A Versatile Skin-Derived Extracellular Matrix Hydrogel-Based Platform to Investigate the Function of a Mechanically Isolated Adipose Tissue Stromal Vascular Fraction
Abstract
1. Introduction
2. Material and Methods
2.1. Hydrogel Generation
2.2. Generation of Tissue-like Stromal Vascular Fraction and Mixing with Hydrogel
2.3. Culture of tSVF Mixed Hydrogels
2.4. Viability
2.5. (Immuno)histochemical Analysis
2.6. Picrosirius Red Staining
2.7. Gene Expression Analysis
2.8. Image and Statistical Analyses
3. Results
3.1. Viability Results
3.2. Tissue SVFs Express Regeneration-Associated Genes During Culture in an ECM Hydrogel
3.3. (Immuno)histological Results
3.4. Fiber Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gonzalez, A.C.D.O.; Costa, T.F.; de Araújo Andrade, Z.; Medrado, A.R.A.P. Wound healing—A literature review. An. Bras. Dermatol. 2016, 91, 614–620. [Google Scholar] [CrossRef] [PubMed]
- Gilmore, M.A. Phases of wound healing. Dimens. Oncol. Nurs. 1991, 5, 32–34. [Google Scholar] [PubMed]
- Maxson, S.; Lopez, E.A.; Yoo, D.; Danilkovitch-Miagkova, A.; LeRoux, M.A. Concise review: Role of mesenchymal stem cells in wound repair. Stem Cells Transl. Med. 2012, 1, 142–149. [Google Scholar] [CrossRef] [PubMed]
- Johnson, K.E.; Wilgus, T.A. Vascular Endothelial Growth Factor and Angiogenesis in the Regulation of Cutaneous Wound Repair. Adv. Wound Care 2014, 3, 647–661. [Google Scholar] [CrossRef]
- Diegelmann, R.F.; Evans, M.C. Wound healing: An overview of acute, fibrotic and delayed healing. Front. Biosci. 2004, 9, 283–289. [Google Scholar] [CrossRef]
- Brainbridge, P. Wound Healing and The Role of Fibroblast. J. Wound Care 2013, 22, 407–412. [Google Scholar]
- Clark, R.A. Fibrin and wound healing. Ann. N. Y. Acad. Sci. 2001, 936, 355–367. [Google Scholar] [CrossRef]
- Li, B.; Wang, J.H.-C. Fibroblasts and myofibroblasts in wound healing: Force generation and measurement. J. Tissue Viability 2011, 20, 108–120. [Google Scholar] [CrossRef]
- Laurens, N.; Koolwijk, P.; DE Maat, M.P.M. Fibrin structure and wound healing. J. Thromb. Haemost. 2006, 4, 932–939. [Google Scholar] [CrossRef]
- Arkudas, A.; Tjiawi, J.; Saumweber, A.; Beier, J.P.; Polykandriotis, E.; Bleiziffer, O.; Horch, R.E.; Kneser, U. Evaluation of blood vessel ingrowth in fibrin gel subject to type and concentration of growth factors. J. Cell Mol. Med. 2009, 13, 2864–2874. [Google Scholar] [CrossRef]
- Krzyszczyk, P.; Schloss, R.; Palmer, A.; Berthiaume, F. The Role of Macrophages in Acute and Chronic Wound Healing and Interventions to Promote Pro-wound Healing Phenotypes. Front. Physiol. 2018, 9, 419. [Google Scholar] [CrossRef]
- Kim, S.Y.; Nair, M.G. Macrophages in wound healing: Activation and plasticity. Immunol. Cell Biol. 2019, 97, 258–267. [Google Scholar] [CrossRef]
- Vriend, L.; van der Lei, B.; Harmsen, M.C.; van Dongen, J.A. Adipose Tissue-Derived Components: From Cells to Tissue Glue to Treat Dermal Damage. Bioengineering 2023, 10, 328. [Google Scholar] [CrossRef]
- Schipper, J.A.M.; van Laarhoven, C.J.H.C.M.; Schepers, R.H.; Tuin, A.J.; Harmsen, M.C.; Spijkervet, F.K.L.; Jansma, J.; van Dongen, J.A. Mechanical Fractionation of Adipose Tissue-A Scoping Review of Procedures to Obtain Stromal Vascular Fraction. Bioengineering 2023, 10, 1175. [Google Scholar] [CrossRef]
- A van Dongen, J.; van Boxtel, J.; Uguten, M.; A Brouwer, L.; Vermeulen, K.M.; Melenhorst, W.B.; Niessen, F.B.; Harmsen, M.C.; Stevens, H.P.; van der Lei, B. Tissue Stromal Vascular Fraction Improves Early Scar Healing: A Prospective Randomized Multicenter Clinical Trial. Aesthet. Surg. J. 2022, 42, NP477–NP488. [Google Scholar] [CrossRef]
- Abouzaid, A.M.; El Mokadem, M.E.; Aboubakr, A.K.; Kassem, M.A.; Al Shora, A.K.; Solaiman, A. Effect of autologous fat transfer in acute burn wound management: A randomized controlled study. Burns 2022, 48, 1368–1385. [Google Scholar] [CrossRef]
- Gu, Z.; Li, Y.; Li, H. Use of Condensed Nanofat Combined with Fat Grafts to Treat Atrophic Scars. JAMA Facial Plast. Surg. 2018, 20, 128–135. [Google Scholar] [CrossRef]
- Deng, C.; Wang, L.; Feng, J.; Lu, F. Treatment of human chronic wounds with autologous extracellular matrix/stromal vascular fraction gel: A STROBE-compliant study. Medicine 2018, 97, e11667. [Google Scholar] [CrossRef]
- Bourin, P.; Bunnell, B.A.; Casteilla, L.; Dominici, M.; Katz, A.J.; March, K.L.; Redl, H.; Rubin, J.P.; Yoshimura, K.; Gimble, J.M. Stromal cells from the adipose tissue-derived stromal vascular fraction and culture expanded adipose tissue-derived stromal/stem cells: A joint statement of the International Federation for Adipose Therapeutics and Science (IFATS) and the International So. Cytotherapy 2013, 15, 641–648. [Google Scholar] [CrossRef]
- Baer, P.C. Adipose-derived mesenchymal stromal/stem cells: An update on their phenotype in vivo and in vitro. World J. Stem Cells 2014, 6, 256–265. [Google Scholar] [CrossRef]
- Terlizzi, V.; Kolibabka, M.; Burgess, J.K.; Hammes, H.P.; Harmsen, M.C. The Pericytic Phenotype of Adipose Tissue-Derived Stromal Cells Is Promoted by NOTCH2. Stem Cells 2018, 36, 240–251. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Zhao, F.; Zhu, Y.; Brouwer, L.A.; Van der Veen, H.; Burgess, J.K.; Harmsen, M.C. Physical Properties and Biochemical Composition of Extracellular Matrix-Derived Hydrogels Dictate Vascularization Potential in an Organ-Dependent Fashion. ACS Appl. Mater. Interfaces 2024, 16, 29930–29945. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Getova, V.E.; Martinez-Garcia, F.D.; Borghuis, T.; Burgess, J.K.; Harmsen, M.C. From Macro to Micro: Comparison of Imaging Techniques to Detect Vascular Network Formation in Left Ventricle Decellularized Extracellular Matrix Hydrogels. Gels 2022, 8, 729. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Zhao, F.; Zhang, X.; Brouwer, L.A.; Burgess, J.K.; Harmsen, M.C. Fibroblasts alter the physical properties of dermal ECM-derived hydrogels to create a pro-angiogenic microenvironment. Mater. Today Bio 2023, 23, 100842. [Google Scholar] [CrossRef] [PubMed]
- Spiekman, M.; Francia, D.L.; Mossel, D.M.; A Brouwer, L.; Diercks, G.F.H.; Vermeulen, K.M.; Folkertsma, M.; Ghods, M.; Kzhyshkowska, J.; Klüter, H.; et al. Autologous Lipofilling Improves Clinical Outcome in Patients with Symptomatic Dermal Scars Through Induction of a Pro-Regenerative Immune Response. Aesthet. Surg. J. 2022, 42, NP244–NP256. [Google Scholar] [CrossRef]
- A Van Dongen, J.; E Gostelie, O.F.; A Vonk, L.; De Bruijn, J.J.; Van Der Lei, B.; Harmsen, M.C.; Stevens, H.P. Fractionation of Adipose Tissue Procedure with a Disposable One-Hole Fractionator. Aesthet. Surg. J. 2020, 40, NP194–NP201. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef]
- Wershof, E.; Park, D.; Barry, D.J.; Jenkins, R.P.; Rullan, A.; Wilkins, A.; Schlegelmilch, K.; Roxanis, I.; I Anderson, K.; A Bates, P.; et al. A FIJI macro for quantifying pattern in extracellular matrix. Life Sci. Alliance 2021, 4, e202000880. [Google Scholar] [CrossRef]
- Blanchette-Mackie, E.; Dwyer, N.; Barber, T.; Coxey, R.; Takeda, T.; Rondinone, C.; Theodorakis, J.; Greenberg, A.; Londos, C. Perilipin is located on the surface layer of intracellular lipid droplets in adipocytes. J. Lipid Res. 1995, 36, 1211–1226. [Google Scholar] [CrossRef]
- Saldin, L.T.; Cramer, M.C.; Velankar, S.S.; White, L.J.; Badylak, S.F. Extracellular matrix hydrogels from decellularized tissues: Structure and function. Acta Biomater. 2017, 49, 1–15. [Google Scholar] [CrossRef]
- Wolf, M.T.; Daly, K.A.; Brennan-Pierce, E.P.; Johnson, S.A.; Carruthers, C.A.; D’Amore, A.; Nagarkar, S.P.; Velankar, S.S.; Badylak, S.F. A hydrogel derived from decellularized dermal extracellular matrix. Biomaterials 2012, 33, 7028–7038. [Google Scholar] [CrossRef] [PubMed]
- Tan, S.H.; Chua, D.A.C.; Tang, J.R.J.; Bonnard, C.; Leavesley, D.; Liang, K. Design of hydrogel-based scaffolds for in vitro three-dimensional human skin model reconstruction. Acta Biomater. 2022, 153, 13–37. [Google Scholar] [CrossRef] [PubMed]
- Hynes, R.O. The extracellular matrix: Not just pretty fibrils. Science 2009, 326, 1216–1219. [Google Scholar] [CrossRef] [PubMed]
- Vriend, L.; van Dongen, J.A.; Sinkunas, V.; Brouwer, L.A.; Buikema, H.J.; Moreira, L.F.; Gemperli, R.; Bongiovanni, L.; de Bruin, A.; van der Lei, B.; et al. Limited Efficacy of Adipose Stromal Cell Secretome-Loaded Skin-Derived Hydrogels to Augment Skin Flap Regeneration in Rats. Stem Cells Dev. 2022, 31, 630–640. [Google Scholar] [CrossRef] [PubMed]
- Koh, Y.J.; Koh, B.I.; Kim, H.; Joo, H.J.; Jin, H.K.; Jeon, J.; Choi, C.; Lee, D.H.; Chung, J.H.; Cho, C.-H.; et al. Stromal vascular fraction from adipose tissue forms profound vascular network through the dynamic reassembly of blood endothelial cells. Arterioscler. Thromb. Vasc. Biol. 2011, 31, 1141–1150. [Google Scholar] [CrossRef] [PubMed]
- Moreira, H.R.; Rodrigues, D.B.; Freitas-Ribeiro, S.; da Silva, L.P.; Morais, A.d.S.; Jarnalo, M.; Horta, R.; Reis, R.L.; Pirraco, R.P.; Marques, A.P. Integrin-specific hydrogels for growth factor-free vasculogenesis. NPJ Regen. Med. 2022, 7, 57. [Google Scholar] [CrossRef]
- Pallua, N.; Serin, M.; Wolter, T.P. Characterisation of angiogenetic growth factor production in adipose tissue-derived mesenchymal cells. J. Plast. Surg. Hand Surg. 2014, 48, 412–416. [Google Scholar] [CrossRef]
- Sun, Y.; Chen, S.; Zhang, X.; Pei, M. Significance of Cellular Cross-Talk in Stromal Vascular Fraction of Adipose Tissue in Neovascularization. Arterioscler. Thromb. Vasc. Biol. 2019, 39, 1034–1044. [Google Scholar] [CrossRef]
- Sun, M.; He, Y.; Zhou, T.; Zhang, P.; Gao, J.; Lu, F. Adipose Extracellular Matrix/Stromal Vascular Fraction Gel Secretes Angiogenic Factors and Enhances Skin Wound Healing in a Murine Model. Biomed. Res. Int. 2017, 2017, 3105780. [Google Scholar] [CrossRef]
- Krenning, G.; Dankers, P.Y.; Jovanovic, D.; van Luyn, M.J.; Harmsen, M.C. Efficient differentiation of CD14+ monocytic cells into endothelial cells on degradable biomaterials. Biomaterials 2007, 28, 1470–1479. [Google Scholar] [CrossRef]
- van Dongen, J.A.; Harmsen, M.C.; Stevens, H.P. Isolation of Stromal Vascular Fraction by Fractionation of Adipose Tissue. Methods Mol. Biol. 2019, 1993, 91–103. [Google Scholar] [CrossRef] [PubMed]
- Yao, Y.; Dong, Z.; Liao, Y.; Zhang, P.; Ma, J.; Gao, J.; Lu, F. Adipose Extracellular Matrix/Stromal Vascular Fraction Gel: A Novel Adipose Tissue-Derived Injectable for Stem Cell Therapy. Plast. Reconstr. Surg. 2017, 139, 867–879. [Google Scholar] [CrossRef] [PubMed]
- Deng, C.; He, Y.; Feng, J.; Dong, Z.; Yao, Y.; Lu, F. Conditioned Medium from 3D Culture System of Stromal Vascular Fraction Cells Accelerates Wound Healing in Diabetic Rats. Regen. Med. 2019, 14, 925–937. [Google Scholar] [CrossRef] [PubMed]





| Dye | Company | Concentration (μM) |
|---|---|---|
| Hoechst | Thermo Fisher Scientific | 33 |
| PI | Sigma Aldrich | 3 |
| Calcein AM | Thermo Fisher Scientific | 5 |
| Dye | Excitation/Emission | EVOS Light Cube Filter | Filter Excitation/Emission |
|---|---|---|---|
| Hoechst | 350–461 nm | DAPI (violet) | 337–447 nm |
| PI | 535–617 nm | Texas Red (red) | 585–624 nm |
| Calcein AM | 490–515 nm | GFP (green) | 470–510 nm |
| First Antibody | Host | Company | Concentration |
|---|---|---|---|
| α-SMA | Mouse | Abcam | 1:200 |
| von Willebrand factor | Rabbit | DAKO | 1:200 |
| Anti-perilipin A | Rabbit | Abcam | 1:200 |
| Second Antibody | Host | Company | Concentration |
|---|---|---|---|
| Goat Anti-Rabbit | Goat | DAKO | 1:100 |
| Swine Anti-Rabbit | Swine | DAKO | 1:100 |
| Rabbit Anti-Mouse | Rabbit | DAKO | 1:100 |
| Target | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
|---|---|---|
| GAPDH | AGCCACATCGCTCAGACAC | GCCCAATACGACCAAATCC |
| VEGFA | CCTGAAATGAAGGAAGAGGA | AAATAAAATGGCGAATCCAA |
| TGFB1 | ACTACTACGCCAAGGAGGTCAC | TGCTTGAACTTGTCATAGATTTCG |
| MMP1 | GCTAACCTTTGATGCTATAACTACGA | TTTGTGCGCATGTAGAATCTG |
| MMP2 | GTTCCCCTTCTTGTTCAATG | CTTGCCATCCTTCTCAAAGT |
| MMP14 | GGGTGAGGAATAACCAAGTG | CTTCCTCTCGTAGGCAGTGT |
| IL1B | AAGCTGGAATTTGAGTCTGC | ACACAAATTGCATGGTGAAG |
| IL6 | AGCTCAATAAGAAGGGGCCTA | TGAGAAACCCTGGCTTAAGTAGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, X.; Schipper, J.A.M.; Schepers, R.H.; Jansma, J.; Spijkervet, F.K.L.; Harmsen, M.C. A Versatile Skin-Derived Extracellular Matrix Hydrogel-Based Platform to Investigate the Function of a Mechanically Isolated Adipose Tissue Stromal Vascular Fraction. Biomolecules 2024, 14, 1493. https://doi.org/10.3390/biom14121493
Zhang X, Schipper JAM, Schepers RH, Jansma J, Spijkervet FKL, Harmsen MC. A Versatile Skin-Derived Extracellular Matrix Hydrogel-Based Platform to Investigate the Function of a Mechanically Isolated Adipose Tissue Stromal Vascular Fraction. Biomolecules. 2024; 14(12):1493. https://doi.org/10.3390/biom14121493
Chicago/Turabian StyleZhang, Xue, Jan Aart M. Schipper, Rutger H. Schepers, Johan Jansma, Fred K. L. Spijkervet, and Martin C. Harmsen. 2024. "A Versatile Skin-Derived Extracellular Matrix Hydrogel-Based Platform to Investigate the Function of a Mechanically Isolated Adipose Tissue Stromal Vascular Fraction" Biomolecules 14, no. 12: 1493. https://doi.org/10.3390/biom14121493
APA StyleZhang, X., Schipper, J. A. M., Schepers, R. H., Jansma, J., Spijkervet, F. K. L., & Harmsen, M. C. (2024). A Versatile Skin-Derived Extracellular Matrix Hydrogel-Based Platform to Investigate the Function of a Mechanically Isolated Adipose Tissue Stromal Vascular Fraction. Biomolecules, 14(12), 1493. https://doi.org/10.3390/biom14121493

