plants 10 00829 sch001 550
Scheme 1. GC-MS chromatogram of O. basilicum EOs.
Scheme 1. GC-MS chromatogram of O. basilicum EOs.
Plants 10 00829 sch001
Plants 10 00829 sch002 550
Scheme 2. GC-MS chromatogram of Nigella sativa Eos.
Scheme 2. GC-MS chromatogram of Nigella sativa Eos.
Plants 10 00829 sch002
Plants 10 00829 sch003 550
Scheme 3. GC-MS chromatogram of L. angustifolia EOs.
Scheme 3. GC-MS chromatogram of L. angustifolia EOs.
Plants 10 00829 sch003
Plants 10 00829 g001 550
Figure 1. Impact of different concentrations (2, 4 and 6 mg/cm2) from O. basilicum EOs on mortality of S. oryzae adults at 3, 6, 12, 24, and 48 h exposure times (mean ± SD) compared with standard chemical pesticide (10 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05; LSD = 0.036.
Figure 1. Impact of different concentrations (2, 4 and 6 mg/cm2) from O. basilicum EOs on mortality of S. oryzae adults at 3, 6, 12, 24, and 48 h exposure times (mean ± SD) compared with standard chemical pesticide (10 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05; LSD = 0.036.
Plants 10 00829 g001
Plants 10 00829 g002 550
Figure 2. Impact of different concentrations (2, 4, and 6 mg/cm2) from N. sativa EOs on mortality of S. oryzae adults at 3, 6, 12, 24, and 48 h exposure times (mean ± SD) compared with standard chemical pesticide (10 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05; LSD = 0.016.
Figure 2. Impact of different concentrations (2, 4, and 6 mg/cm2) from N. sativa EOs on mortality of S. oryzae adults at 3, 6, 12, 24, and 48 h exposure times (mean ± SD) compared with standard chemical pesticide (10 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05; LSD = 0.016.
Plants 10 00829 g002
Plants 10 00829 g003 550
Figure 3. Impact of different concentrations (2, 4, and 6 mg/cm2) from L. angustifolia EOs on mortality of S. oryzae adults at 3, 6, 12, 24, and 48 h exposure times (mean ± SD) compared with standard chemical pesticide (10 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05; LSD = 0.115.
Figure 3. Impact of different concentrations (2, 4, and 6 mg/cm2) from L. angustifolia EOs on mortality of S. oryzae adults at 3, 6, 12, 24, and 48 h exposure times (mean ± SD) compared with standard chemical pesticide (10 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05; LSD = 0.115.
Plants 10 00829 g003
Plants 10 00829 g004 550
Figure 4. Impact of different concentrations (0.25, 0.5, and 0.75 mg/cm2) from O. basilicum EOs on repellent % of S. oryzae adults at 1, 2, 3, 4, and 5 h exposure times (mean ± SD) compared with standard chemical pesticide (4 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05; LSD = 0.157.
Figure 4. Impact of different concentrations (0.25, 0.5, and 0.75 mg/cm2) from O. basilicum EOs on repellent % of S. oryzae adults at 1, 2, 3, 4, and 5 h exposure times (mean ± SD) compared with standard chemical pesticide (4 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05; LSD = 0.157.
Plants 10 00829 g004
Plants 10 00829 g005 550
Figure 5. Impact of different concentrations (0.25, 0.5, and 0.75 mg/cm2) from N. sativa EOs on repellent % of S. oryzae adults at 1, 2, 3, 4, and 5 h exposure times (mean ± SD) compared with standard chemical pesticide (4 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05; LSD = 0.127.
Figure 5. Impact of different concentrations (0.25, 0.5, and 0.75 mg/cm2) from N. sativa EOs on repellent % of S. oryzae adults at 1, 2, 3, 4, and 5 h exposure times (mean ± SD) compared with standard chemical pesticide (4 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05; LSD = 0.127.
Plants 10 00829 g005
Plants 10 00829 g006 550
Figure 6. Impact of different concentrations (0.25, 0.5, and 0.75 mg/cm2) from L. angustifolia EOs and on repellent % of S. oryzae adults at 1, 2, 3, 4, and 5 h exposure times (mean ± SD) compared with standard chemical pesticide (4 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05; LSD = 0. 0.157.
Figure 6. Impact of different concentrations (0.25, 0.5, and 0.75 mg/cm2) from L. angustifolia EOs and on repellent % of S. oryzae adults at 1, 2, 3, 4, and 5 h exposure times (mean ± SD) compared with standard chemical pesticide (4 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05; LSD = 0. 0.157.
Plants 10 00829 g006
Plants 10 00829 g007 550
Figure 7. Relative gene expression of DEGs gene (CL8) gene in S. oryzae adults after 1 and 2 h treated with 6 mg/cm2 of O. basilicum, N. sativa, and L. angustifolia EOs (mean ± SD) compared with standard chemical insecticide (10 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05.
Figure 7. Relative gene expression of DEGs gene (CL8) gene in S. oryzae adults after 1 and 2 h treated with 6 mg/cm2 of O. basilicum, N. sativa, and L. angustifolia EOs (mean ± SD) compared with standard chemical insecticide (10 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05.
Plants 10 00829 g007
Plants 10 00829 g008 550
Figure 8. Relative gene expression of CYP4Q4 gene in S. oryzae adults after 1 and 2 h treated with 6 mg/cm2 of O. basilicum, N. sativa and L. angustifolia EOs (mean ± SD) compared with standard chemical insecticide (10 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05.
Figure 8. Relative gene expression of CYP4Q4 gene in S. oryzae adults after 1 and 2 h treated with 6 mg/cm2 of O. basilicum, N. sativa and L. angustifolia EOs (mean ± SD) compared with standard chemical insecticide (10 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05.
Plants 10 00829 g008
Plants 10 00829 g009 550
Figure 9. Relative gene expression of CL 1294 gene in S. oryzae adults after 1 and 2 h treated with 6 mg/cm2 of O. basilicum, N. sativa, and L. angustifolia EOs (mean ± SD) compared with standard chemical insecticide (10 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05.
Figure 9. Relative gene expression of CL 1294 gene in S. oryzae adults after 1 and 2 h treated with 6 mg/cm2 of O. basilicum, N. sativa, and L. angustifolia EOs (mean ± SD) compared with standard chemical insecticide (10 ppm malathion). Different letters indicate significant differences between different treatments at p < 0.05.
Plants 10 00829 g009
Table
Table 1. Nucleotide primer sequences used in qRT-PCR analysis in S. oryzae adult stage treated with essential oils.
Table 1. Nucleotide primer sequences used in qRT-PCR analysis in S. oryzae adult stage treated with essential oils.
TechniqueTarget GeneSequences (5′–3′)Annealing °C
qRT-PCRβ-Actin-FGACCTCTATGCCAACACAGT60 °C
β-Actin-RAGTACTTGCGCTCAGGAGGA
CL8-FCATCCGCAAACACAACAAAC
CL8 -RTACCTGAAGGGTCCATATGG
CYP 4Q4-FCAGTTTGGTGATTCAGATGATG
CYP 4Q4-RGCACATCTGGGGACAAACTT
CL1294 –FGTCTATGCACCTGGGTCGTT
CL1294 –RGTCGGCAGACAAGGAAGACA
Table
Table 2. Phytochemical analysis of basil, black seeds and lavender EOs.
Table 2. Phytochemical analysis of basil, black seeds and lavender EOs.
S. No.Phytochemical TestO. basilicumN. sativaL. angustifolia
1Carbohydrate+--
2Glycosides++-
3Steroids+++
4Terpenoids+++
5Tannins+++
6Sterols +++
Table
Table 3. Chemical composition of O. basilicum EOs.
Table 3. Chemical composition of O. basilicum EOs.
Quantitative IDComponent IdentifiedRILRIArea (%)Identification
1Glycolaldehyde8739233.27RI, MS
2Trioxane686660tRI, MS
3Methyl formate484386tRI, MS
42-Chloroethanol688680tRI, MS
5Acetic acid, 2-hydroxy-, ethyl ester829918tRI, MS
6Acetic acid, hydrazide8639461.14RI, MS
7(1S)-Camphor1121112030.321RI, MS
8Ethyl 3-(6-methoxy-3-methyl-2-benzofuranyl)-3-(p-methoxyphenyl) propionate27492838tRI, MS
9O-Ethyl S-[1-(4-methylphenyl)-2,3-diphenyl-2-cyclopropen-1-yl] carbonodithioate34013490tRI, MS
101-{2,4-Bis[(trimethylsilyl)oxy]phenyl}-2-{4-[(trimethylsilyl)oxy]phenyl}-1-propanone26312720tRI, MS
11Octamethylcyclotetrasiloxane8279949.936RI, MS
122-Butyl-9(10H)-acridinone23422431tRI, MS
13Cridanimod23542443tRI, MS
1410-Butyl-10H-acridin-9-one216922580.31RI, MS
155-Amino-2-trimethylsilyloxy-acetophenone163917281.311RI, MS
161-Acetyl-1,5-diazacycloheptadecan-6-one25502639tRI, MS
172,2-Bis[4-(dimethylamino)phenyl]-1-phenylethanone2835292436.630RI, MS
18Bis(3,4-dimethylphenyl) isophthalate30403087tRI, MS
192,5-Diphenyl-1,2-dihydro-3H-1,2,4-triazole-3-thione 24832572tRI, MS
20Triamterene 2829291213.042RI, MS
212-Amino-7-benzyl-4(1H)-pteridinone 25252614tRI, MS
221,2-Dihydrobenzo[b]fluoranthene 22462420tRI, MS
239-Phenanthrylmethyl 2,6-dimethylbenzoate 306231092.84RI, MS
24Propyl 2-tridecyn-1-yl terephthalate 28492896ndRI, MS
252,3-Dichlorophenyl 2-fluoro-6-(trifluoromethyl)benzoate 19162005tRI, MS
262,4-Dichloro-6-formylphenyl 2-fluoro-5-(trifluoromethyl)benzoate 22182307ndRI, MS
279-Phenanthrylmethyl 2,6-dimethylbenzoate 30623109tRI, MS
28Nonyl N-(4-ethylbenzoyl)glycinate 26672756tRI, MS
29Undecyl N-(4-ethylbenzoyl)glycinate 28662955tRI, MS
30Tridecyl N-(4-ethylbenzoyl)glycinate30653154tRI, MS
31Isobutyl N-(4-ethylbenzoyl)glycinate 21062195tRI, MS
321,1′-(2,4,6-Trihydroxy-1,3-phenylene)di(1-propanone) 22382327tRI, MS
33Propyl 2-fluoro-5-(trifluoromethyl)benzoate 11811270tRI, MS
341-{2,4-Bis[(trimethylsilyl)oxy]phenyl}-2-{4-[(trimethylsilyl)oxy]phenyl}-1-propanone 26312720tRI, MS
351-{2,4-Bis[(trimethylsilyl)oxy]phenyl}ethanone 16251714tRI, MS
36Bis(2,5-dimethylphenyl) isophthalate 30403087tRI, MS
37Pyridazinone 8859680.518RI, MS
384-Pyridazinol 11221211ndRI, MS
39Decahydroquinoline 12471330ndRI, MS
40N,N,2-Trimethyl-3-butyn-2-amine 680763ndRI, MS
41Allylcyclohexylamine11681251ndRI, MS
421,5-Bis(3-ethylphenoxy)-1,1,3,3,5,5-hexamethyltrisiloxane 24222511ndRI, MS
431,5-Bis(2,5-dimethylphenoxy)-1,1,3,3,5,5-hexamethyltrisiloxane 24502539ndRI, MS
441,1,3,3,5,5,7,7,9,9,11,11-Dodecamethylhexasiloxane 13411430tRI, MS
452,3,4,5-Tetraethyl-7,7-diphenylbicyclo[4.1.0]hepta-2,4-diene 27432798tRI, MS
461,1,3,3,5,5,7,7,9,9,11,11,13,13-Tetradecamethylheptasiloxane 15261615tRI, MS
47Eugenol1392136417.52RI, MS
48Linalool1082110012.31RI, MS
49Estragole117211787.20RI, MS
50Linalyl acetate1272125430.43RI, MS
RI: Retention, LRI: Literature retention index, t: Trace (<0.05%), nd: not detected, MS: Mass spectrometry (GC/MS).
Table
Table 4. Chemical composition of N. sativa EOs.
Table 4. Chemical composition of N. sativa EOs.
Quantitative IDComponent IdentifiedRILRIArea (%)Identification
1β-Thujene873920tRI, MS
2α-Thujene9029262.061RI, MS
3α-Phellandrene9691005tRI, MS
4p-Cymene 104210217.244RI, MS
5Thymoquinone134012761.145RI, MS
64,4a,5,6,7,8-Hexahydro-4a-methyl-2(3H)-naphthalinone13571414tRI, MS
74-(3-Methyl-2-butenyl)-4-cyclopentene-1,3-dione13971454tRI, MS
82(5H)-Furanone, 4-(2,3-dimethyl-2-buten-4-yl)-5-methoxy-14931582tRI, MS
9(11E,13Z)-1,11,13-Hexadecatriene16181657tRI, MS
109-Hexadecenal18081805tRI, MS
Pentadecanoic acid18691865tRI, MS
11Palmitic acid196819639.936RI, MS
12cis-10-Heptadecenoic acid20752073tRI, MS
13Methyl linoleate20932087tRI, MS
14Oleic acid chloride213122200.31RI, MS
15Stearic acid 216721611.311RI, MS
16Oleic Acid21752171tRI, MS
17Linoleic acid2183213456.630RI, MS
18cis-11-Eicosenoic acid23742362tRI, MS
192-Chloroethyl linoleate24182458tRI, MS
20Erucic acid2572254613.042RI, MS
211-Oleoyl-rac-glycerol 26892714tRI, MS
222-Oleoylglycerol27052780tRI, MS
23Trielaidin 614961898.628RI, MS
RI: Retention index, LRI: Literature retention index, t: Trace (<0.05%), MS: Mass spectrometry (GC/MS).
Table
Table 5. Chemical composition of L. angustifolia EOs.
Table 5. Chemical composition of L. angustifolia EOs.
Quantitative IDComponent IdentifiedRILRIArea (%)Identification
1Hexanal80681910.44RI, MS
2Cyclobutanol828668tRI, MS
3Eucalyptol105910308.940RI, MS
4Trifluoroacetyl-.alpha.-terpineol11671167tRI, MS
5Lavandulyl acetate1270127319.24RI, MS
6Linalool acetate12721261tRI, MS
7Eugenol1392135629.35RI, MS
8Isoeugenol14101451tRI, MS
9Linalyl butyrate14711422tRI, MS
10Bicyclo[10.1.0]tridec-1-ene1472147214.69RI, MS
Hexyl cyclohexanecarboxylate15441509ndRI, MS
11Eugenol acetate15521523tRI, MS
128-Hexadecyne162916291.031RI, MS
139,12-Tetradecadien-1-ol, (Z,E)-16721677tRI, MS
149-Hexadecyn-1-ol18721863tRI, MS
159-Hexadecenoic acid197619530.65RI, MS
16Cyclohexanecarboxylic acid20312084ndRI, MS
171,6-Octadien-3-ol, 3,7-dimethyl-, 2-aminobenzoate2157217515.35RI, MS
18Vaccenic acid21752141tRI, MS
19Cyclohexanecarboxylic acid, 2-tridecyl ester21762168ndRI, MS
20Linoleic acid2183212812.76RI, MS
21Oxacycloheptadec-8-en-2-one22462206tRI, MS
22cis-10-Nonadecenoic acid22742225tRI, MS
23Cyclohexanecarboxylic acid, 2-tetradecyl ester22752267ndRI, MS
242-cis,cis-9,12-Octadecadienyloxyethanol23442344tRI, MS
259-Decenyl laurate23652365ndRI, MS
26cis-11-Eicosenoic acid2374236213.48RI, MS
27Erucic acid257225460.23RI, MS
28cis-13,16-Docasadienoic acid25802566tRI, MS
29Isocaryophyllene143414272.67RI, MS
RI: Retention index, LRI: Literature retention index, t: Trace (<0.05%), nd: not detected, MS: Mass spectrometry (GC/MS).
Table
Table 6. Total phenol content (TPC), total flavonoid content (TFC) and free radical scavenging capacity (DPPH) from basil, black seeds and lavender EOs.
Table 6. Total phenol content (TPC), total flavonoid content (TFC) and free radical scavenging capacity (DPPH) from basil, black seeds and lavender EOs.
PhytochemistryBasilBlack SeedsLavender
TPC (mg GAE/g)31.417.823.4
TFC (mg RE/g)17.69.712.5
DPPH (%)18.916.411.2
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Al-Harbi, N.A.; Al Attar, N.M.; Hikal, D.M.; Mohamed, S.E.; Abdel Latef, A.A.H.; Ibrahim, A.A.; Abdein, M.A. Evaluation of Insecticidal Effects of Plants Essential Oils Extracted from Basil, Black Seeds and Lavender against Sitophilus oryzae. Plants 2021, 10, 829. https://doi.org/10.3390/plants10050829

AMA Style

Al-Harbi NA, Al Attar NM, Hikal DM, Mohamed SE, Abdel Latef AAH, Ibrahim AA, Abdein MA. Evaluation of Insecticidal Effects of Plants Essential Oils Extracted from Basil, Black Seeds and Lavender against Sitophilus oryzae. Plants. 2021; 10(5):829. https://doi.org/10.3390/plants10050829

Chicago/Turabian Style

Al-Harbi, Nadi Awad, Nagy M. Al Attar, Dalia M. Hikal, Salwa E. Mohamed, Arafat Abdel Hamed Abdel Latef, Amira A. Ibrahim, and Mohamed A. Abdein. 2021. "Evaluation of Insecticidal Effects of Plants Essential Oils Extracted from Basil, Black Seeds and Lavender against Sitophilus oryzae" Plants 10, no. 5: 829. https://doi.org/10.3390/plants10050829

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop