Wheat (Triticum aestivum L.) TaHMW1D Transcript Variants Are Highly Expressed in Response to Heat Stress and in Grains Located in Distal Part of the Spike
Abstract
:1. Introduction
2. Results
2.1. Analysis of High-Molecular Weight Glutenin Subunits (HMW-GS)
2.2. Gluten Analysis by 2DE-PAGE
2.3. Peptide Analysis of Selected Glutenin Spots
2.4. Sequence Analysis of TraesCS1D02G317301 (TaHMW1D)
2.5. Analysis of Transcript Variants
2.6. Expression Analysis of Transcript Variants Measured by qRT-PCR
3. Discussion
4. Methods
4.1. Plant Materials and Growth Conditions
4.2. Extraction and Fractionation of Gluten Protein
4.3. Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis (SDS-PAGE)
4.4. Two-Dimensional Gel Electrophoresis (2DE)
4.5. Image Analysis
4.6. Mass Spectrometry
4.7. Genomic DNA Extraction
4.8. RNA Extraction and cDNA Synthesis
4.9. Isolation and Sequencing of a Wheat HMW-GS Genes
4.10. Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR) Analysis
4.11. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ortiz, R.; Braun, H.-J.; Crossa, J.; Crouch, J.H.; Davenport, G.; Dixon, J.; Dreisigacker, S.; Duveiller, E.; He, Z.; Huerta, J. Wheat genetic resources enhancement by the International Maize and Wheat Improvement Center (CIMMYT). Genet. Resour. Crop Evol. 2008, 55, 1095–1140. [Google Scholar] [CrossRef]
- Godden, D.; Batterham, R.; Drynan, R. Climate change and Australian wheat yield. Nature 1998, 391, 447–448. [Google Scholar] [CrossRef]
- Wardlaw, I.; Moncur, L. The response of wheat to high temperature following anthesis. I. The rate and duration of kernel filling. Funct. Plant Biol. 1995, 22, 391–397. [Google Scholar] [CrossRef]
- Ko, C.S.; Kim, J.-B.; Hong, M.J.; Kim, K.H.; Seo, Y.W. Transcript Analysis of Wheat WAS-2 Gene Family under High Temperature Stress during Ripening Period. Plant Breed. Biotechnol. 2018, 6, 363–380. [Google Scholar] [CrossRef]
- Cao, Z.; Yao, X.; Liu, H.; Liu, B.; Cheng, T.; Tian, Y.; Cao, W.; Zhu, Y. Comparison of the abilities of vegetation indices and photosynthetic parameters to detect heat stress in wheat. Agric. For. Meteorol. 2019, 265, 121–136. [Google Scholar] [CrossRef]
- Zafar, S.A.; Hameed, A.; Ashraf, M.; Khan, A.S.; Li, X.; Siddique, K.H. Agronomic, physiological and molecular characterisation of rice mutants revealed the key role of reactive oxygen species and catalase in high-temperature stress tolerance. Funct. Plant Biol. 2020, 47, 440–453. [Google Scholar] [CrossRef] [PubMed]
- Suriyasak, C.; Harano, K.; Tanamachi, K.; Matsuo, K.; Tamada, A.; Iwaya-Inoue, M.; Ishibashi, Y. Reactive oxygen species induced by heat stress during grain filling of rice (Oryza sativa L.) are involved in occurrence of grain chalkiness. J. Plant Physiol. 2017, 216, 52–57. [Google Scholar] [CrossRef]
- Grover, D.; Singh, J. Post-harvest losses in wheat crop in Punjab: Past and present. Agric. Econ. Res. Rev. 2013, 26, 293–297. [Google Scholar]
- Philipp, N.; Weichert, H.; Bohra, U.; Weschke, W.; Schulthess, A.W.; Weber, H. Grain number and grain yield distribution along the spike remain stable despite breeding for high yield in winter wheat. PLoS ONE 2018, 13, e0205452. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Cui, Z.; Ni, Y.; Zheng, M.; Yang, D.; Jin, M.; Chen, J.; Wang, Z.; Yin, Y. Plant density effect on grain number and weight of two winter wheat cultivars at different spikelet and grain positions. PLoS ONE 2016, 11, e0155351. [Google Scholar] [CrossRef]
- Baillot, N.; Girousse, C.; Allard, V.; Piquet-Pissaloux, A.; Le Gouis, J. Different grain-filling rates explain grain-weight differences along the wheat ear. PLoS ONE 2018, 13, e0209597. [Google Scholar] [CrossRef] [PubMed]
- Darlington, H.; Fido, R.; Tatham, A.S.; Jones, H.; Salmon, S.E.; Shewry, P.R. Milling and baking properties of field grown wheat expressing HMW subunit transgenes. J. Cereal Sci. 2003, 38, 301–306. [Google Scholar] [CrossRef]
- Bacala, R.; Fu, B.X.; Perreault, H.; Hatcher, D.W. C-terminal tyrosine removal from wheat low-molecular weight glutenin subunits (LMW-GS); biologically relevant or mistaken substrate? J. Cereal Sci. 2020, 95, 103060. [Google Scholar] [CrossRef]
- Shewry, P.R.; Tatham, A.S. The prolamin storage proteins of cereal seeds: Structure and evolution. Biochem. J. 1990, 267, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dhaka, V.; Khatkar, B. Effects of gliadin/glutenin and HMW-GS/LMW-GS ratio on dough rheological properties and bread-making potential of wheat varieties. J. Food Qual. 2015, 38, 71–82. [Google Scholar] [CrossRef]
- Gianibelli, M.; Larroque, O.; MacRitchie, F.; Wrigley, C. Biochemical, genetic, and molecular characterization of wheat endosperm proteins. Cereal Chem. 2001, 78, 635–646. [Google Scholar] [CrossRef]
- Henkrar, F.; El-Haddoury, J.; Iraqi, D.; Bendaou, N.; Udupa, S.M. Allelic variation at high-molecular weight and low-molecular weight glutenin subunit genes in Moroccan bread wheat and durum wheat cultivars. 3 Biotech 2017, 7, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maruyama-Funatsuki, W.; Takata, K.; Funatsuki, H.; Tabiki, T.; Ito, M.; Nishio, Z.; Kato, A.; Saito, K.; Yahata, E.; Saruyama, H. An LMW-s glutenin gene of a Hard Red Winter wheat is similar to an LMW-s gene of a Canadian Western Extra-strong wheat. Breed. Sci. 2005, 55, 241–246. [Google Scholar] [CrossRef]
- Jouanin, A.; Gilissen, L.J.; Boyd, L.A.; Cockram, J.; Leigh, F.J.; Wallington, E.J.; Van den Broeck, H.C.; Van der Meer, I.M.; Schaart, J.G.; Visser, R.G. Food processing and breeding strategies for coeliac-safe and healthy wheat products. Food Res. Int. 2018, 110, 11–21. [Google Scholar] [CrossRef] [Green Version]
- Graziano, S.; Marando, S.; Prandi, B.; Boukid, F.; Marmiroli, N.; Francia, E.; Pecchioni, N.; Sforza, S.; Visioli, G.; Gullì, M. Technological quality and nutritional value of two durum wheat varieties depend on both genetic and environmental factors. J. Agric. Food Chem. 2019, 67, 2384–2395. [Google Scholar] [CrossRef]
- Labuschagne, M.; Masci, S.; Tundo, S.; Muccilli, V.; Saletti, R.; van Biljon, A. Proteomic analysis of proteins responsive to drought and low temperature stress in a hard red spring wheat cultivar. Molecules 2020, 25, 1366. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.-F.; Wu, Y.; Hernandez-Espinosa, N.; Peña, R.J. Heat and drought stress on durum wheat: Responses of genotypes, yield, and quality parameters. J. Cereal Sci. 2013, 57, 398–404. [Google Scholar] [CrossRef]
- Zhang, X.; Cai, J.; Wollenweber, B.; Liu, F.; Dai, T.; Cao, W.; Jiang, D. Multiple heat and drought events affect grain yield and accumulations of high molecular weight glutenin subunits and glutenin macropolymers in wheat. J. Cereal Sci. 2013, 57, 134–140. [Google Scholar] [CrossRef]
- Yu, Z.; Peng, Y.; Islam, M.S.; She, M.; Lu, M.; Lafiandra, D.; Roy, N.; Juhasz, A.; Yan, G.; Ma, W. Molecular characterization and phylogenetic analysis of active y-type high molecular weight glutenin subunit genes at Glu-A1 locus in wheat. J. Cereal Sci. 2019, 86, 9–14. [Google Scholar] [CrossRef]
- Richards, R.I.; Sutherland, G.R. Simple repeat DNA is not replicated simply. Nat. Genet. 1994, 6, 114–116. [Google Scholar] [CrossRef] [PubMed]
- Borrow, J.; Dyer, S.A.; Akiki, S.; Griffiths, M.J. Terminal deoxynucleotidyl transferase promotes acute myeloid leukemia by priming FLT3-ITD replication slippage. Blood J. Am. Soc. Hematol. 2019, 134, 2281–2290. [Google Scholar] [CrossRef]
- Sharma, M.; Pandey, G.K. Expansion and function of repeat domain proteins during stress and development in plants. Front. Plant Sci. 2016, 6, 1218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Szakonyi, D.; Duque, P. Alternative splicing as a regulator of early plant development. Front. Plant Sci. 2018, 9, 1174. [Google Scholar] [CrossRef] [Green Version]
- Blanchard, A.A.; Zelinski, T.; Xie, J.; Cooper, S.; Penner, C.; Leygue, E.; Myal, Y. Identification of claudin 1 transcript variants in human invasive breast cancer. PLoS ONE 2016, 11, e0163387. [Google Scholar] [CrossRef] [Green Version]
- Xu, X.; Liu, D.; Ji, N.; Li, T.; Li, L.; Jiang, L.; Li, J.; Zhang, P.; Zeng, X.; Chen, Q. A novel transcript variant of proteasome activator 28γ: Identification and function in oral cancer cells. Int. J. Oncol. 2015, 47, 188–194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hojny, J.; Bartu, M.; Krkavcova, E.; Nemejcova, K.; Sevcik, J.; Cibula, D.; Fryba, V.; Plincelnerova, L.; Dundr, P.; Struzinska, I. Identification of novel HNF1B mRNA splicing variants and their qualitative and semi-quantitative profile in selected healthy and tumour tissues. Sci. Rep. 2020, 10, 1–11. [Google Scholar]
- Kazan, K. Alternative splicing and proteome diversity in plants: The tip of the iceberg has just emerged. Trends Plant Sci. 2003, 8, 468–471. [Google Scholar] [CrossRef] [PubMed]
- Hassan, S.; Lethin, J.; Blomberg, R.; Mousavi, H.; Aronsson, H. In silico based screening of WRKY genes for identifying functional genes regulated by WRKY under salt stress. Comput. Biol. Chem. 2019, 83, 107131. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Qin, J.; Tian, X.; Xu, S.; Wang, Y.; Li, H.; Wang, X.; Peng, H.; Yao, Y.; Hu, Z. Global profiling of alternative splicing landscape responsive to drought, heat and their combination in wheat (Triticum aestivum L.). Plant Biotechnol. J. 2018, 16, 714–726. [Google Scholar] [CrossRef] [Green Version]
- Andrási, N.; Pettkó-Szandtner, A.; Szabados, L. Diversity of plant heat shock factors: Regulation, interactions, and functions. J. Exp. Bot. 2021, 72, 1558–1575. [Google Scholar] [CrossRef] [PubMed]
- Gulledge, A.A.; Roberts, A.D.; Vora, H.; Patel, K.; Loraine, A.E. Mining Arabidopsis thaliana RNA-seq data with integrated genome browser reveals stress-induced alternative splicing of the putative splicing regulator SR45a. Am. J. Bot. 2012, 99, 219–231. [Google Scholar] [CrossRef]
- Dworschak, R.G.; Ens, W.; Standing, K.G.; Preston, K.R.; Marchylo, B.A.; Nightingale, M.J.; Stevenson, S.G.; Hatcher, D.W. Analysis of wheat gluten proteins by matrix-assisted laser desorption/ionization mass spectrometry. J. Mass Spectrom. 1998, 33, 429–435. [Google Scholar] [CrossRef]
- Karaduman, Y. Assessing gluten strength with a new small-scale LASRC method useful for soft wheat breeding programs. Cereal Chem. 2020, 97, 196–204. [Google Scholar] [CrossRef]
- Montagner Souza, T.; de Miranda, M.Z.; Mateus Prando, A.; Tilley, M.; Payton, M.E.; Rayas-Duarte, P. Gluten viscoelasticity: Rapid method for classification of soft-like wheat genotypes. Cereal Chem. 2019, 96, 167–181. [Google Scholar] [CrossRef] [Green Version]
- Rasheed, A.; Xia, X.; Yan, Y.; Appels, R.; Mahmood, T.; He, Z. Wheat seed storage proteins: Advances in molecular genetics, diversity and breeding applications. J. Cereal Sci. 2014, 60, 11–24. [Google Scholar] [CrossRef] [Green Version]
- Sissons, M.; Pleming, D.; Sestili, F.; Lafiandra, D. Effect of Glu-D1 gene introgression and amylose content on breadmaking potential of blends of durum and hexaploid wheat. Cereal Chem. 2019, 96, 193–206. [Google Scholar] [CrossRef]
- Shewry, P.R.; Powers, S.; Field, J.M.; Fido, R.J.; Jones, H.D.; Arnold, G.M.; West, J.; Lazzeri, P.A.; Barcelo, P.; Barro, F. Comparative field performance over 3 years and two sites of transgenic wheat lines expressing HMW subunit transgenes. Theor. Appl. Genet. 2006, 113, 128–136. [Google Scholar] [CrossRef]
- Mao, X.; Li, Y.; Zhao, S.; Zhang, J.; Lei, Q.; Meng, D.; Ma, F.; Hu, W.; Chen, M.; Chang, J. The interactive effects of transgenically overexpressed 1Ax1 with various HMW-GS combinations on dough quality by introgression of exogenous subunits into an elite Chinese wheat variety. PLoS ONE 2013, 8, e78451. [Google Scholar] [CrossRef] [PubMed]
- DuPont, F.M.; Altenbach, S.B. Molecular and biochemical impacts of environmental factors on wheat grain development and protein synthesis. J. Cereal Sci. 2003, 38, 133–146. [Google Scholar] [CrossRef]
- Don, C.; Lookhart, G.; Naeem, H.; MacRitchie, F.; Hamer, R.J. Heat stress and genotype affect the glutenin particles of the glutenin macropolymer-gel fraction. J. Cereal Sci. 2005, 42, 69–80. [Google Scholar] [CrossRef]
- Sugiyama, T.; Rafalski, A.; Peterson, D.; Söll, D. A wheat HMW glutenin subunit gene reveals a highly repeated structure. Nucleic Acids Res. 1985, 13, 8729–8737. [Google Scholar] [CrossRef] [Green Version]
- Huo, N.; Zhu, T.; Altenbach, S.; Dong, L.; Wang, Y.; Mohr, T.; Liu, Z.; Dvorak, J.; Luo, M.-C.; Gu, Y.Q. Dynamic evolution of α-gliadin prolamin gene family in homeologous genomes of hexaploid wheat. Sci. Rep. 2018, 8, 5181. [Google Scholar] [CrossRef] [PubMed]
- Feldman, M.; Levy, A.A. Genome evolution due to allopolyploidization in wheat. Genetics 2012, 192, 763–774. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gemayel, R.; Cho, J.; Boeynaems, S.; Verstrepen, K.J. Beyond junk-variable tandem repeats as facilitators of rapid evolution of regulatory and coding sequences. Genes 2012, 3, 461–480. [Google Scholar] [CrossRef] [Green Version]
- Murray, J.I.; Voelker, R.B.; Henscheid, K.L.; Warf, M.B.; Berglund, J.A. Identification of motifs that function in the splicing of non-canonical introns. Genome Biol. 2008, 9, R97. [Google Scholar] [CrossRef] [Green Version]
- Shewry, P.R.; Halford, N.G.; Tatham, A.S.; Popineau, Y.; Lafiandra, D.; Belton, P.S. The high molecular weight subunits of wheat glutenin and their role in determining wheat processing properties. Adv. Food Nutr. Res. 2003, 45, 219–302. [Google Scholar] [PubMed]
- Tsukaguchi, T.; Tanaka, R.; Inoue, H.; Nakagawa, H. Effects of high temperature and shading on grain abscisic acid content and grain filling pattern in rice (Oryza sativa L.). Plant Prod. Sci. 2018, 21, 407–412. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.; Zhang, J.; Liu, K.; Wang, Z.; Liu, L. Abscisic acid and ethylene interact in wheat grains in response to soil drying during grain filling. New Phytol. 2006, 171, 293–303. [Google Scholar] [CrossRef] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef]
- Oakley, B.R.; Kirsch, D.R.; Morris, N.R. A simplified ultrasensitive silver stain for detecting proteins in polyacrylamide gels. Anal. Biochem. 1980, 105, 361–363. [Google Scholar] [CrossRef]
- Doyle, J. DNA protocols for plants. In Molecular Techniques in Taxonomy; Springer: Berlin, Germany, 1991; pp. 283–293. [Google Scholar]
- Meng, L.; Feldman, L. A Rapid TRIzol-Based Two-Step Method for DNA-Free RNA Extraction from Arabidopsis Siliques and Dry Seeds; 1860–6768; Wiley Online Library: Hoboken, NJ, USA, 2010. [Google Scholar]
Protein Name | Protein Mass (Da) | Total Matching Score | Matches Number | Protein Information (NCBI Data) | Highest Identity (Plants Ensemble) | Identity (%) |
---|---|---|---|---|---|---|
AAF37838.1 | 19,968 | 120 | 11 | y-type high molecular weight glutenin subunit, partial [Aegilops ventricosa] | TraesCS1D02G317301 | 100 |
AAP73788.1 | 37,935 | 64 | 8 | y-type HMW glutenin subunit, partial [Triticum spelta] | TraesCS1D02G317301 | 100 |
AAP73790.1 | 37,940 | 64 | 8 | y-type HMW glutenin subunit, partial [Triticum compactum] | TraesCS1D02G317301 | 100 |
AAR04373.1 | 47,810 | 57 | 8 | high molecular weight glutenin subunit type y [Aegilops tauschii] | TraesCS1D02G317301 | 99.30 |
AAT06762.1 | 27,382 | 124 | 12 | HMW glutenin subunit Dy10 [Aegilops tauschii] | TraesCS1D02G317301 | 100 |
ABF82252.1 | 89,645 | 223 | 25 | high molecular weight glutenin subunit [Triticum aestivum] | TraesCS1D02G317301 | 93 |
ABK54365.1 | 88,693 | 82 | 9 | high molecular weight glutenin subunit [Triticum aestivum] | TraesCS1D02G317301 | 100 |
ABN71647.1 | 32,308 | 68 | 8 | truncated high molecular weight glutenin subunit 1By9 [Triticum aestivum subsp. tibeticum] | TraesCS1D02G317301 | 100 |
ACL82342.1 | 17,566 | 125 | 11 | high molecular weight glutenin y-type, partial [Triticum aestivum] | TraesCS1D02G317301 | 99.30 |
ACZ49742.1 | 91,648 | 328 | 31 | high molecular weight glutenin subunit Ax-dp, partial [Triticum polonicum] | TraesCS1A02G317311 | 99.10 |
ADY38692.1 | 90,025 | 258 | 27 | high-molecular-weight glutenin subunit [Secale cereale x Triticum aestivum] | TraesCS1D02G317301 | 92.3 |
ADY38693.1 | 66,498 | 121 | 14 | high-molecular-weight glutenin subunit [Secale cereale x Triticum aestivum] | TraesCS1D02G317301 | 92.3 |
ADY38695.1 | 65,788 | 122 | 14 | high-molecular-weight glutenin subunit [Secale cereale x Triticum aestivum] | TraesCS1D02G317301 | 92.3 |
ADY38698.1 | 64,245 | 123 | 14 | high-molecular-weight glutenin subunit [Secale cereale x Triticum aestivum] | TraesCS1D02G317301 | 99.3 |
ADY38699.1 | 66,442 | 122 | 14 | high-molecular-weight glutenin subunit [Secale cereale x Triticum aestivum] | TraesCS1D02G317301 | 92.3 |
ADY38701.1 | 63,448 | 124 | 14 | high-molecular-weight glutenin subunit [Secale cereale x Triticum aestivum] | TraesCS1D02G317301 | 92.3 |
ADY38705.1 | 64,840 | 296 | 27 | high-molecular-weight glutenin subunit [Secale cereale x Triticum aestivum] | TraesCS1D02G317301 | 90.9 |
ADY38706.1 | 66,308 | 293 | 27 | high-molecular-weight glutenin subunit [Secale cereale x Triticum aestivum] | TraesCS1D02G317301 | 92.3 |
ADY38717.1 | 63,738 | 124 | 14 | high-molecular-weight glutenin subunit [Secale cereale x Triticum aestivum] | TraesCS1D02G317301 | 92.3 |
ADY38718.1 | 64,758 | 209 | 22 | high-molecular-weight glutenin subunit [Secale cereale x Triticum aestivum] | TraesCS1D02G317301 | 92.3 |
AEO19857.1 | 93,820 | 254 | 27 | high molecular weight glutenin subunit [Triticum aestivum] | TraesCS1D02G317301 | 99.3 |
AHZ62762.1 | 90,009 | 258 | 27 | high molecular weight glutenin subunit 1Ax1 [Triticum aestivum] | TraesCS1A02G317311 | 100 |
AKW50839.1 | 90,741 | 300 | 29 | high molecular weight glutenin subunit [Triticum aestivum] | TraesCS1D02G317301 | 98 |
AKW50840.1 | 90,254 | 126 | 16 | high molecular weight glutenin subunit [Triticum dicoccoides] | TraesCS1D02G317301 | 100 |
AKW50841.1 | 90,291 | 126 | 16 | high molecular weight glutenin subunit [Triticum aestivum] | TraesCS1D02G317301 | 100 |
AKW50842.1 | 90,042 | 209 | 24 | high molecular weight glutenin subunit [Triticum aestivum] | TraesCS1D02G317301 | 100 |
ANJ03342.1 | 90,244 | 136 | 16 | HMW-GS protein [Triticum dicoccoides] | TraesCS1D02G317301 | 100 |
BAJ85955.1 | 13,150 | 52 | 4 | predicted protein [Hordeum vulgare subsp. vulgare] | No match | |
BAN29068.1 | 86,558 | 335 | 31 | high molecular weight glutenin subunit, partial [Triticum aestivum] | TraesCS1D02G317211 | 100 |
BAN82580.1 | 89,546 | 223 | 25 | high-molecular-weight glutenin subunit [Triticum aestivum] | TraesCS1D02G317301 | 100 |
BAS99197.1 | 8,082 | 52 | 3 | Os06g0686900 [Oryza sativa Japonica Group] | TraesCS7B02G345400 | 86.40 |
CAA43331.1 | 89,993 | 258 | 27 | high molecular weight glutenin subunit 1Ax1 [Triticum aestivum] | TraesCS1A02G317311 | 99 |
CAC84118.1 | 21,859 | 198 | 16 | glutenin high molecular weight subunit, partial [Triticum aestivum] | TraesCS1D02G317301 | 100 |
CAC84120.1 | 20,193 | 56 | 4 | glutenin high molecular weight subunit, partial [Triticum aestivum] | TraesCS1D02G317301 | 98.60 |
EAZ38071.1 | 7,841 | 53 | 3 | hypothetical protein OsJ_22417 [Oryza sativa Japonica Group] | TraesCS7B02G345400 | 86.40 |
EMS67071.1 | 90,299 | 108 | 13 | Glutenin, high molecular weight subunit DX5 [Triticum urartu] | TraesCS1D02G317301 | 100 |
POF00734.1 | 14,483 | 54 | 4 | No match | ||
XP_002879350.1 | 16,644 | 52 | 4 | uncharacterized protein LOC9317273 [Arabidopsis lyrata subsp. lyrata] | No match | |
XP_007513787.1 | 26,443 | 53 | 4 | hypothetical protein Bathy04g00280 [Bathycoccus prasinos] | No match | |
XP_020873876.1 | 16,658 | 52 | 4 | uncharacterized protein LOC9299019 [Arabidopsis lyrata subsp. lyrata] | No match |
Repeated Sequence | Position | Length |
---|---|---|
AGCTTCTCAGCAGCAGCCAGGACAAGGGCAACAAGGGCACTACCCAGCTTCTCAGCAGCAGCCAGGACAAGGGCAACAAGGGCACTACCCAGCTTCTCAGCA | 844 | 102 |
CAGGACAAAGGCAACAACCAGGACAAGGGCAACATCCAGAACAAGGG | 320, 1082 | 47 |
AAGGGCAACAAGGGTACTACCCAACTTCTCTGCAGCA | 236, 281 | 37 |
AGGACAAGGGCAACAAGGGTACTACCCAACTTCTCT | 276, 978 | 36 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ko, C.S.; Kim, J.-B.; Hong, M.J.; Seo, Y.W. Wheat (Triticum aestivum L.) TaHMW1D Transcript Variants Are Highly Expressed in Response to Heat Stress and in Grains Located in Distal Part of the Spike. Plants 2021, 10, 687. https://doi.org/10.3390/plants10040687
Ko CS, Kim J-B, Hong MJ, Seo YW. Wheat (Triticum aestivum L.) TaHMW1D Transcript Variants Are Highly Expressed in Response to Heat Stress and in Grains Located in Distal Part of the Spike. Plants. 2021; 10(4):687. https://doi.org/10.3390/plants10040687
Chicago/Turabian StyleKo, Chan Seop, Jin-Baek Kim, Min Jeong Hong, and Yong Weon Seo. 2021. "Wheat (Triticum aestivum L.) TaHMW1D Transcript Variants Are Highly Expressed in Response to Heat Stress and in Grains Located in Distal Part of the Spike" Plants 10, no. 4: 687. https://doi.org/10.3390/plants10040687