Core-Extended Naphthalene Diimide Dyads as Light-Up Probes with Targeted Cytotoxicity Toward Tumor Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Synthesis and Purification
2.2. Sample Preparation for Solution Studies
NA | Sequence | Structure |
ds26 | 5′-[CAATCGGATCGAATTCGATCCGATTG]-3′ | ds DNA |
hTel22 | 5′-A[GGGTTA]3GGG-3′ | hybrid G4 |
hTel45 | 5′-GGG[TTAGGG]7-3′ | hybrid G4 dimer |
c-myc22 | 5′-[GAGGGTGGG]2GAAG-3′ | parallel G4 |
kras | 5′-[AGGGCGGTGTGGGAAGAGGGA]-3′ | parallel G4 |
2.3. Absorption and Fluorescence Spectra
2.4. Fluorescence Lifetimes
2.5. Multiwavelength Global Analysis of Spectroscopic Titration Data
2.6. Cell Culture
2.7. Cell Treatments and Viability/Survival Assays
2.8. Immunofluorescence and FISH Analysis
3. Results and Discussion
3.1. Design and Synthesis
3.2. Photophysical Characterization of the New Water-Soluble NDI-ceNDI Dyads
3.3. Binding Study of the New Compounds to Model NAs
3.4. Biological Studies
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Siddiqui-Jain, A.; Grand, C.L.; Bearss, D.J.; Hurley, L.H. Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc. Natl. Acad. Sci. USA 2002, 99, 11593–11598. [Google Scholar] [CrossRef] [PubMed]
- Huppert, J.L.; Balasubramanian, S. Prevalence of quadruplexes in the human genome. Nucleic Acids Res. 2005, 33, 2908–2916. [Google Scholar] [CrossRef]
- Huppert, J.L.; Balasubramanian, S. G-quadruplexes in promoters throughout the human genome. Nucleic Acids Res. 2007, 35, 406–413. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, R.; Miller, K.M.; Forment, J.V.; Bradshaw, C.R.; Nikan, M.; Britton, S.; Oelschlaegel, T.; Xhemalce, B.; Balasubramanian, S.; Jackson, S.P. Small-molecule-induced DNA damage identifies alternative DNA structures in human genes. Nat. Chem. Biol. 2012, 8, 301–310. [Google Scholar] [CrossRef] [PubMed]
- Shiekh, S.; Kodikara, S.G.; Balci, H. Structure, Topology, and Stability of Multiple G-quadruplexes in Long Telomeric Overhangs. J. Mol. Biol. 2024, 436, 23. [Google Scholar] [CrossRef] [PubMed]
- Mustafa, G.; Shiekh, S.; Keshav, G.C.; Abeysirigunawardena, S.; Balci, H. Interrogating accessibility of telomeric sequences with FRET-PAINT: Evidence for length-dependent telomere compaction. Nucleic Acids Res. 2021, 49, 3371–3380. [Google Scholar] [CrossRef] [PubMed]
- Chatain, J.; Hatem, G.; Delagoutte, E.; Riou, J.F.; Alberti, P.; Saintomé, C. Multiple hPOT1-TPP1 cooperatively unfold contiguous telomeric G-quadruplexes proceeding from 3′ toward 5′, a feature due to a 3′-end binding preference and to structuring of telomeric DNA. Nucleic Acids Res. 2021, 49, 10735–10746. [Google Scholar] [CrossRef]
- Biffi, G.; Tannahill, D.; McCafferty, J.; Balasubramanian, S. Quantitative visualization of DNA G-quadruplex structures in human cells. Nat. Chem. 2013, 5, 182–186. [Google Scholar] [CrossRef] [PubMed]
- Henderson, A.; Wu, Y.; Huang, Y.C.; Chavez, E.A.; Platt, J.; Johnson, F.B.; Brosh, R.M.; Sen, D.; Lansdorp, P.M. Detection of G-quadruplex DNA in mammalian cells. Nucleic Acids Res. 2014, 42, 860–869. [Google Scholar] [CrossRef]
- Siddiqui-Jain, A.; Hurley, L.H. DNA STRUCTURE Visualizing the quadruplex. Nat. Chem. 2013, 5, 153–155. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.-Y.; Liu, W.; Wang, K.-N.; Zhu, B.-C.; Xia, X.-Y.; Ji, L.-N.; Mao, Z.-W. Quantitative Detection of G-Quadruplex DNA in Live Cells Based on Photon Counts and Complex Structure Discrimination. Angew. Chem. Int. Ed. 2020, 59, 9719–9726. [Google Scholar] [CrossRef] [PubMed]
- Shivalingam, A.; Izquierdo, M.A.; Marois, A.L.; Vysniauskas, A.; Suhling, K.; Kuimova, M.K.; Vilar, R. The interactions between a small molecule and G-quadruplexes are visualized by fluorescence lifetime imaging microscopy. Nat. Commun. 2015, 6, 8178. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, A.A.; Angell, R.; Oxenford, S.; Worthington, J.; Williams, N.; Barton, N.; Fowler, T.G.; O’Flynn, D.E.; Sunose, M.; McConville, M.; et al. Asymmetrically Substituted Quadruplex-Binding Naphthalene Diimide Showing Potent Activity in Pancreatic Cancer Models. ACS Med. Chem. Lett. 2020, 11, 1634–1644. [Google Scholar] [CrossRef]
- Ahmed, A.A.; Chen, S.; Roman-Escorza, M.; Angell, R.; Oxenford, S.; McConville, M.; Barton, N.; Sunose, M.; Neidle, D.; Haider, S.; et al. Structure–activity relationships for the G-quadruplex-targeting experimental drug QN-302 and two analogues probed with comparative transcriptome profiling and molecular modeling. Sci. Rep. 2024, 14, 3447. [Google Scholar] [CrossRef] [PubMed]
- Collie, G.W.; Promontorio, R.; Hampel, S.M.; Micco, M.; Neidle, S.; Parkinson, G.N. Structural Basis for Telomeric G-Quadruplex Targeting by Naphthalene Diimide Ligands. J. Am. Chem. Soc. 2012, 134, 2723–2731. [Google Scholar] [CrossRef] [PubMed]
- Cuenca, F.; Greciano, O.; Gunaratnam, M.; Haider, S.; Munnur, D.; Nanjunda, R.; Wilson, W.D.; Neidle, S. Tri- and tetra-substituted naphthalene diimides as potent G-quadruplex ligands. Bioorg. Med. Chem. Lett. 2008, 18, 1668–1673. [Google Scholar] [CrossRef] [PubMed]
- Micco, M.; Collie, G.W.; Dale, A.G.; Ohnmacht, S.A.; Pazitna, I.; Gunaratnam, M.; Reszka, A.P.; Neidle, S. Structure-based design and evaluation of naphthalene diimide g-quadruplex ligands as telomere targeting agents in pancreatic cancer cells. J. Med. Chem. 2013, 56, 2959–2974. [Google Scholar] [CrossRef] [PubMed]
- Doria, F.; Oppi, A.; Manoli, F.; Botti, S.; Kandoth, N.; Grande, V.; Manet, I.; Freccero, M. A naphthalene diimide dyad for fluorescence switch-on detection of G-quadruplexes. Chem. Commun. 2015, 51, 9105–9108. [Google Scholar] [CrossRef]
- Neidle, S. Quadruplex Nucleic Acids as Novel Therapeutic Targets. J. Med. Chem. 2016, 59, 5987–6011. [Google Scholar] [CrossRef]
- Vo, T.; Oxenford, S.; Angell, R.; Marchetti, C.; Ohnmacht, S.A.; Wilson, W.D.; Neidle, S. Substituted Naphthalenediimide Compounds Bind Selectively to Two Human Quadruplex Structures with Parallel Topology. ACS Med. Chem. Lett. 2020, 11, 991–999. [Google Scholar] [CrossRef] [PubMed]
- Nadai, M.; Doria, F.; Scalabrin, M.; Pirota, V.; Grande, V.; Bergamaschi, G.; Amendola, V.; Winnerdy, F.R.; Phan, A.T.; Richter, S.N.; et al. A Catalytic and Selective Scissoring Molecular Tool for Quadruplex Nucleic Acids. J. Am. Chem. Soc. 2018, 140, 14528–14532. [Google Scholar] [CrossRef]
- Doria, F.; Nadai, M.; Folini, M.; Scalabrin, M.; Germani, L.; Sattin, G.; Mella, M.; Palumbo, M.; Zaffaroni, N.; Fabris, D.; et al. Targeting Loop Adenines in G-Quadruplex by a Selective Oxirane. Chem.-Eur. J. 2013, 19, 78–81. [Google Scholar] [CrossRef]
- Röger, C.; Würthner, F. Core-Tetrasubstituted Naphthalene Diimides: Synthesis, Optical Properties, and Redox Characteristics. J. Org. Chem. 2007, 72, 8070–8075. [Google Scholar] [CrossRef]
- Würthner, F.; Ahmed, S.; Thalacker, C.; Debaerdemaeker, T. Core-Substituted Naphthalene Bisimides: New Fluorophors with Tunable Emission Wavelength for FRET Studies. Chem.-Eur. J. 2002, 8, 4742–4750. [Google Scholar] [CrossRef] [PubMed]
- Sakai, N.; Mareda, J.; Vauthey, E.; Matile, S. Core-substituted naphthalenediimides. Chem. Commun. 2010, 46, 4225–4237. [Google Scholar] [CrossRef]
- Zuffo, M.; Doria, F.; Spalluto, V.; Ladame, S.; Freccero, M. Red/NIR G-Quadruplex Sensing, Harvesting Blue Light by a Coumarin–Naphthalene Diimide Dyad. Chem.-Eur. J. 2015, 21, 17596–17600. [Google Scholar] [CrossRef] [PubMed]
- Ghule, N.V.; Kharat, K.; Bhosale, R.S.; Puyad, A.L.; Bhosale, S.V.; Bhosale, S.V. The fluorescence detection of autophagosomes in live cells under starvation using core-substituted naphthalenediimide probes. RSC Adv. 2016, 6, 1644–1648. [Google Scholar] [CrossRef]
- Salvati, E.; Doria, F.; Manoli, F.; D’Angelo, C.; Biroccio, A.; Freccero, M.; Manet, I. A bimodal fluorescent and photocytotoxic naphthalene diimide for theranostic applications. Org. Biomol. Chem. 2016, 14, 7238–7249. [Google Scholar] [CrossRef] [PubMed]
- Doria, F.; Manet, I.; Grande, V.; Monti, S.; Freccero, M. Water-Soluble Naphthalene Diimides as Singlet Oxygen Sensitizers. J. Org. Chem. 2013, 78, 8065–8073. [Google Scholar] [CrossRef]
- Doria, F.; Salvati, E.; Pompili, L.; Pirota, V.; D’Angelo, C.; Manoli, F.; Nadai, M.; Richter, S.N.; Biroccio, A.; Manet, I.; et al. Dyads of G-Quadruplex Ligands Triggering DNA Damage Response and Tumour Cell Growth Inhibition at Subnanomolar Concentration. Chem.-Eur. J. 2019, 25, 11085–11097. [Google Scholar] [CrossRef]
- Manoli, F.; Doria, F.; Colombo, G.; Zambelli, B.; Freccero, M.; Manet, I. The Binding Pocket at the Interface of Multimeric Telomere G-quadruplexes: Myth or Reality? Chem.-Eur. J. 2021, 27, 11707–11720. [Google Scholar] [CrossRef] [PubMed]
- Zuffo, M.; Doria, F.; Botti, S.; Bergamaschi, G.; Freccero, M. G-quadruplex fluorescence sensing by core-extended naphthalene diimides. Biochim. Biophys. Acta-Gen. Subj. 2017, 1861, 1303–1311. [Google Scholar] [CrossRef] [PubMed]
- Platella, C.; Pirota, V.; Musumeci, D.; Rizzi, F.; Iachettini, S.; Zizza, P.; Biroccio, A.; Freccero, M.; Montesarchio, D.; Doria, F. Trifunctionalized Naphthalene Diimides and Dimeric Analogues as G-Quadruplex-Targeting Anticancer Agents Selected by Affinity Chromatography. Int. J. Mol. Sci. 2020, 21, 1964. [Google Scholar] [CrossRef]
- Zuffo, M.; Stucchi, A.; Campos-Salinas, J.; Cabello-Donayre, M.; Martínez-García, M.; Belmonte-Reche, E.; Pérez-Victoria, J.M.; Mergny, J.L.; Freccero, M.; Morales, J.C.; et al. Carbohydrate-naphthalene diimide conjugates as potential antiparasitic drugs: Synthesis, evaluation and structure-activity studies. Eur. J. Med. Chem. 2019, 163, 54–66. [Google Scholar] [CrossRef]
- Arevalo-Ruiz, M.; Doria, F.; Belmonte-Reche, E.; De Rache, A.; Campos-Salinas, J.; Lucas, R.; Falomir, E.; Carda, M.; Perez-Victoria, J.M.; Mergny, J.L.; et al. Synthesis, Binding Properties, and Differences in Cell Uptake of G-Quadruplex Ligands Based on Carbohydrate Naphthalene Diimide Conjugates. Chemistry 2017, 23, 2157–2164. [Google Scholar] [CrossRef]
- Pirota, V.; Platella, C.; Musumeci, D.; Benassi, A.; Amato, J.; Pagano, B.; Colombo, G.; Freccero, M.; Doria, F.; Montesarchio, D. On the binding of naphthalene diimides to a human telomeric G-quadruplex multimer model. Int. J. Biol. Macromol. 2021, 166, 1320–1334. [Google Scholar] [CrossRef] [PubMed]
- Rogers, J.E.; Weiss, S.J.; Kelly, L.A. Photoprocesses of naphthalene imide and diimide derivatives in aqueous solutions of DNA. J. Am. Chem. Soc. 2000, 122, 427–436. [Google Scholar] [CrossRef]
- Berndl, S.; Dimitrov, S.D.; Menacher, F.; Fiebig, T.; Wagenknecht, H.-A. Thiazole Orange Dimers in DNA: Fluorescent Base Substitutions with Hybridization Readout. Chem.-Eur. J. 2016, 22, 2386–2395. [Google Scholar] [CrossRef] [PubMed]
- White, E.W.; Tanious, F.; Ismail, M.A.; Reszka, A.P.; Neidle, S.; Boykin, D.W.; Wilson, W.D. Structure-specific recognition of quadruplex DNA by organic cations: Influence of shape, substituents and charge. Biophys. Chem. 2007, 126, 140–153. [Google Scholar] [CrossRef] [PubMed]
- Fornander, L.H.; Wu, L.; Billeter, M.; Lincoln, P.; Nordén, B. Minor-Groove Binding Drugs: Where Is the Second Hoechst 33258 Molecule? J. Phys. Chem. B 2013, 117, 5820–5830. [Google Scholar] [CrossRef]
- Balaz, M.; De Napoli, M.; Holmes, A.E.; Mammana, A.; Nakanishi, K.; Berova, N.; Purrello, R. A Cationic Zinc Porphyrin as a Chiroptical Probe for Z-DNA. Angew. Chem. Int. Ed. 2005, 44, 4006–4009. [Google Scholar] [CrossRef] [PubMed]
- Šmidlehner, T.; Piantanida, I.; Pescitelli, G. Polarization spectroscopy methods in the determination of interactions of small molecules with nucleic acids—tutorial. Beilstein J. Org. Chem. 2018, 14, 84–105. [Google Scholar] [CrossRef] [PubMed]
Sample | Φ a | Lifetime, τ (ns),b Measured at 605 nm | ||
---|---|---|---|---|
λexc 560 nm | λexc 465 nm | |||
τ1 | τ1 | τ2 | ||
PHAM-Prop | 0.10 | 3.34 | 3.23 | |
PHAM-Prop/SDS | 0.32 | 3.94 | 3.80 | |
DIPAY | 0.004 | 3.35 | 2.79 (59%) | 7.32 (41%) |
DIPAY/SDS | 0.32 | 3.71 | 3.71 | |
DIPAC | <0.001 | 3.31 | 2.65 (22%) | 8.80 (78%) |
DIPAC/SDS | 0.053 | 3.47 | 3.44 |
DNA | PHAM-Prop | DIPAY | DIPAC | |||
---|---|---|---|---|---|---|
Htel22 | 1:1 1:2 | 7.64 ± 0.16 14.04 ± 0.21 | 1:1 1:2 2:1 | 8.93 ± 0.07 15.71 ± 0.10 14.14 ± 0.06 | 1:1 1:2 1:3 | 7.67 ± 0.05 14.68 ± 0.10 20.37 ± 0.10 |
Htel45 | 1:2 1:4 | 14.41 ± 0.05 28.6 ± 0.1 | 1:1 1:2 1:4 2:1 | 7.91 ± 0.07 12.94 ± 0.16 25.52 ± 0.07 13.24 ± 0.08 | 1:2 1:4 2:1 | 13.80 ± 0.05 26.88 ± 0.1 11.55 ± 0.03 |
c-myc22 | 1:1 1:2 | 6.89 ± 0.05 14.74 ± 0.06 | 1:1 1:2 | 6.16 ± 0.02 13.78 ± 0.03 | 1:1 1:2 2:1 | 7.77 ± 0.12 14.36 ± 0.16 11.69 ± 0.16 |
Ds26 | 1:2 1:4 | 15.25 ± 0.03 29.15 ± 0.04 | 1:1 1:2 1:3 | 6.50 ± 0.03 12.95 ± 0.03 18.35 ± 0.05 | 1:1 1:2 1:3 | 5.82 ± 0.02 12.48 ± 0.02 17.70 ± 0.12 |
τ1, ns | α1 | τ2, ns | α2 | <τav>/ns | DNA/Ligand | |
---|---|---|---|---|---|---|
PHAM-Prop | ||||||
hTel22 | 1.25 | 62% | 3.22 | 38% | 2.45 | 1:1 |
hTel45 | 1.00 | 55% | 3.5 | 45% | 2.85 | 1:2 |
Cmyc22 | 0.68 | 66% | 3.15 | 34% | 2.42 | 1:1, 1:2 |
Ds26mer | 0.39 | 89% | 3.14 | 11% | 1.76 | 1:2 |
DIPAY | ||||||
hTel22 | 0.77 | 69% | 2.77 | 31% | 2.00 | 1:1, 2:1 |
hTel45 | 0.68 | 83% | 2.52 | 17% | 1.47 | 1:1, 2:1 |
Cmyc22 | 0.47 | 88% | 1.70 | 12% | 0.88 | 1:1, 1:2 |
Ds26mer | 0.20 | 90% | 0.68 | 10% | 0.33 | 1:1, 1:2 |
DIPAC | ||||||
hTel22 | 0.74 | 74% | 2.53 | 26% | 1.72 | 1:1, 1:2 |
hTel45 | 0.90 | 73% | 2.44 | 27% | 1.67 | 1:1, 2:1 |
Cmyc22 | 0.52 | 85% | 1.82 | 15% | 1.01 | 1:1, 2:1 |
Ds26mer | 0.19 | 90% | 1.37 | 10% | 0.71 | 1:1, 1:2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pirota, V.; Salvati, E.; Risoldi, C.; Manoli, F.; Rizzo, A.; Zizza, P.; Biroccio, A.; Freccero, M.; Manet, I.; Doria, F. Core-Extended Naphthalene Diimide Dyads as Light-Up Probes with Targeted Cytotoxicity Toward Tumor Cells. Biomolecules 2025, 15, 311. https://doi.org/10.3390/biom15020311
Pirota V, Salvati E, Risoldi C, Manoli F, Rizzo A, Zizza P, Biroccio A, Freccero M, Manet I, Doria F. Core-Extended Naphthalene Diimide Dyads as Light-Up Probes with Targeted Cytotoxicity Toward Tumor Cells. Biomolecules. 2025; 15(2):311. https://doi.org/10.3390/biom15020311
Chicago/Turabian StylePirota, Valentina, Erica Salvati, Carla Risoldi, Francesco Manoli, Angela Rizzo, Pasquale Zizza, Annamaria Biroccio, Mauro Freccero, Ilse Manet, and Filippo Doria. 2025. "Core-Extended Naphthalene Diimide Dyads as Light-Up Probes with Targeted Cytotoxicity Toward Tumor Cells" Biomolecules 15, no. 2: 311. https://doi.org/10.3390/biom15020311
APA StylePirota, V., Salvati, E., Risoldi, C., Manoli, F., Rizzo, A., Zizza, P., Biroccio, A., Freccero, M., Manet, I., & Doria, F. (2025). Core-Extended Naphthalene Diimide Dyads as Light-Up Probes with Targeted Cytotoxicity Toward Tumor Cells. Biomolecules, 15(2), 311. https://doi.org/10.3390/biom15020311