Structural and Molecular Changes of Human Chondrocytes Exposed to the Rotating Wall Vessel Bioreactor
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Cultures
2.2. Rotating Wall Vessel Device
2.3. Histological Analysis
2.3.1. Histological Staining
2.3.2. Immunohistochemistry
2.4. Cell Death Detection
2.5. RNA Isolation
2.6. Quantitative Real Time PCR (qPCR)
2.7. STRING Analysis (Search Tool for the Retrieval of Interacting Genes/Proteins, V11.5)
2.8. Statistical Analysis
3. Results
3.1. Formation of 3D Cartilage Constructs in the Rotating Wall Vessel
3.2. Histochemical and Immunohistochemical Investigation of 3D C28/I2 Tissues
3.3. Gene Expression of Chondrocyte Signaling Factors in 3D C28/I2 Spheroids
3.4. Gene Expression Pattern in Primary Human Chondrocyte Spheroids
3.5. Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) Analysis
4. Discussion
4.1. Tissue Engineering under Microgravity Conditions
4.2. Extracellular Matrix Proteins, Cytokines and Chondrocyte Signaling Factors in Neocartilage Tissue-Engineered with the Stable C28/12 Chondrocyte Cell Line
4.3. Signaling Factors of Different Biological Processes in Neocartilage Tissue-Engineered with Primary Human Articular Chondrocytes
4.4. Interaction Network of Selected Genes Evaluated by STRING Analysis
4.4.1. C28/I2 Chondrocyte Cells Exposed to Microgravity Conditions
4.4.2. Primary Articular Chondrocytes Exposed to the Rotating Wall Vessel
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- GBD 2019. Global Burden of 369 Diseases and Injuries in 204 Countries and Territories, 1990–2019: A Systematic Analysis for the Global Burden of Disease Study 2019. Available online: https://vizhub.healthdata.org/gbd-results/ (accessed on 5 May 2023).
- Long, H.; Liu, Q.; Yin, H.; Wang, K.; Diao, N.; Zhang, Y.; Lin, J.; Guo, A. Prevalence Trends of Site-Specific Osteoarthritis From 1990 to 2019: Findings From the Global Burden of Disease Study 2019. Arthritis Rheumatol. 2022, 74, 1172–1183. [Google Scholar] [CrossRef] [PubMed]
- Yu, S.P.; Hunter, D.J. Managing osteoarthritis. Aust. Prescr. 2015, 38, 115–119. [Google Scholar] [CrossRef] [PubMed]
- Nowaczyk, A.; Szwedowski, D.; Dallo, I.; Nowaczyk, J. Overview of First-Line and Second-Line Pharmacotherapies for Osteoarthritis with Special Focus on Intra-Articular Treatment. Int. J. Mol. Sci. 2022, 23, 1566. [Google Scholar] [CrossRef] [PubMed]
- Kraeutler, M.J.; Belk, J.W.; Purcell, J.M.; McCarty, E.C. Microfracture Versus Autologous Chondrocyte Implantation for Articular Cartilage Lesions in the Knee: A Systematic Review of 5-Year Outcomes. Am. J. Sports Med. 2018, 46, 995–999. [Google Scholar] [CrossRef] [PubMed]
- Iordache, E.; Robertson, E.L.; Hirschmann, A.; Hirschmann, M.T. Typical MRI-pattern suggests peak maturation of the ACI graft 2 years after third-generation ACI: A systematic review. Knee Surg. Sports Traumatol. Arthrosc. 2021, 29, 3664–3677. [Google Scholar] [CrossRef] [PubMed]
- Migliorini, F.; Maffulli, N.; Baroncini, A.; Knobe, M.; Tingart, M.; Eschweiler, J. Matrix-induced autologous chondrocyte implantation versus autologous matrix-induced chondrogenesis for chondral defects of the talus: A systematic review. Br. Med. Bull. 2021, 138, 144–154. [Google Scholar] [CrossRef] [PubMed]
- Shimomura, K.; Ando, W.; Hart, D.A.; Yonetani, Y.; Horibe, S.; Nakamura, N. Five-Year Outcomes After Implantation of a Scaffold-Free Tissue-Engineered Construct Generated From Autologous Synovial Mesenchymal Stromal Cells for Repair of Knee Chondral Lesions. Orthop. J. Sports Med. 2023, 11, 23259671231189474. [Google Scholar] [CrossRef]
- Eschen, C.; Kaps, C.; Widuchowski, W.; Fickert, S.; Zinser, W.; Niemeyer, P.; Roel, G. Clinical outcome is significantly better with spheroid-based autologous chondrocyte implantation manufactured with more stringent cell culture criteria. Osteoarthr. Cartil. Open 2020, 2, 100033. [Google Scholar] [CrossRef]
- Fani, N.; Peshkova, M.; Bikmulina, P.; Golroo, R.; Timashev, P.; Vosough, M. Fabricating the cartilage: Recent achievements. Cytotechnology 2023, 75, 269–292. [Google Scholar] [CrossRef]
- Huang, J.; Xiong, J.; Wang, D.; Zhang, J.; Yang, L.; Sun, S.; Liang, Y. 3D Bioprinting of Hydrogels for Cartilage Tissue Engineering. Gels 2021, 7, 144. [Google Scholar] [CrossRef]
- Perera, K.; Ivone, R.; Natekin, E.; Wilga, C.A.; Shen, J.; Menon, J.U. 3D Bioprinted Implants for Cartilage Repair in Intervertebral Discs and Knee Menisci. Front. Bioeng. Biotechnol. 2021, 9, 754113. [Google Scholar] [CrossRef] [PubMed]
- McGivern, S.; Boutouil, H.; Al-Kharusi, G.; Little, S.; Dunne, N.J.; Levingstone, T.J. Translational Application of 3D Bioprinting for Cartilage Tissue Engineering. Bioengineering 2021, 8, 144. [Google Scholar] [CrossRef] [PubMed]
- Elalouf, A. Immune response against the biomaterials used in 3D bioprinting of organs. Transpl. Immunol. 2021, 69, 101446. [Google Scholar] [CrossRef] [PubMed]
- Sikavitsas, V.I.; Bancroft, G.N.; Holtorf, H.L.; Jansen, J.A.; Mikos, A.G. Mineralized matrix deposition by marrow stromal osteoblasts in 3D perfusion culture increases with increasing fluid shear forces. Proc. Natl. Acad. Sci. USA 2003, 100, 14683–14688. [Google Scholar] [CrossRef] [PubMed]
- Phelan, M.; Lelkes, P.; Swaroop, A. Customized rotating wall vessel bioreactors produce improved retinal organoids with reduced operational costs and less frequent experimental failure. Investig. Ophthalmol. Vis. Sci. 2019, 60, 3316. [Google Scholar]
- Reina-Mahecha, A.; Beers, M.J.; van der Veen, H.C.; Zuhorn, I.S.; van Kooten, T.G.; Sharma, P.K. A Review of the Role of Bioreactors for iPSCs-Based Tissue-Engineered Articular Cartilage. Tissue Eng. Regen. Med. 2023, 20, 1041–1052. [Google Scholar] [CrossRef]
- Mekala, N.K.; Baadhe, R.R.; Parcha, S.R. Review on bioreactors in tissue engineering. Bio Technol. AIJ 2011, 5, 246–253. [Google Scholar]
- Moroni, L.; Tabury, K.; Stenuit, H.; Grimm, D.; Baatout, S.; Mironov, V. What can biofabrication do for space and what can space do for biofabrication? Trends Biotechnol. 2022, 40, 398–411. [Google Scholar] [CrossRef]
- Grimm, D.; Wehland, M.; Corydon, T.J.; Richter, P.; Prasad, B.; Bauer, J.; Egli, M.; Kopp, S.; Lebert, M.; Kruger, M. The effects of microgravity on differentiation and cell growth in stem cells and cancer stem cells. Stem Cells Transl. Med. 2020, 9, 882–894. [Google Scholar] [CrossRef]
- Ma, X.; Wehland, M.; Schulz, H.; Saar, K.; Hubner, N.; Infanger, M.; Bauer, J.; Grimm, D. Genomic approach to identify factors that drive the formation of three-dimensional structures by EA.hy926 endothelial cells. PLoS ONE 2013, 8, e64402. [Google Scholar] [CrossRef]
- Freed, L.E.; Langer, R.; Martin, I.; Pellis, N.R.; Vunjak-Novakovic, G. Tissue engineering of cartilage in space. Proc. Natl. Acad. Sci. USA 1997, 94, 13885–13890. [Google Scholar] [CrossRef] [PubMed]
- Stamenkovic, V.; Keller, G.; Nesic, D.; Cogoli, A.; Grogan, S.P. Neocartilage formation in 1 g, simulated, and microgravity environments: Implications for tissue engineering. Tissue Eng. Part A 2010, 16, 1729–1736. [Google Scholar] [CrossRef] [PubMed]
- Freed, L.E.; Vunjak-Novakovic, G. Microgravity tissue engineering. Vitr. Cell Dev. Biol. Anim. 1997, 33, 381–385. [Google Scholar] [CrossRef] [PubMed]
- Chang, T.T.; Hughes-Fulford, M. Molecular mechanisms underlying the enhanced functions of three-dimensional hepatocyte aggregates. Biomaterials 2014, 35, 2162–2171. [Google Scholar] [CrossRef] [PubMed]
- Dittrich, A.; Grimm, D.; Sahana, J.; Bauer, J.; Kruger, M.; Infanger, M.; Magnusson, N.E. Key Proteins Involved in Spheroid Formation and Angiogenesis in Endothelial Cells After Long-Term Exposure to Simulated Microgravity. Cell Physiol. Biochem. 2018, 45, 429–445. [Google Scholar] [CrossRef] [PubMed]
- Wehland, M.; Steinwerth, P.; Aleshcheva, G.; Sahana, J.; Hemmersbach, R.; Lutzenberg, R.; Kopp, S.; Infanger, M.; Grimm, D. Tissue Engineering of Cartilage Using a Random Positioning Machine. Int. J. Mol. Sci. 2020, 21, 9596. [Google Scholar] [CrossRef]
- Aleshcheva, G.; Sahana, J.; Ma, X.; Hauslage, J.; Hemmersbach, R.; Egli, M.; Infanger, M.; Bauer, J.; Grimm, D. Changes in morphology, gene expression and protein content in chondrocytes cultured on a random positioning machine. PLoS ONE 2013, 8, e79057. [Google Scholar] [CrossRef]
- Baker, T.L.; Goodwin, T.J. Three-dimensional culture of bovine chondrocytes in rotating-wall vessels. Vitr. Cell Dev. Biol. Anim. 1997, 33, 358–365. [Google Scholar] [CrossRef]
- Mellor, L.F.; Baker, T.L.; Brown, R.J.; Catlin, L.W.; Oxford, J.T. Optimal 3D culture of primary articular chondrocytes for use in the rotating wall vessel bioreactor. Aviat. Space Environ. Med. 2014, 85, 798–804. [Google Scholar] [CrossRef]
- Marlovits, S.; Tichy, B.; Truppe, M.; Gruber, D.; Schlegel, W. Collagen expression in tissue engineered cartilage of aged human articular chondrocytes in a rotating bioreactor. Int. J. Artif. Organ. 2003, 26, 319–330. [Google Scholar] [CrossRef]
- Marlovits, S.; Tichy, B.; Truppe, M.; Gruber, D.; Vecsei, V. Chondrogenesis of aged human articular cartilage in a scaffold-free bioreactor. Tissue Eng. 2003, 9, 1215–1226. [Google Scholar] [CrossRef] [PubMed]
- Kopp, S.; Slumstrup, L.; Corydon, T.J.; Sahana, J.; Aleshcheva, G.; Islam, T.; Magnusson, N.E.; Wehland, M.; Bauer, J.; Infanger, M.; et al. Identifications of novel mechanisms in breast cancer cells involving duct-like multicellular spheroid formation after exposure to the Random Positioning Machine. Sci. Rep. 2016, 6, 26887. [Google Scholar] [CrossRef] [PubMed]
- Nalesso, G.; Thorup, A.S.; Eldridge, S.E.; De Palma, A.; Kaur, A.; Peddireddi, K.; Blighe, K.; Rana, S.; Stott, B.; Vincent, T.L.; et al. Calcium calmodulin kinase II activity is required for cartilage homeostasis in osteoarthritis. Sci. Rep. 2021, 11, 5682. [Google Scholar] [CrossRef] [PubMed]
- Meyer, F.; Dittmann, A.; Kornak, U.; Herbster, M.; Pap, T.; Lohmann, C.H.; Bertrand, J. Chondrocytes From Osteoarthritic and Chondrocalcinosis Cartilage Represent Different Phenotypes. Front. Cell Dev. Biol. 2021, 9, 622287. [Google Scholar] [CrossRef] [PubMed]
- Stolberg-Stolberg, J.; Boettcher, A.; Sambale, M.; Stuecker, S.; Sherwood, J.; Raschke, M.; Pap, T.; Bertrand, J. Toll-like receptor 3 activation promotes joint degeneration in osteoarthritis. Cell Death Dis. 2022, 13, 224. [Google Scholar] [CrossRef] [PubMed]
- Joksiene, J.; Sahana, J.; Wehland, M.; Schulz, H.; Cortes-Sanchez, J.L.; Prat-Duran, J.; Grimm, D.; Simonsen, U. Effects of High Glucose on Human Endothelial Cells Exposed to Simulated Microgravity. Biomolecules 2023, 13, 189. [Google Scholar] [CrossRef]
- Snel, B.; Lehmann, G.; Bork, P.; Huynen, M.A. STRING: A web-server to retrieve and display the repeatedly occurring neighbourhood of a gene. Nucleic Acids Res. 2000, 28, 3442–3444. [Google Scholar] [CrossRef]
- Aleshcheva, G.; Wehland, M.; Sahana, J.; Bauer, J.; Corydon, T.J.; Hemmersbach, R.; Frett, T.; Egli, M.; Infanger, M.; Grosse, J.; et al. Moderate alterations of the cytoskeleton in human chondrocytes after short-term microgravity produced by parabolic flight maneuvers could be prevented by up-regulation of BMP-2 and SOX-9. FASEB J. 2015, 29, 2303–2314. [Google Scholar] [CrossRef]
- Wehland, M.; Aleshcheva, G.; Schulz, H.; Saar, K.; Hubner, N.; Hemmersbach, R.; Braun, M.; Ma, X.; Frett, T.; Warnke, E.; et al. Differential gene expression of human chondrocytes cultured under short-term altered gravity conditions during parabolic flight maneuvers. Cell Commun. Signal 2015, 13, 18. [Google Scholar] [CrossRef]
- Hader, D.P.; Braun, M.; Grimm, D.; Hemmersbach, R. Gravireceptors in eukaryotes-a comparison of case studies on the cellular level. NPJ Microgravity 2017, 3, 13. [Google Scholar] [CrossRef]
- Cialdai, F.; Brown, A.M.; Baumann, C.W.; Angeloni, D.; Baatout, S.; Benchoua, A.; Bereiter-Hahn, J.; Bottai, D.; Buchheim, J.I.; Calvaruso, M.; et al. How do gravity alterations affect animal and human systems at a cellular/tissue level? NPJ Microgravity 2023, 9, 84. [Google Scholar] [CrossRef] [PubMed]
- Riwaldt, S.; Pietsch, J.; Sickmann, A.; Bauer, J.; Braun, M.; Segerer, J.; Schwarzwalder, A.; Aleshcheva, G.; Corydon, T.J.; Infanger, M.; et al. Identification of proteins involved in inhibition of spheroid formation under microgravity. Proteomics 2015, 15, 2945–2952. [Google Scholar] [CrossRef] [PubMed]
- Unsworth, B.R.; Lelkes, P.I. Growing tissues in microgravity. Nat. Med. 1998, 4, 901–907. [Google Scholar] [CrossRef] [PubMed]
- Schwarz, R.P.; Goodwin, T.J.; Wolf, D.A. Cell culture for three-dimensional modeling in rotating-wall vessels: An application of simulated microgravity. J. Tissue Cult. Methods 1992, 14, 51–57. [Google Scholar] [CrossRef]
- Jessup, J.M.; Goodwin, T.J.; Spaulding, G. Prospects for use of microgravity-based bioreactors to study three-dimensional host-tumor interactions in human neoplasia. J. Cell Biochem. 1993, 51, 290–300. [Google Scholar] [CrossRef] [PubMed]
- Becker, J.L. Women’s health issues and space-based medical technologies. Earth Space Rev. 1994, 3, 15–19. [Google Scholar] [PubMed]
- Freed, L.E.; Vunjak-Novakovic, G.; Langer, R. Cultivation of cell-polymer cartilage implants in bioreactors. J. Cell Biochem. 1993, 51, 257–264. [Google Scholar] [CrossRef]
- Conza, N.; Mainil-Varlet, P.; Rieser, F.; Kraemer, J.; Bittmann, P.; Huijser, R.; van den Bergh, L.; Cogoli, A. Tissue engineering in space. J. Gravit. Physiol. 2001, 8, P17–P20. [Google Scholar]
- Gu, J.; Lu, Y.; Li, F.; Qiao, L.; Wang, Q.; Li, N.; Borgia, J.A.; Deng, Y.; Lei, G.; Zheng, Q. Identification and characterization of the novel Col10a1 regulatory mechanism during chondrocyte hypertrophic differentiation. Cell Death Dis. 2014, 5, e1469. [Google Scholar] [CrossRef]
- Komori, T. Runx2, an inducer of osteoblast and chondrocyte differentiation. Histochem. Cell Biol. 2018, 149, 313–323. [Google Scholar] [CrossRef]
- Ogawa, H.; Kozhemyakina, E.; Hung, H.H.; Grodzinsky, A.J.; Lassar, A.B. Mechanical motion promotes expression of Prg4 in articular cartilage via multiple CREB-dependent, fluid flow shear stress-induced signaling pathways. Genes. Dev. 2014, 28, 127–139. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.; Ecker, M. Overview of MMP-13 as a Promising Target for the Treatment of Osteoarthritis. Int. J. Mol. Sci. 2021, 22, 1742. [Google Scholar] [CrossRef]
- Wiegertjes, R.; van de Loo, F.A.J.; Blaney Davidson, E.N. A roadmap to target interleukin-6 in osteoarthritis. Rheumatology 2020, 59, 2681–2694. [Google Scholar] [CrossRef] [PubMed]
- Song, H.; Park, K.H. Regulation and function of SOX9 during cartilage development and regeneration. Semin. Cancer Biol. 2020, 67, 12–23. [Google Scholar] [CrossRef] [PubMed]
- Fitzgerald, J.; Endicott, J.; Hansen, U.; Janowitz, C. Articular cartilage and sternal fibrocartilage respond differently to extended microgravity. NPJ Microgravity 2019, 5, 3. [Google Scholar] [CrossRef] [PubMed]
- Roughley, P.J.; Mort, J.S. The role of aggrecan in normal and osteoarthritic cartilage. J. Exp. Orthop. 2014, 1, 8. [Google Scholar] [CrossRef] [PubMed]
- Takahata, Y.; Hagino, H.; Kimura, A.; Urushizaki, M.; Yamamoto, S.; Wakamori, K.; Murakami, T.; Hata, K.; Nishimura, R. Regulatory Mechanisms of Prg4 and Gdf5 Expression in Articular Cartilage and Functions in Osteoarthritis. Int. J. Mol. Sci. 2022, 23, 4672. [Google Scholar] [CrossRef]
- Li, Y.; Xiao, W.; Sun, M.; Deng, Z.; Zeng, C.; Li, H.; Yang, T.; Li, L.; Luo, W.; Lei, G. The Expression of Osteopontin and Wnt5a in Articular Cartilage of Patients with Knee Osteoarthritis and Its Correlation with Disease Severity. Biomed. Res. Int. 2016, 2016, 9561058. [Google Scholar] [CrossRef]
- Cabral-Pacheco, G.A.; Garza-Veloz, I.; Castruita-De la Rosa, C.; Ramirez-Acuna, J.M.; Perez-Romero, B.A.; Guerrero-Rodriguez, J.F.; Martinez-Avila, N.; Martinez-Fierro, M.L. The Roles of Matrix Metalloproteinases and Their Inhibitors in Human Diseases. Int. J. Mol. Sci. 2020, 21, 9739. [Google Scholar] [CrossRef]
- Nagata, K.; Hojo, H.; Chang, S.H.; Okada, H.; Yano, F.; Chijimatsu, R.; Omata, Y.; Mori, D.; Makii, Y.; Kawata, M.; et al. Runx2 and Runx3 differentially regulate articular chondrocytes during surgically induced osteoarthritis development. Nat. Commun. 2022, 13, 6187. [Google Scholar] [CrossRef]
- Liu, S.; Deng, Z.; Chen, K.; Jian, S.; Zhou, F.; Yang, Y.; Fu, Z.; Xie, H.; Xiong, J.; Zhu, W. Cartilage tissue engineering: From proinflammatory and anti-inflammatory cytokines to osteoarthritis treatments (Review). Mol. Med. Rep. 2022, 25, 99. [Google Scholar] [CrossRef] [PubMed]
- Cucchiarini, M.; Thurn, T.; Weimer, A.; Kohn, D.; Terwilliger, E.F.; Madry, H. Restoration of the extracellular matrix in human osteoarthritic articular cartilage by overexpression of the transcription factor SOX9. Arthritis Rheum. 2007, 56, 158–167. [Google Scholar] [CrossRef] [PubMed]
- Peacock, J.D.; Huk, D.J.; Ediriweera, H.N.; Lincoln, J. Sox9 transcriptionally represses Spp1 to prevent matrix mineralization in maturing heart valves and chondrocytes. PLoS ONE 2011, 6, e26769. [Google Scholar] [CrossRef] [PubMed]
- Schuerwegh, A.J.; Dombrecht, E.J.; Stevens, W.J.; Van Offel, J.F.; Bridts, C.H.; De Clerck, L.S. Influence of pro-inflammatory (IL-1 alpha, IL-6, TNF-alpha, IFN-gamma) and anti-inflammatory (IL-4) cytokines on chondrocyte function. Osteoarthr. Cartil. 2003, 11, 681–687. [Google Scholar] [CrossRef] [PubMed]
- Hwang, H.S.; Kim, H.A. Chondrocyte Apoptosis in the Pathogenesis of Osteoarthritis. Int. J. Mol. Sci. 2015, 16, 26035–26054. [Google Scholar] [CrossRef]
- Akiyama, H.; Chaboissier, M.C.; Martin, J.F.; Schedl, A.; de Crombrugghe, B. The transcription factor Sox9 has essential roles in successive steps of the chondrocyte differentiation pathway and is required for expression of Sox5 and Sox6. Genes. Dev. 2002, 16, 2813–2828. [Google Scholar] [CrossRef] [PubMed]
- Goldring, M.B.; Birkhead, J.R.; Suen, L.F.; Yamin, R.; Mizuno, S.; Glowacki, J.; Arbiser, J.L.; Apperley, J.F. Interleukin-1 beta-modulated gene expression in immortalized human chondrocytes. J. Clin. Investig. 1994, 94, 2307–2316. [Google Scholar] [CrossRef]
- Leong, D.J.; Gu, X.I.; Li, Y.; Lee, J.Y.; Laudier, D.M.; Majeska, R.J.; Schaffler, M.B.; Cardoso, L.; Sun, H.B. Matrix metalloproteinase-3 in articular cartilage is upregulated by joint immobilization and suppressed by passive joint motion. Matrix Biol. 2010, 29, 420–426. [Google Scholar] [CrossRef]
- Kwok, A.T.; Moore, J.E.; Rosas, S.; Kerr, B.A.; Andrews, R.N.; Nguyen, C.M.; Lee, J.; Furdui, C.M.; Collins, B.E.; Munley, M.T.; et al. Knee and Hip Joint Cartilage Damage from Combined Spaceflight Hazards of Low-Dose Radiation Less than 1 Gy and Prolonged Hindlimb Unloading. Radiat. Res. 2019, 191, 497–506. [Google Scholar] [CrossRef]
- Xie, L.; Li, Z.; Chen, Z.; Li, M.; Tao, J. ITGB1 alleviates osteoarthritis by inhibiting cartilage inflammation and apoptosis via activating cAMP pathway. J. Orthop. Surg. Res. 2023, 18, 849. [Google Scholar] [CrossRef]
- Xue, M.; Gong, S.; Dai, J.; Chen, G.; Hu, J. The Treatment of Fibrosis of Joint Synovium and Frozen Shoulder by Smad4 Gene Silencing in Rats. PLoS ONE 2016, 11, e0158093. [Google Scholar] [CrossRef] [PubMed]
- Yin, H.; Wang, Y.; Sun, X.; Cui, G.; Sun, Z.; Chen, P.; Xu, Y.; Yuan, X.; Meng, H.; Xu, W.; et al. Functional tissue-engineered microtissue derived from cartilage extracellular matrix for articular cartilage regeneration. Acta Biomater. 2018, 77, 127–141. [Google Scholar] [CrossRef] [PubMed]
- Ohyabu, Y.; Kida, N.; Kojima, H.; Taguchi, T.; Tanaka, J.; Uemura, T. Cartilaginous tissue formation from bone marrow cells using rotating wall vessel (RWV) bioreactor. Biotechnol. Bioeng. 2006, 95, 1003–1008. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer | Reverse Primer |
---|---|---|
18S rRNA | GGAGCCTGCGGCTTAATTT | CAACTAAGAACGGCCATGCA |
ACAN | TTCTGCTTCCGAGGTGTGTC | CCACCTGAGTGACGATCCAG |
ACTB | TGCCGACAGGATGCAGAAG | GCCGATCCACACGGAGTACT |
CASP3 | AACTGCTCCTTTTGCTGTGATCT | GCAGCAAACCTCAGGGAAAC |
CASP8 | TGCAAAAGCACGGGAGAAAG | CTCTTCAAAGGTCGTGGTCAAAG |
COL10A1 | GGGCAGAGGAAGCTTCAGAAA | TCTCAGATGGATTCTGCGTGC |
COL1A1 | ACGAAGACATCCCACCAATCAC | CGTTGTCGCAGACGCAGAT |
COL2A1 | GGCAATAGCAGGTTCACGTACA | CGATAACAGTCTTGCCCCACTT |
CXCL8 | TGGCAGCCTTCCTGATTTCT | GGGTGGAAAGGTTTGGAGTATG |
IL6 | CGGGAACGAAAGAGAAGCTCTA | GAGCAGCCCCAGGGAGAA |
ITGB1 | GAAAACAGCGCATATCTGGAAATT | CAGCCAATCAGTGATCCACAA |
LAMA1 | TGACTGACCTGGGTTCAGGA | TGCTAGCACTCCTTGCTTCC |
MMP1 | GTCAGGGGAGATCATCGGG | GAGCATCCCCTCCAATACCTG |
MMP13 | GGAGCCCTGATGTTTCCCAT | GTCTTCATCGCCTGGACCATA |
MMP3 | ACAAAGGATACAACAGGGACCAA | TAGAGTGGGTACATCAAAGCTTCAGT |
PRG4 | CCCCCAAACCACCAGTTGTA | ACGTGTCAGGAGTTGTGACC |
RUNX2 | TGATGACACTGCCACCTCTG | CCAGTTCTGAAGCACCTGCC |
RUNX3 | GTGGGCGAGGGAAGAGTTTC | CCTTGATGGCTCGGTGGTAG |
SOD3 | CTGGAAAGGTGCCCGACTCC | ATGTCTCGGATCCACTCCGC |
SOX6 | GCCACACATTAAGCG | TCCAGCGAGATCCTAAGATTTTG |
SOX9 | AGGAAGTCGGTGAAGAACGG | CGCCTTGAAGATGGCGTTG |
SPP1 | CGAGGTGATAGTGTGGTTTATGGA | CGTCTGTAGCATCAGGGTACTG |
TGFB1 | CACCCGCGTGCTAATGGT | AGAGCAACACGGGTTCAGGTA |
TUBB | CTGGACCGCATCTCTGTGTACTAC | GACCTGAGCGAACAGAGTCCAT |
VIM | TTCAGAGAGAGGAAGCCGAAAAC | AGATTCCACTTTGCGTTCAAGGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Steinwerth, P.; Bertrand, J.; Sandt, V.; Marchal, S.; Sahana, J.; Bollmann, M.; Schulz, H.; Kopp, S.; Grimm, D.; Wehland, M. Structural and Molecular Changes of Human Chondrocytes Exposed to the Rotating Wall Vessel Bioreactor. Biomolecules 2024, 14, 25. https://doi.org/10.3390/biom14010025
Steinwerth P, Bertrand J, Sandt V, Marchal S, Sahana J, Bollmann M, Schulz H, Kopp S, Grimm D, Wehland M. Structural and Molecular Changes of Human Chondrocytes Exposed to the Rotating Wall Vessel Bioreactor. Biomolecules. 2024; 14(1):25. https://doi.org/10.3390/biom14010025
Chicago/Turabian StyleSteinwerth, Paul, Jessica Bertrand, Viviann Sandt, Shannon Marchal, Jayashree Sahana, Miriam Bollmann, Herbert Schulz, Sascha Kopp, Daniela Grimm, and Markus Wehland. 2024. "Structural and Molecular Changes of Human Chondrocytes Exposed to the Rotating Wall Vessel Bioreactor" Biomolecules 14, no. 1: 25. https://doi.org/10.3390/biom14010025
APA StyleSteinwerth, P., Bertrand, J., Sandt, V., Marchal, S., Sahana, J., Bollmann, M., Schulz, H., Kopp, S., Grimm, D., & Wehland, M. (2024). Structural and Molecular Changes of Human Chondrocytes Exposed to the Rotating Wall Vessel Bioreactor. Biomolecules, 14(1), 25. https://doi.org/10.3390/biom14010025