CRISPR/Cas9-Targeted Myostatin Deletion Improves the Myogenic Differentiation Parameters for Muscle-Derived Stem Cells in Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. CRISPR/Cas9 Mstn Editing
2.3. Cell Viability Assay
2.4. Sulforhodamine B Assay (SRB)
2.5. Myogenic Differentiation
2.6. RT-qPCR
2.7. Phalloidin Staining
2.8. Immunocytochemistry
2.9. Statistical Analysis
3. Results
3.1. Myostatin Loci Targeting and Editing Using CRISPR/Cas9
3.2. Assessment of Cell Viability in the Mstn−/− Cells
3.3. Assessment of the Myogenic Relative Gene Expression in the Mstn−/− Cells
3.4. Evaluation of the Myogenic Differentiation Using Immunocytochemistry
3.5. Morphometric Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
MSCs | Skeletal muscle-derived stem cells |
PF | Proliferation condition |
DF | Differentiation condition |
MyoD | Myogenic determinant factor 1 |
MRF4 | Myogenic regulatory factor 4 |
Pax7 | Paired-box transcription factor 7 |
SRB | Sulforhodamine B |
MTT | (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) cell viability assay |
ActRIIb | Activin receptor type 2b |
FGFs | Fibroblast growth factors |
TGF-β | Transforming growth factor-beta |
HGF | Hepatocyte growth factor |
TNF-α | Tumor necrosis growth factor-alpha |
IL-6 | Interleukin-6 |
MyF5 | Myogenic regulatory factor 5 |
MyH1 | Myosin heavy chain 1 |
MyH2 | Myosin heavy chain 2 |
MyH7 | Myosin heavy chain 7 |
GDF-8 | Growth and differentiation factor-8 |
GDF-11 | Growth and differentiation factor-11 |
pAMPK | phosphorylated adenosine monophosphate-activated protein kinase |
SIRT1 | silent information regulator-1 |
PGC1α | peroxisome proliferator-activated receptor γ coactivator 1α |
IGF-I | Insulin growth factor-I |
mTOR | Mammalian target of Rapamycin |
References
- Muscaritoli, M.; Anker, S.D.; Argilés, J.; Aversa, Z.; Bauer, J.M.; Biolo, G.; Boirie, Y.; Bosaeus, I.; Cederholm, T.; Costelli, P.; et al. Consensus definition of sarcopenia, cachexia and pre-cachexia: Joint document elaborated by Special Interest Groups (SIG) “cachexia-anorexia in chronic wasting diseases” and “nutrition in geriatrics”. Clin. Nutr. 2010, 29, 154–159. [Google Scholar] [CrossRef] [PubMed]
- Ogino, S.; Leonard, D.G.B.; Rennert, H.; Wilson, R.B. Spinal muscular atrophy genetic testing experience at an academic medical center. J. Mol. Diagn. 2002, 4, 53–58. [Google Scholar] [CrossRef]
- Cohen, S.; Nathan, J.A.; Goldberg, A.L. Muscle wasting in disease: Molecular mechanisms and promising therapies. Nat. Rev. Drug Discov. 2015, 14, 58–74. [Google Scholar] [CrossRef]
- Muir, L.A.; Chamberlain, J.S. Emerging strategies for cell and gene therapy of the muscular dystrophies. Expert Rev. Mol. Med. 2009, 11, e18. [Google Scholar] [CrossRef] [PubMed]
- Batchelor, C.L.; Winder, S.J. Sparks, signals and shock absorbers: How dystrophin loss causes muscular dystrophy. Trends Cell Biol. 2006, 16, 198–205. [Google Scholar] [CrossRef] [PubMed]
- Mauro, A. Satellite cell of skeletal muscle fibers. J. Biophys. Biochem. Cytol. 1961, 9, 493–495. [Google Scholar] [CrossRef] [PubMed]
- Asakura, A.; Komaki, M.; Rudnicki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation 2001, 68, 245–253. [Google Scholar] [CrossRef] [PubMed]
- Chargé, S.B.P.; Rudnicki, M.A. Cellular and molecular regulation of muscle regeneration. Physiol. Rev. 2004, 84, 209–238. [Google Scholar] [CrossRef] [PubMed]
- Yablonka-Reuveni, Z.; Rivera, A.J. Temporal expression of regulatory and structural muscle proteins during myogenesis of satellite cells on isolated adult rat fibers. Dev. Biol. 1994, 164, 588–603. [Google Scholar] [CrossRef]
- Smith, C.K.; Janney, M.J.; Allen, R.E. Temporal expression of myogenic regulatory genes during activation, proliferation, and differentiation of rat skeletal muscle satellite cells. J. Cell. Physiol. 1994, 159, 379–385. [Google Scholar] [CrossRef]
- Zammit, P.S.; Golding, J.P.; Nagata, Y.; Hudon, V.; Partridge, T.A.; Beauchamp, J.R. Muscle satellite cells adopt divergent fates: A mechanism for self-renewal? J. Cell Biol. 2004, 166, 347–357. [Google Scholar] [CrossRef] [PubMed]
- Hurme, T.; Kalimo, H. Activation of myogenic precursor cells after muscle injury. Med. Sci. Sports Exerc. 1992, 24, 197–205. [Google Scholar] [CrossRef]
- Beyer, T.A.; Narimatsu, M.; Weiss, A.; David, L.; Wrana, J.L. The TGFβ superfamily in stem cell biology and early mammalian embryonic development. Biochim. Biophys. Acta 2013, 1830, 2268–2279. [Google Scholar] [CrossRef]
- Amthor, H.; Huang, R.; McKinnell, I.; Christ, B.; Kambadur, R.; Sharma, M.; Patel, K. The regulation and action of myostatin as a negative regulator of muscle development during avian embryogenesis. Dev. Biol. 2002, 251, 241–257. [Google Scholar] [CrossRef]
- Anderson, S.B.; Goldberg, A.L.; Whitman, M. Identification of a novel pool of extracellular pro-myostatin in skeletal muscle. J. Biol. Chem. 2008, 283, 7027–7035. [Google Scholar] [CrossRef]
- McFarlane, C.; Langley, B.; Thomas, M.; Hennebry, A.; Plummer, E.; Nicholas, G.; McMahon, C.; Sharma, M.; Kambadur, R. Proteolytic processing of myostatin is auto-regulated during myogenesis. Dev. Biol. 2005, 283, 58–69. [Google Scholar] [CrossRef] [PubMed]
- McCroskery, S.; Thomas, M.; Maxwell, L.; Sharma, M.; Kambadur, R. Myostatin negatively regulates satellite cell activation and self-renewal. J. Cell Biol. 2003, 162, 1135–1147. [Google Scholar] [CrossRef]
- Mosher, D.S.; Quignon, P.; Bustamante, C.D.; Sutter, N.B.; Mellersh, C.S.; Parker, H.G.; Ostrander, E.A. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet. 2007, 3, e79. [Google Scholar] [CrossRef] [PubMed]
- Kijas, J.W.; McCulloch, R.; Edwards, J.E.H.; Oddy, V.H.; Lee, S.H.; van der Werf, J. Evidence for multiple alleles effecting muscling and fatness at the ovine GDF8 locus. BMC Genet. 2007, 8, 80. [Google Scholar] [CrossRef]
- Grobet, L.; Martin, L.J.; Poncelet, D.; Pirottin, D.; Brouwers, B.; Riquet, J.; Schoeberlein, A.; Dunner, S.; Ménissier, F.; Massabanda, J.; et al. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat. Genet. 1997, 17, 71–74. [Google Scholar] [CrossRef]
- Dall’Olio, S.; Fontanesi, L.; Nanni Costa, L.; Tassinari, M.; Minieri, L.; Falaschini, A. Analysis of horse myostatin gene and identification of single nucleotide polymorphisms in breeds of different morphological types. J. Biomed. Biotechnol. 2010, 2010, 542945. [Google Scholar] [CrossRef]
- Stinckens, A.; Luyten, T.; Bijttebier, J.; van den Maagdenberg, K.; Dieltiens, D.; Janssens, S.; de Smet, S.; Georges, M.; Buys, N. Characterization of the complete porcine MSTN gene and expression levels in pig breeds differing in muscularity. Anim. Genet. 2008, 39, 586–596. [Google Scholar] [CrossRef]
- Schuelke, M.; Wagner, K.R.; Stolz, L.E.; Hübner, C.; Riebel, T.; Kömen, W.; Braun, T.; Tobin, J.F.; Lee, S.-J. Myostatin mutation associated with gross muscle hypertrophy in a child. N. Engl. J. Med. 2004, 350, 2682–2688. [Google Scholar] [CrossRef]
- Amthor, H.; Nicholas, G.; McKinnell, I.; Kemp, C.F.; Sharma, M.; Kambadur, R.; Patel, K. Follistatin complexes Myostatin and antagonises Myostatin-mediated inhibition of myogenesis. Dev. Biol. 2004, 270, 19–30. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.J.; McPherron, A.C. Regulation of myostatin activity and muscle growth. Proc. Natl. Acad. Sci. USA 2001, 98, 9306–9311. [Google Scholar] [CrossRef] [PubMed]
- Wolfman, N.M.; McPherron, A.C.; Pappano, W.N.; Davies, M.V.; Song, K.; Tomkinson, K.N.; Wright, J.F.; Zhao, L.; Sebald, S.M.; Greenspan, D.S.; et al. Activation of latent myostatin by the BMP-1/tolloid family of metalloproteinases. Proc. Natl. Acad. Sci. USA 2003, 100, 15842–15846. [Google Scholar] [CrossRef] [PubMed]
- Thies, R.S.; Chen, T.; Davies, M.V.; Tomkinson, K.N.; Pearson, A.A.; Shakey, Q.A.; Wolfman, N.M. GDF-8 propeptide binds to GDF-8 and antagonizes biological activity by inhibiting GDF-8 receptor binding. Growth Factors 2001, 18, 251–259. [Google Scholar] [CrossRef]
- Kemaladewi, D.U.; Hoogaars, W.M.H.; van Heiningen, S.H.; Terlouw, S.; de Gorter, D.J.J.; den Dunnen, J.T.; van Ommen, G.J.B.; Aartsma-Rus, A.; ten Dijke, P.; Hoen, P.A. Dual exon skipping in myostatin and dystrophin for Duchenne muscular dystrophy. BMC Med. Genom. 2011, 4, 36. [Google Scholar] [CrossRef]
- Kang, J.K.; Malerba, A.; Popplewell, L.; Foster, K.; Dickson, G. Antisense-induced myostatin exon skipping leads to muscle hypertrophy in mice following octa-guanidine morpholino oligomer treatment. Mol. Ther. 2011, 19, 159–164. [Google Scholar] [CrossRef] [PubMed]
- Dumonceaux, J.; Marie, S.; Beley, C.; Trollet, C.; Vignaud, A.; Ferry, A.; Butler-Browne, G.; Garcia, L. Combination of myostatin pathway interference and dystrophin rescue enhances tetanic and specific force in dystrophic mdx mice. Mol. Ther. 2010, 18, 881–887. [Google Scholar] [CrossRef] [PubMed]
- Wagner, K.R.; McPherron, A.C.; Winik, N.; Lee, S.-J. Loss of myostatin attenuates severity of muscular dystrophy in mdx mice. Ann. Neurol. 2002, 52, 832–836. [Google Scholar] [CrossRef] [PubMed]
- Deveau, H.; Garneau, J.E.; Moineau, S. CRISPR/Cas system and its role in phage-bacteria interactions. Annu. Rev. Microbiol. 2010, 64, 475–493. [Google Scholar] [CrossRef]
- Horvath, P.; Barrangou, R. CRISPR/Cas, the immune system of bacteria and archaea. Science 2010, 327, 167–170. [Google Scholar] [CrossRef]
- Karginov, F.V.; Hannon, G.J. The CRISPR system: Small RNA-guided defense in bacteria and archaea. Mol. Cell 2010, 37, 7–19. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Yu, H.; Lei, A.; Zhou, J.; Zeng, W.; Zhu, H.; Dong, Z.; Niu, Y.; Shi, B.; Cai, B.; et al. Generation of gene-modified goats targeting MSTN and FGF5 via zygote injection of CRISPR/Cas9 system. Sci. Rep. 2015, 5, 13878. [Google Scholar] [CrossRef]
- Han, H.; Ma, Y.; Wang, T.; Lian, L.; Tian, X.; Hu, R.; Deng, S.; Li, K.; Wang, F.; Li, N.; et al. One-step generation of myostatin gene knockout sheep via the CRISPR/Cas9 system. Front. Agr. Sci. Eng. 2014, 1, 2. [Google Scholar] [CrossRef]
- Bi, Y.; Hua, Z.; Liu, X.; Hua, W.; Ren, H.; Xiao, H.; Zhang, L.; Li, L.; Wang, Z.; Laible, G.; et al. Isozygous and selectable marker-free MSTN knockout cloned pigs generated by the combined use of CRISPR/Cas9 and Cre/LoxP. Sci. Rep. 2016, 6, 31729. [Google Scholar] [CrossRef]
- Li, R.; Zeng, W.; Ma, M.; Wei, Z.; Liu, H.; Liu, X.; Wang, M.; Shi, X.; Zeng, J.; Yang, L.; et al. Precise editing of myostatin signal peptide by CRISPR/Cas9 increases the muscle mass of Liang Guang Small Spotted pigs. Transgenic Res. 2020, 29, 149–163. [Google Scholar] [CrossRef]
- Lv, Q.; Yuan, L.; Deng, J.; Chen, M.; Wang, Y.; Zeng, J.; Li, Z.; Lai, L. Efficient Generation of Myostatin Gene Mutated Rabbit by CRISPR/Cas9. Sci. Rep. 2016, 6, 25029. [Google Scholar] [CrossRef]
- Xu, K.; Han, C.X.; Zhou, H.; Ding, J.M.; Xu, Z.; Yang, L.Y.; He, C.; Akinyemi, F.; Zheng, Y.M.; Qin, C.; et al. Effective MSTN Gene Knockout by AdV-Delivered CRISPR/Cas9 in Postnatal Chick Leg Muscle. Int. J. Mol. Sci. 2020, 21, 2584. [Google Scholar] [CrossRef]
- Naito, Y.; Hino, K.; Bono, H.; Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics 2015, 31, 1120–1123. [Google Scholar] [CrossRef]
- Orellana, E.A.; Kasinski, A.L. Sulforhodamine B (SRB) Assay in Cell Culture to Investigate Cell Proliferation. Bio Protoc. 2016, 6, e1984. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Bogdanovich, S.; Krag, T.O.B.; Barton, E.R.; Morris, L.D.; Whittemore, L.-A.; Ahima, R.S.; Khurana, T.S. Functional improvement of dystrophic muscle by myostatin blockade. Nature 2002, 420, 418–421. [Google Scholar] [CrossRef]
- Stolz, L.E.; Li, D.; Qadri, A.; Jalenak, M.; Klaman, L.D.; Tobin, J.F. Administration of myostatin does not alter fat mass in adult mice. Diabetes Obes. Metab. 2008, 10, 135–142. [Google Scholar] [CrossRef] [PubMed]
- Matsakas, A.; Foster, K.; Otto, A.; Macharia, R.; Elashry, M.I.; Feist, S.; Graham, I.; Foster, H.; Yaworsky, P.; Walsh, F.; et al. Molecular, cellular and physiological investigation of myostatin propeptide-mediated muscle growth in adult mice. Neuromuscul. Disord. 2009, 19, 489–499. [Google Scholar] [CrossRef]
- Morine, K.J.; Bish, L.T.; Pendrak, K.; Sleeper, M.M.; Barton, E.R.; Sweeney, H.L. Systemic myostatin inhibition via liver-targeted gene transfer in normal and dystrophic mice. PLoS ONE 2010, 5, e9176. [Google Scholar] [CrossRef] [PubMed]
- Fakhfakh, R.; Michaud, A.; Tremblay, J.P. Blocking the myostatin signal with a dominant negative receptor improves the success of human myoblast transplantation in dystrophic mice. Mol. Ther. 2011, 19, 204–210. [Google Scholar] [CrossRef]
- Luo, J.; Song, Z.; Yu, S.; Cui, D.; Wang, B.; Ding, F.; Li, S.; Dai, Y.; Li, N. Efficient generation of myostatin (MSTN) biallelic mutations in cattle using zinc finger nucleases. PLoS ONE 2014, 9, e95225. [Google Scholar] [CrossRef] [PubMed]
- Maeder, M.L.; Gersbach, C.A. Genome-editing Technologies for Gene and Cell Therapy. Mol. Ther. 2016, 24, 430–446. [Google Scholar] [CrossRef]
- Wicik, Z.; Sadkowski, T.; Jank, M.; Motyl, T. The transcriptomic signature of myostatin inhibitory influence on the differentiation of mouse C2C12 myoblasts. Pol. J. Vet. Sci. 2011, 14, 643–652. [Google Scholar] [CrossRef] [PubMed]
- Ran, F.A.; Hsu, P.D.; Wright, J.; Agarwala, V.; Scott, D.A.; Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 2013, 8, 2281–2308. [Google Scholar] [CrossRef] [PubMed]
- Gandhi, S.; Piacentino, M.L.; Vieceli, F.M.; Bronner, M.E. Optimization of CRISPR/Cas9 genome editing for loss-of-function in the early chick embryo. Dev. Biol. 2017, 432, 86–97. [Google Scholar] [CrossRef]
- Zhang, J.-H.; Adikaram, P.; Pandey, M.; Genis, A.; Simonds, W.F. Optimization of genome editing through CRISPR-Cas9 engineering. Bioengineered 2016, 7, 166–174. [Google Scholar] [CrossRef] [PubMed]
- McPherron, A.C.; Lawler, A.M.; Lee, S.J. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 1997, 387, 83–90. [Google Scholar] [CrossRef]
- Drysch, M.; Schmidt, S.V.; Becerikli, M.; Reinkemeier, F.; Dittfeld, S.; Wagner, J.M.; Dadras, M.; Sogorski, A.; von Glinski, M.; Lehnhardt, M.; et al. Myostatin Deficiency Protects C2C12 Cells from Oxidative Stress by Inhibiting Intrinsic Activation of Apoptosis. Cells 2021, 10, 1680. [Google Scholar] [CrossRef] [PubMed]
- Weintraub, H.; Davis, R.; Tapscott, S.; Thayer, M.; Krause, M.; Benezra, R.; Blackwell, T.K.; Turner, D.; Rupp, R.; Hollenberg, S. The myoD gene family: Nodal point during specification of the muscle cell lineage. Science 1991, 251, 761–766. [Google Scholar] [CrossRef]
- Zammit, P.S. Function of the myogenic regulatory factors Myf5, MyoD, Myogenin and MRF4 in skeletal muscle, satellite cells and regenerative myogenesis. Semin. Cell Dev. Biol. 2017, 72, 19–32. [Google Scholar] [CrossRef] [PubMed]
- Carnac, G.; Vernus, B.; Bonnieu, A. Myostatin in the pathophysiology of skeletal muscle. Curr. Genom. 2007, 8, 415–422. [Google Scholar] [CrossRef]
- Langley, B.; Thomas, M.; Bishop, A.; Sharma, M.; Gilmour, S.; Kambadur, R. Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. J. Biol. Chem. 2002, 277, 49831–49840. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, S.S.; Lim, J.H.; Ahmad, K.; Chun, H.J.; Hur, S.J.; Lee, E.J.; Choi, I. Targeting myostatin using quercetin as a media supplement to improve myogenesis for cultured meat production: An in silico and in vitro study. Curr. Res. Food Sci. 2024, 8, 100678. [Google Scholar] [CrossRef]
- Elashry, M.I.; Otto, A.; Matsakas, A.; El-Morsy, S.E.; Patel, K. Morphology and myofiber composition of skeletal musculature of the forelimb in young and aged wild type and myostatin null mice. Rejuvenation Res. 2009, 12, 269–281. [Google Scholar] [CrossRef]
- McPherron, A.C.; Lee, S.J. Double muscling in cattle due to mutations in the myostatin gene. Proc. Natl. Acad. Sci. USA 1997, 94, 12457–12461. [Google Scholar] [CrossRef] [PubMed]
- Egerman, M.A.; Glass, D.J. Signaling pathways controlling skeletal muscle mass. Crit. Rev. Biochem. Mol. Biol. 2014, 49, 59–68. [Google Scholar] [CrossRef]
- Amirouche, A.; Durieux, A.-C.; Banzet, S.; Koulmann, N.; Bonnefoy, R.; Mouret, C.; Bigard, X.; Peinnequin, A.; Freyssenet, D. Down-regulation of Akt/mammalian target of rapamycin signaling pathway in response to myostatin overexpression in skeletal muscle. Endocrinology 2009, 150, 286–294. [Google Scholar] [CrossRef] [PubMed]
- Morissette, M.R.; Cook, S.A.; Buranasombati, C.; Rosenberg, M.A.; Rosenzweig, A. Myostatin inhibits IGF-I-induced myotube hypertrophy through Akt. Am. J. Physiol. Cell Physiol. 2009, 297, C1124–C1132. [Google Scholar] [CrossRef]
- Rodriguez, J.; Vernus, B.; Toubiana, M.; Jublanc, E.; Tintignac, L.; Leibovitch, S.; Bonnieu, A. Myostatin inactivation increases myotube size through regulation of translational initiation machinery. J. Cell. Biochem. 2011, 112, 3531–3542. [Google Scholar] [CrossRef]
- Bodine, S.C.; Stitt, T.N.; Gonzalez, M.; Kline, W.O.; Stover, G.L.; Bauerlein, R.; Zlotchenko, E.; Scrimgeour, A.; Lawrence, J.C.; Glass, D.J.; et al. Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat. Cell Biol. 2001, 3, 1014–1019. [Google Scholar] [CrossRef]
- Amthor, H.; Macharia, R.; Navarrete, R.; Schuelke, M.; Brown, S.C.; Otto, A.; Voit, T.; Muntoni, F.; Vrbóva, G.; Partridge, T.; et al. Lack of myostatin results in excessive muscle growth but impaired force generation. Proc. Natl. Acad. Sci. USA 2007, 104, 1835–1840. [Google Scholar] [CrossRef] [PubMed]
- Gu, M.; Wei, Z.; Wang, X.; Gao, Y.; Wang, D.; Liu, X.; Bai, C.; Su, G.; Yang, L.; Li, G. Myostatin Knockout Affects Mitochondrial Function by Inhibiting the AMPK/SIRT1/PGC1α Pathway in Skeletal Muscle. Int. J. Mol. Sci. 2022, 23, 13703. [Google Scholar] [CrossRef]
- Wang, X.; Wei, Z.; Gu, M.; Zhu, L.; Hai, C.; Di, A.; Wu, D.; Bai, C.; Su, G.; Liu, X.; et al. Loss of Myostatin Alters Mitochondrial Oxidative Phosphorylation, TCA Cycle Activity, and ATP Production in Skeletal Muscle. Int. J. Mol. Sci. 2022, 23, 15707. [Google Scholar] [CrossRef] [PubMed]
- Morvan, F.; Rondeau, J.-M.; Zou, C.; Minetti, G.; Scheufler, C.; Scharenberg, M.; Jacobi, C.; Brebbia, P.; Ritter, V.; Toussaint, G.; et al. Blockade of activin type II receptors with a dual anti-ActRIIA/IIB antibody is critical to promote maximal skeletal muscle hypertrophy. Proc. Natl. Acad. Sci. USA 2017, 114, 12448–12453. [Google Scholar] [CrossRef]
- Lee, S.-J.; Reed, L.A.; Davies, M.V.; Girgenrath, S.; Goad, M.E.P.; Tomkinson, K.N.; Wright, J.F.; Barker, C.; Ehrmantraut, G.; Holmstrom, J.; et al. Regulation of muscle growth by multiple ligands signaling through activin type II receptors. Proc. Natl. Acad. Sci. USA 2005, 102, 18117–18122. [Google Scholar] [CrossRef]
- Morine, K.J.; Bish, L.T.; Selsby, J.T.; Gazzara, J.A.; Pendrak, K.; Sleeper, M.M.; Barton, E.R.; Lee, S.-J.; Sweeney, H.L. Activin IIB receptor blockade attenuates dystrophic pathology in a mouse model of Duchenne muscular dystrophy. Muscle Nerve 2010, 42, 722–730. [Google Scholar] [CrossRef]
- Morrison, B.M.; Lachey, J.L.; Warsing, L.C.; Ting, B.L.; Pullen, A.E.; Underwood, K.W.; Kumar, R.; Sako, D.; Grinberg, A.; Wong, V.; et al. A soluble activin type IIB receptor improves function in a mouse model of amyotrophic lateral sclerosis. Exp. Neurol. 2009, 217, 258–268. [Google Scholar] [CrossRef]
- Miura, T.; Kishioka, Y.; Wakamatsu, J.; Hattori, A.; Hennebry, A.; Berry, C.J.; Sharma, M.; Kambadur, R.; Nishimura, T. Decorin binds myostatin and modulates its activity to muscle cells. Biochem. Biophys. Res. Commun. 2006, 340, 675–680. [Google Scholar] [CrossRef]
- Liu, Y.; Xu, C.; Asiamah, C.A.; Ye, R.; Pan, Y.; Lu, L.-L.; Zhao, Z.; Jiang, P.; Su, Y. Decorin regulates myostatin and enhances proliferation and differentiation of embryonic myoblasts in Leizhou black duck. Gene 2021, 804, 145884. [Google Scholar] [CrossRef]
- Li, Y.; Li, J.; Zhu, J.; Sun, B.; Branca, M.; Tang, Y.; Foster, W.; Xiao, X.; Huard, J. Decorin gene transfer promotes muscle cell differentiation and muscle regeneration. Mol. Ther. 2007, 15, 1616–1622. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Li, Y.; Shen, W.; Qiao, C.; Ambrosio, F.; Lavasani, M.; Nozaki, M.; Branca, M.F.; Huard, J. Relationships between transforming growth factor-beta1, myostatin, and decorin: Implications for skeletal muscle fibrosis. J. Biol. Chem. 2007, 282, 25852–25863. [Google Scholar] [CrossRef] [PubMed]
Myostatin Target Sequences | Vector | Primers |
---|---|---|
GCCAAGAGCGCCTCCACTCC GGG | pMH17 | Forward: CACCGCCAAGAGCGCCTCCACTCC |
Reverse: AAACGGAGTGGAGGCGCTCTTGGC | ||
GCGATCAGTACGACGTCCAGA GGG | pMH18 | Forward: CACCGCGATCAGTACGACGTCCAGA |
Reverse: AAACTCTGGACGTCGTACTGATCGC | ||
GTGACGATTATCACGCTACCA CGG | pMH19 | Forward: CACCGTGACGATTATCACGCTACCA |
Reverse: AAACTGGTAGCGTGATAATCGTCAC | ||
GAGGTGACAGACACACCCAAG AGG | pMH20 | Forward: CACCGAGGTGACAGACACACCCAAG |
Reverse: AAACCTTGGGTGTGTCTGTCACCTC | ||
GAAAGACGGTACAAGGTATAC TGG | pMH21 | Forward: CACCGAAAGACGGTACAAGGTATAC |
Reverse: AAACGTATACCTTGTACCGTCTTTC |
Primer | Forward | Reverse |
---|---|---|
Myogenin | GAAGAAAAGGGACTGGGGAC | TCTTGAGCCTGCGCTTCTCC |
MyoD | GTGAATGAGGCCTTCGAGAC | GAGCCTGCAGACCTTCGATG |
Myostatin | ATGAGGGCAGTGAGAGAGAAG | CGCAGCTTACTGAGGATTTG |
ActRIIB | AACCCCCAGGTGTACTTCTG | TGGCTCGTACGTGACTTCTG |
Decorin | CCCGACACAACCTTGCTAG | CCTCTGGACTGATTTTGCTG |
mTOR | CGGCACACATTTGAAGAAGC | TCCATGCTGCTGATACGAAC |
MYH1 | CTACAACATCGCTGGCTGG | GCCACCAGACTCTGCTTCC |
MYH2 | TGGCTGGCTGGACAAGAAC | TCCACCACTACTTGCCTCTG |
MYH7 | ACTATGCTGGAGCTGATGCC | CTCTGTGCAGAGCAGACAC |
18S | ATGCGGCGGCGTTATTCC | GCTATCAATCTGTCAATCCTGTCC |
Clone | Nr. of Deleted Nucleoides |
---|---|
Mstn−/− 17–9 | 243 |
Mstn−/− 17–7 | 51 |
Mstn−/− 21–48 | 38 |
Mstn−/− 18–19 | 23 |
Mstn−/− 20–38 | 5 |
Mstn−/− 19–21 | 3 |
Mstn−/− 18–20 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elashry, M.I.; Schneider, V.C.; Heimann, M.; Wenisch, S.; Arnhold, S. CRISPR/Cas9-Targeted Myostatin Deletion Improves the Myogenic Differentiation Parameters for Muscle-Derived Stem Cells in Mice. J. Dev. Biol. 2025, 13, 5. https://doi.org/10.3390/jdb13010005
Elashry MI, Schneider VC, Heimann M, Wenisch S, Arnhold S. CRISPR/Cas9-Targeted Myostatin Deletion Improves the Myogenic Differentiation Parameters for Muscle-Derived Stem Cells in Mice. Journal of Developmental Biology. 2025; 13(1):5. https://doi.org/10.3390/jdb13010005
Chicago/Turabian StyleElashry, Mohamed I., Victoria C. Schneider, Manuela Heimann, Sabine Wenisch, and Stefan Arnhold. 2025. "CRISPR/Cas9-Targeted Myostatin Deletion Improves the Myogenic Differentiation Parameters for Muscle-Derived Stem Cells in Mice" Journal of Developmental Biology 13, no. 1: 5. https://doi.org/10.3390/jdb13010005
APA StyleElashry, M. I., Schneider, V. C., Heimann, M., Wenisch, S., & Arnhold, S. (2025). CRISPR/Cas9-Targeted Myostatin Deletion Improves the Myogenic Differentiation Parameters for Muscle-Derived Stem Cells in Mice. Journal of Developmental Biology, 13(1), 5. https://doi.org/10.3390/jdb13010005