Identification of Novel Coloboma Candidate Genes through Conserved Gene Expression Analyses across Four Vertebrate Species
Abstract
1. Introduction
2. Materials and Methods
2.1. Chicken Eye mRNA Sequencing
2.2. Transcript Quantification and Differential Gene Expression Analysis
2.3. In Silico Cross Species Differential Gene Expression Analysis
2.4. In Situ Hybridisation Gene Expression Analyses
2.5. Data Access at Genomics England, 100,000 Genomes Project
2.6. Zebrafish Husbandry
2.7. CRISPR/Cas9 Mutagenesis in Zebrafish
2.8. Phenotypic Assessments
3. Results
3.1. Transcriptomic Analyses during Chicken Optic Fissure Closure
3.2. Cross-Species In Silico Analysis of Optic Fissure Transcriptomes
3.3. In Situ Hybridization Analysis of Enriched Gene Expression in Chicken Optic Fissures
3.4. Coloboma Candidate Gene Targeting In Vivo
3.5. Screening MAC Cohorts for Human Variants in Novel OFC Genes
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Stoll, C.; Alembik, Y.; Dott, B.; Roth, M.P. Epidemiology of Congenital Eye Malformations in 131,760 Consecutive Births. Ophthalmic Paediatr. Genet. 1992, 13, 179–186. [Google Scholar] [CrossRef] [PubMed]
- Morrison, D.; FitzPatrick, D.; Hanson, I.; Williamson, K.; van Heyningen, V.; Fleck, B.; Jones, I.; Chalmers, J.; Campbell, H. National Study of Microphthalmia, Anophthalmia, and Coloboma (MAC) in Scotland: Investigation of Genetic Aetiology. J. Med. Genet. 2002, 39, 16–22. [Google Scholar] [CrossRef] [PubMed]
- Shah, S.P.; Taylor, A.E.; Sowden, J.C.; Ragge, N.; Russell-Eggitt, I.; Rahi, J.S.; Gilbert, C.E. Anophthalmos, Microphthalmos, and Coloboma in the United Kingdom: Clinical Features, Results of Investigations, and Early Management. Ophthalmology 2012, 119, 362–368. [Google Scholar] [CrossRef]
- Williamson, K.A.; FitzPatrick, D.R. The Genetic Architecture of Microphthalmia, Anophthalmia and Coloboma. Eur. J. Med. Genet. 2014, 57, 369–380. [Google Scholar] [CrossRef] [PubMed]
- Selzer, E.B.; Blain, D.; Hufnagel, R.B.; Lupo, P.J.; Mitchell, L.E.; Brooks, B.P. Review Article Review of Evidence for Environmental Causes of Uveal Coloboma. Surv. Ophthalmol. 2021, 67, 1031–1047. [Google Scholar] [CrossRef] [PubMed]
- Harding, P.; Moosajee, M. The Molecular Basis of Human Anophthalmia and Microphthalmia. J. Dev. Biol. 2019, 7, 16. [Google Scholar] [CrossRef]
- Patel, A.; Sowden, J.C. Genes and Pathways in Optic Fissure Closure. Semin. Cell Dev. Biol. 2017, 91, 55–65. [Google Scholar] [CrossRef]
- Sinn, R.; Wittbrodt, J. An Eye on Eye Development. Mech. Dev. 2013, 130, 347–358. [Google Scholar] [CrossRef]
- Fuhrmann, S. Eye Morphogenesis and Patterning of the Optic Vesicle. Curr. Top. Dev. Biol. 2010, 93, 61–84. [Google Scholar]
- Chow, R.L.; Lang, R.A. Early Eye Development in Vertebrates. Annu. Rev. Cell Dev. Biol. 2001, 17, 255–296. [Google Scholar] [CrossRef]
- Zhang, X.M.; Yang, X.J. Temporal and Spatial Effects of Sonic Hedgehog Signaling in Chick Eye Morphogenesis. Dev. Biol. 2001, 233, 271–290. [Google Scholar] [CrossRef] [PubMed]
- Barbieri, A.M.; Lupo, G.; Bulfone, A.; Andreazzoli, M.; Mariani, M.; Fougerousse, F.; Consalez, G.G.; Borsani, G.; Beckmann, J.S.; Barsacchi, G.; et al. A Homeobox Gene, Vax2, Controls the Patterning of the Eye Dorsoventral Axis. Proc. Natl. Acad. Sci. USA 1999, 96, 10729–10734. [Google Scholar] [CrossRef] [PubMed]
- Mui, S.H.; Kim, J.W.; Lemke, G.; Bertuzzi, S. Vax Genes Ventralize the Embryonic Eye. Genes Dev. 2005, 19, 1249–1259. [Google Scholar] [CrossRef] [PubMed]
- Adler, R.; Belecky-Adams, T.L. The Role of Bone Morphogenetic Proteins in the Differentiation of the Ventral Optic Cup. Development 2002, 129, 3161–3171. [Google Scholar] [CrossRef] [PubMed]
- Sehgal, R.; Karcavich, R.; Carlson, S.; Belecky-Adams, T.L. Ectopic Pax2 Expression in Chick Ventral Optic Cup Phenocopies Loss of Pax2 Expression. Dev. Biol. 2008, 319, 23–33. [Google Scholar] [CrossRef]
- Chan, B.H.C.; Moosajee, M.; Rainger, J. Closing the Gap: Mechanisms of Epithelial Fusion During Optic Fissure Closure. Front. Cell Dev. Biol. 2021, 8, 620774. [Google Scholar] [CrossRef]
- Hardy, H.; Prendergast, J.G.; Patel, A.; Dutta, S.; Trejo-Reveles, V.; Kroeger, H.; Yung, A.R.; Goodrich, L.V.; Brooks, B.; Sowden, J.C.; et al. Detailed Analysis of Chick Optic Fissure Closure Reveals Netrin-1 as an Essential Mediator of Epithelial Fusion. Elife 2019, 8, e43877. [Google Scholar] [CrossRef]
- Eckert, P.; Knickmeyer, M.D.; Heermann, S. In Vivo Analysis of Optic Fissure Fusion in Zebrafish: Pioneer Cells, Basal Lamina, Hyaloid Vessels, and How Fissure Fusion Is Affected by Bmp. Int. J. Mol. Sci. 2020, 21, 2760. [Google Scholar] [CrossRef]
- Shah, S.P.; Taylor, A.E.; Sowden, J.C.; Ragge, N.K.; Russell-Eggitt, I.; Rahi, J.S.; Gilbert, C.E. Anophthalmos, Microphthalmos, and Typical Coloboma in the United Kingdom: A Prospective Study of Incidence and Risk. Investig. Ophthalmol. Vis. Sci. 2011, 52, 558–564. [Google Scholar] [CrossRef]
- Harding, P.; Gore, S.; Malka, S.; Rajkumar, J.; Oluonye, N.; Moosajee, M. Real-World Clinical and Molecular Management of 50 Prospective Patients with Microphthalmia, Anophthalmia and/or Ocular Coloboma. Br. J. Ophthalmol. 2022. [Google Scholar] [CrossRef]
- Patel, A.; Hayward, J.D.; Tailor, V.; Nyanhete, R.; Ahlfors, H.; Gabriel, C.; Jannini, T.B.; Abbou-Rayyah, Y.; Henderson, R.; Nischal, K.K.; et al. The Oculome Panel Test: Next-Generation Sequencing to Diagnose a Diverse Range of Genetic Developmental Eye Disorders. Ophthalmology 2019, 126, 888–907. [Google Scholar] [CrossRef]
- Rainger, J.; Williamson, K.A.; Soares, D.C.; Truch, J.; Kurian, D.; Gillessen-Kaesbach, G.; Seawright, A.; Prendergast, J.; Halachev, M.; Wheeler, A.; et al. A Recurrent de Novo Mutation in ACTG1 Causes Isolated Ocular Coloboma. Hum. Mutat. 2017, 38, 942–946. [Google Scholar] [CrossRef]
- Jackson, D.; Malka, S.; Harding, P.; Palma, J.; Dunbar, H.; Moosajee, M. Molecular Diagnostic Challenges for Non-Retinal Developmental Eye Disorders in the United Kingdom. Am. J. Med. Genet. Part C Semin. Med. Genet. 2020, 184, 578–589. [Google Scholar] [CrossRef]
- Brown, J.D.; Dutta, S.; Bharti, K.; Bonner, R.F.; Munson, P.J.; Dawid, I.B.; Akhtar, A.L.; Onojafe, I.F.; Alur, R.P.; Gross, J.M.; et al. Expression Profiling during Ocular Development Identifies 2 Nlz Genes with a Critical Role in Optic Fissure Closure. Proc. Natl. Acad. Sci. USA 2009, 106, 1462–1467. [Google Scholar] [CrossRef] [PubMed]
- Richardson, R.; Owen, N.; Young, R.M.; Tracey-White, D.; Moosajee, M.; Toms, M. Transcriptome Profiling of Zebrafish Optic Fissure Fusion. Sci. Rep. 2019, 9, 1541. [Google Scholar] [CrossRef]
- Owen, N.M.; Toms, M.; Young, R.M.; Eintracht, J.; Sarkar, H.; Brooks, B.P.; Moosajee, M.; Ambrose, J.C.; Baple, E.L.; Bleda, M.; et al. Identification of 4 novel human ocular coloboma genes ANK3, BMPR1B, PDGFRA, and CDH4 through evolutionary conserved vertebrate gene analysis. Genet. Med. 2022, 24, 1073–1084. [Google Scholar] [CrossRef] [PubMed]
- Hamburger, V.; Hamilton, H.L. A Series of Normal Stages in the Development of the Chick Embryo. J. Morphol. 1951, 88, 49–92. [Google Scholar] [CrossRef]
- Martin, M. Cutadapt Removes Adapter Sequences from High-Throughput Sequencing Reads. Mol. Biol. Netw. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. 1000 Genome Project Data Processing Subgroup The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
- Liao, Y.; Smyth, G.K.; Shi, W. The Subread Aligner: Fast, Accurate and Scalable Read Mapping by Seed-and-Vote. Nucleic Acids Res. 2013, 41, e108. [Google Scholar] [CrossRef]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Benjamini, Y.; Hochberg, Y. Controlling The False Discovery Rate-A Practical And Powerful Approach To Multiple Testing. J. R. Stat. Soc. Ser. B Methodol. 1995, 57, 289–300. [Google Scholar] [CrossRef]
- Durinck, S.; Moreau, Y.; Kasprzyk, A.; Davis, S.; De Moor, B.; Brazma, A.; Huber, W. BioMart and Bioconductor: A Powerful Link between Biological Databases and Microarray Data Analysis. Bioinformatics 2005, 21, 3439–3440. [Google Scholar] [CrossRef]
- Durinck, S.; Spellman, P.; Birney, E.; Huber, W. Mapping Identifiers for the Integration of Genomic Datasets with the R/Bioconductor Package BiomaRt. Nat. Protoc. 2009, 4, 1184–1191. [Google Scholar] [CrossRef] [PubMed]
- Genomics England Research Consortium. 100,000 Genomes Pilot on Rare-Disease Diagnosis in Health Care—Preliminary Report. N. Engl. J. Med. 2021, 385, 1868–1880. [Google Scholar] [CrossRef]
- Köhler, S.; Carmody, L.; Vasilevsky, N.; Jacobsen, J.O.B.; Danis, D.; Gourdine, J.P.; Gargano, M.; Harris, N.L.; Matentzoglu, N.; McMurry, J.A.; et al. Expansion of the Human Phenotype Ontology (HPO) Knowledge Base and Resources. Nucleic Acids Res. 2019, 8, D1018–D1027. [Google Scholar] [CrossRef]
- Patel, A.; Anderson, G.; Galea, G.; Balys, M.; Sowden, J.C. A Molecular and Cellular Analysis of Human Embryonic Optic Fissure Closure Related to the Eye Malformation Coloboma. Development 2020, 147, dev193649. [Google Scholar] [CrossRef]
- Carrara, N.; Weaver, M.; Piedade, W.P.; Vöcking, O.; Famulski, J.K. Temporal Characterization of Optic Fissure Basement Membrane Composition Suggests Nidogen May Be an Initial Target of Remodeling. Dev. Biol. 2019, 452, 43–54. [Google Scholar] [CrossRef]
- Knickmeyer, M.D.; Mateo, J.L.; Eckert, P.; Roussa, E.; Rahhal, B.; Zuniga, A.; Krieglstein, K.; Wittbrodt, J.; Heermann, S. TGFb-Facilitated Optic Fissure Fusion and the Role of Bone Morphogenetic Protein Antagonism. Open Biol. 2018, 8, 170134. [Google Scholar] [CrossRef]
- Ishida, M.; Cullup, T.; Boustred, C.; James, C.; Docker, J.; English, C.; Lench, N.; Copp, A.J.; Moore, G.E.; Greene, N.; et al. A Targeted Sequencing Panel Identifies Rare Damaging Variants in Multiple Genes in the Cranial Neural Tube Defect, Anencephaly. Clin. Genet. 2018, 93, 870–879. [Google Scholar] [CrossRef] [PubMed]
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and Guidelines for the Interpretation of Sequence Variants: A Joint Consensus Recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–424. [Google Scholar] [CrossRef] [PubMed]
- Gestri, G.; Bazin-Lopez, N.; Scholes, C.; Wilson, S.W. Cell Behaviors during Closure of the Choroid Fissure in the Developing Eye. Front. Cell. Neurosci. 2018, 12, 42. [Google Scholar] [CrossRef] [PubMed]
- Bernstein, C.S.; Anderson, M.T.; Gohel, C.; Slater, K.; Gross, J.M.; Agarwala, S. The Cellular Bases of Choroid Fissure Formation and Closure. Dev. Biol. 2018, 440, 137–151. [Google Scholar] [CrossRef]
- Yoshida, M.; Suda, Y.; Matsuo, I.; Miyamoto, N.; Takeda, N.; Kuratani, S. Yoshida-1997 Emx1 and Emx2 Functions in Development of Dorsal Telencephalon. Development 1997, 111, 101–111. [Google Scholar] [CrossRef]
- Suda, Y.; Hossain, Z.M.; Kobayashi, C.; Hatano, O.; Yoshida, M.; Matsuo, I.; Aizawa, S. Emx2 Directs the Development of Diencephalon in Cooperation with Otx2. Development 2001, 128, 2433–2450. [Google Scholar] [CrossRef]
- Cecchi, C. Emx2: A Gene Responsible for Cortical Development, Regionalization and Area Specification. Gene 2002, 291, 1–9. [Google Scholar] [CrossRef]
- Klein, R. Eph/Ephrin Signalling during Development. Development 2012, 139, 4105–4109. [Google Scholar] [CrossRef]
- Zhao, K.; He, J.; Wang, Y.-F.; Jin, S.-D.; Fan, Y.; Fang, N.; Qian, J.; Xu, T.P.; Guo, R.-H. EZH2-Mediated Epigenetic Suppression of EphB3 Inhibits Gastric Cancer Proliferation and Metastasis by Affecting E-Cadherin and Vimentin Expression. Gene 2019, 686, 118–124. [Google Scholar] [CrossRef]
- Shi, Y.; DeMaria, A.; Bennett, T.; Shiels, A.; Bassnett, S.A. Role for Epha2 in Cell Migration and Refractive Organization of the Ocular Lens. Invest. Ophthalmol. Vis. Sci. 2012, 53, 551–559. [Google Scholar] [CrossRef]
- Jun, G.; Guo, H.; Klein, B.E.K.; Klein, R.; Wang, J.J.; Mitchell, P.; Miao, H.; Lee, K.E.; Joshi, T.; Buck, M.; et al. EPHA2 Is Associated with Age-Related Cortical Cataract in Mice and Humans. PLoS Genet. 2009, 5, e1000584. [Google Scholar] [CrossRef]
- Lee, J.; Lee, B.K.; Gross, J.M. Bcl6a Function Is Required during Optic Cup Formation to Prevent P53-Dependent Apoptosis and Colobomata. Hum. Mol. Genet. 2013, 22, 3568–3582. [Google Scholar] [CrossRef]
- Coopera, M.A.; Sona, A.I.; Komlosb, D.; Suna, Y.; Kleimanc, N.J.; Zhoua, R. Loss of Ephrin-A5 Function Disrupts Lens Fiber Cell Packing and Leads to Cataract. Proc. Natl. Acad. Sci. USA 2008, 105, 16620–16625. [Google Scholar] [CrossRef] [PubMed]
- Harding, P.; Toms, M.; Schiff, E.; Owen, N.; Bell, S.; Lloyd, I.C.; Moosajee, M. EPHA2 Segregates with Microphthalmia and Congenital Cataracts in Two Unrelated Families. Int. J. Mol. Sci. 2021, 22, 2190. [Google Scholar] [CrossRef]
- Courdier, C.; Gemahling, A.; Guindolet, D.; Barjol, A.; Scaramouche, C.; Bouneau, L.; Calvas, P.; Martin, G.; Chassaing, N.; Plaisancié, J. EPHA2 Biallelic Disruption Causes Syndromic Complex Microphthalmia with Iris Hypoplasia. Eur. J. Med. Genet. 2022, 65, 104574. [Google Scholar] [CrossRef] [PubMed]
- Benetti, E.; Artifoni, L.; Salviati, L.; Pinello, L.; Perrotta, S.; Zuffardi, O.; Zacchello, G.; Murer, L. Renal Hypoplasia without Optic Coloboma Associated with PAX2 Gene Deletion. Nephrol. Dial. Transplant. 2007, 22, 2076–2078. [Google Scholar] [CrossRef] [PubMed]
- Gregory-Evans, C.Y.; Williams, M.J.; Halford, S.; Gregory-Evans, K. Ocular Coloboma: A Reassessment in the Age of Molecular Neuroscience. J. Med. Genet. 2004, 41, 881–891. [Google Scholar] [CrossRef] [PubMed]
- Sanyanusin, P.; Schimmenti, L.A.; McNoe, L.A.; Ward, T.A.; Pierpont, M.E.; Sullivan, M.J.; Dobyns, W.B.; Eccles, M.R. Mutation of the PAX2 Gene in a Family with Optic Nerve Colobomas, Renal Anomalies and Vesicoureteral Reflux. Nat. Genet. 1995, 9, 358–364. [Google Scholar] [CrossRef]
mRNA Target | Name of Probe | Channel | Catalogue Number |
---|---|---|---|
TENM3 | Gg-TENM3-C2 | C2 | 1147351-C2 |
EMX2 (Transcript variant X1) | Gg-EMX2-C2 | C2 | 1060951-C2 |
PAX2 | Gg-PAX2-C2 | C2 | 1147371-C2 |
EPHB3 (Transcript variant X7) | Gg-EPHB3-C2 | C2 | 458861-C2 |
NID1 | Gg-NID1-C1 | C1 | 1147381-C1 |
ALDH1A3 | Gg-ALDH1A3-C2 | C2 | 1144151-C2 |
BMPR1B | Gg-BMPR1B-C1 | C1 | 1144161-C1 |
VAX1 | Gg-VAX1-C1 | C1 | 1144181-C1 |
SMOC1 (Transcript variant X4) | Gg-SMOC1-C2 | C2 | 593601-C2 |
NTN1 | Gg-NTN1-C2 | C2 | 497491-C2 |
Gene | CRISPR Guide Sequence (5′−3′) | Primer Sequences (5′−3′) |
---|---|---|
emx2 | CGAGGAGCCCATACGACCAG | Forward: CACGATGTGTTGAGCTGTGC Reverse: CCTTTGCTGGCTTGCGAAAA |
ephb3a | ATGACCACTTGAGCCCCATC | Forward: TTACATTCCACCTGCTTACACC Reverse: ACATAAGGATTCTCCCTCCACG |
ephb3b | ACACTTGGTACGTTCGGATG | Forward: GCAGTACCTTTGCAGCGTAAC Reverse: GAAGCTCTCATCCGGAGCAA |
Family | HPO Terms | Gene | cDNA/GRCh38 | Protein | SIFT | Polyphen-2 | Mutation Taster | REVEL | PhyloP100 | CADD | gnomAD |
---|---|---|---|---|---|---|---|---|---|---|---|
F1 | Optic nerve coloboma, moderate proteinuria, stage 3 chronic kidney disease | EPHB3 | NM_004443.4 c.649 G>A 3:184572969:G:T | p.(Ala217Thr) | Tolerated | Probably Damaging | Disease Causing | 0.27 | 7.965 | 24.7 | 0.001% |
F2 | Intellectual disability, autism, microphthalmia, seizures, true anophthalmia | EPHB3 | NM_004443.4 c.1259 G>A 3:184577088:G:A | p.(Arg420His) | Benign | Probably Damaging | Disease Causing | 0.069 | 3.343 | 22.6 | 3 × 10−5 |
F3 | Chorioretinal coloboma, macrocephaly, unilateral cleft lip, sleep apnea, abnormal aggressive impulsive or violent behaviour | NID1 | NM_002508.3 c.2204 G>A 1:236017198:C:T | p.(Arg735His) | Deleterious | Possibly Damaging | Disease Causing | 0.575 | 7.456 | 24.04 | 0.016 |
F4 | Bilateral retinal coloboma, mild global developmental delay, abnormality of the vertebrae, bulbar palsy, Sprengel anomaly, abnormality of the ear, skeletal system, nervous system | NID1 | NM_002508.3 c.3458 C>G 1:235979873:G:C | p.(Pro1153Arg) | Pathogenic | Probably Damaging | Uncertain | 0.671 | 10.003 | 25.9 | NF |
F5 | Retinal coloboma, anterior segment dysgenesis, microphthalmia, chorioretinal coloboma, iris coloboma | NID1 | NM_002508.3 c.2859 G>T 1:235990955:C:A | p.(Lys953Asn) | Uncertain | Probably Damaging | Uncertain | 0.192 | 1.649 | 24.4 | NF |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Trejo-Reveles, V.; Owen, N.; Ching Chan, B.H.; Toms, M.; Schoenebeck, J.J.; Moosajee, M.; Rainger, J., on behalf of Genomics England Research Consortium. Identification of Novel Coloboma Candidate Genes through Conserved Gene Expression Analyses across Four Vertebrate Species. Biomolecules 2023, 13, 293. https://doi.org/10.3390/biom13020293
Trejo-Reveles V, Owen N, Ching Chan BH, Toms M, Schoenebeck JJ, Moosajee M, Rainger J on behalf of Genomics England Research Consortium. Identification of Novel Coloboma Candidate Genes through Conserved Gene Expression Analyses across Four Vertebrate Species. Biomolecules. 2023; 13(2):293. https://doi.org/10.3390/biom13020293
Chicago/Turabian StyleTrejo-Reveles, Violeta, Nicholas Owen, Brian Ho Ching Chan, Maria Toms, Jeffrey J. Schoenebeck, Mariya Moosajee, and Joe Rainger on behalf of Genomics England Research Consortium. 2023. "Identification of Novel Coloboma Candidate Genes through Conserved Gene Expression Analyses across Four Vertebrate Species" Biomolecules 13, no. 2: 293. https://doi.org/10.3390/biom13020293
APA StyleTrejo-Reveles, V., Owen, N., Ching Chan, B. H., Toms, M., Schoenebeck, J. J., Moosajee, M., & Rainger, J., on behalf of Genomics England Research Consortium. (2023). Identification of Novel Coloboma Candidate Genes through Conserved Gene Expression Analyses across Four Vertebrate Species. Biomolecules, 13(2), 293. https://doi.org/10.3390/biom13020293