Multi-Omics Analysis of Multiple Glucose-Sensing Receptor Systems in Yeast
Abstract
:1. Introduction
2. Materials and Methods
2.1. Yeast Strains
2.2. Sample Preparation for RNA-seq
2.3. RNA Sequence Analysis
2.4. Transcriptomics Pathway Enrichment Analysis and Over-Representation Analysis
2.5. Sample Preparation for Metabolomics
2.6. UHPLC High-Resolution Orbitrap MS Metabolomics Data Acquisition
2.7. Metabolomics Data Normalization and Filtration
2.8. In-House Compound Identification and Annotation
2.9. Compound Annotation, Metabolic Pathway Enrichment Analysis and Over-Representation Analysis
2.10. Integration of Transcriptomics and Metabolomics Data
2.11. Yeast RNA Extraction, DNase Treatment, and Reverse Transcription for qPCR
2.12. qPCR
YER100W_FWD primer | 5′ GAAGCCACGACAGGATCAAT 3′ |
YER100W_REV primer | 5′ ATCCCCCTCATCCAATTTTC 3′ |
YBR117C_FWD | 5′ GTCACTCATGCGCTCTTCTG 3′ |
YBR117C_REV | 5′ GAGTCGGAAATGGGAAAGCC 3′ |
YPL061W_FWD | 5′ GGCGCCAAGATCTTAACTGG 3′ |
YPL061W_REV | 5′ CCACCTTCAAACCTGTGCTC 3′ |
YJL153C_FWD | 5′ CATGGTTAGCCCAAACGACT 3′ |
YJL153C_REV | 5′ CGTGGTTACGTTGCCTTTTT 3′ |
YFL030W_FWD | 5′ TGATCCCAGGCCCCATTATC 3′ |
YFL030W_REV | 5′ AATATGTCCCACCCCAACGT 3′ |
3. Results
3.1. Unsupervised Principal Component Analysis (PCA)
3.2. Glucose Sensing in Wildtype Cells
3.3. Comparison of Glucose Signaling by the GPCR and Transceptor Systems
3.4. Comparison of Glucose Signaling through Large and Small G Proteins
3.5. Ras2 Integrates Signals from Gpr1 and Snf3/Rgt2
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kresnowati, M.T.; van Winden, W.A.; Almering, M.J.; ten Pierick, A.; Ras, C.; Knijnenburg, T.A.; Daran-Lapujade, P.; Pronk, J.T.; Heijnen, J.J.; Daran, J.M. When transcriptome meets metabolome: Fast cellular responses of yeast to sudden relief of glucose limitation. Mol. Syst. Biol. 2006, 2, 49. [Google Scholar] [CrossRef] [PubMed]
- Castrillo, J.I.; Zeef, L.A.; Hoyle, D.C.; Zhang, N.; Hayes, A.; Gardner, D.C.; Cornell, M.J.; Petty, J.; Hakes, L.; Wardleworth, L.; et al. Growth control of the eukaryote cell: A systems biology study in yeast. J. Biol. 2007, 6, 4. [Google Scholar] [CrossRef] [PubMed]
- Gutteridge, A.; Pir, P.; Castrillo, J.I.; Charles, P.D.; Lilley, K.S.; Oliver, S.G. Nutrient control of eukaryote cell growth: A systems biology study in yeast. BMC Biol. 2010, 8, 68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dikicioglu, D.; Karabekmez, E.; Rash, B.; Pir, P.; Kirdar, B.; Oliver, S.G. How yeast re-programmes its transcriptional profile in response to different nutrient impulses. BMC Syst. Biol. 2011, 5, 148. [Google Scholar] [CrossRef] [Green Version]
- Yun, C.W.; Tamaki, H.; Nakayama, R.; Yamamoto, K.; Kumagai, H. G-protein coupled receptor from yeast Saccharomyces cerevisiae. Biochem. Biophys. Res. Commun. 1997, 240, 287–292. [Google Scholar] [CrossRef]
- Yun, C.W.; Tamaki, H.; Nakayama, R.; Yamamoto, K.; Kumagai, H. Gpr1p, a putative G-protein coupled receptor, regulates glucose- dependent cellular cAMP level in yeast Saccharomyces cerevisiae. Biochem. Biophys. Res. Commun. 1998, 252, 29–33. [Google Scholar] [CrossRef]
- Xue, Y.; Batlle, M.; Hirsch, J.P. GPR1 encodes a putative G protein-coupled receptor that associates with the Gpa2p Galpha subunit and functions in a Ras-independen t pathway. EMBO J. 1998, 17, 1996–2007. [Google Scholar] [CrossRef]
- Colombo, S.; Ma, P.; Cauwenberg, L.; Winderickx, J.; Crauwels, M.; Teunissen, A.; Nauwelaers, D.; de Winde, J.H.; Gorwa, M.F.; Colavizza, D.; et al. Involvement of distinct G-proteins, Gpa2 and Ras, in glucose- and intracellular acidification-induced cAMP signalling in the yeast Saccharomyces cerevisiae. EMBO J. 1998, 17, 3326–3341. [Google Scholar] [CrossRef] [Green Version]
- Kraakman, L.; Lemaire, K.; Ma, P.; Teunissen, A.W.; Donaton, M.C.; Van Dijck, P.; Winderickx, J.; de Winde, J.H.; Thevelein, J.M. A Saccharomyces cerevisiae G-protein coupled receptor, Gpr1, is specifically required for glucose activation of the cAMP pathway during the transition to growth on glucose. Mol. Microbiol. 1999, 32, 1002–1012. [Google Scholar] [CrossRef]
- Lorenz, M.C.; Pan, X.; Harashima, T.; Cardenas, M.E.; Xue, Y.; Hirsch, J.P.; Heitman, J. The G protein-coupled receptor gpr1 is a nutrient sensor that regulates pseudohyphal differentiation in Saccharomyces cerevisiae. Genetics 2000, 154, 609–622. [Google Scholar] [CrossRef]
- Lemaire, K.; Van de Velde, S.; Van Dijck, P.; Thevelein, J.M. Glucose and sucrose act as agonist and mannose as antagonist ligands of the G protein-coupled receptor Gpr1 in the yeast Saccharomyces cerevisiae. Mol. Cell 2004, 16, 293–299. [Google Scholar] [CrossRef] [Green Version]
- Zeller, C.E.; Parnell, S.C.; Dohlman, H.G. The RACK1 ortholog Asc1 functions as a G-protein beta subunit coupled to glucose responsiveness in yeast. J. Biol. Chem. 2007, 282, 25168–25176. [Google Scholar] [CrossRef] [Green Version]
- Li, S.; Li, Y.; Rushing, B.R.; Harris, S.E.; McRitchie, S.L.; Jones, J.C.; Dominguez, D.; Sumner, S.J.; Dohlman, H.G. Multi-omics analysis of glucose-mediated signaling by a moonlighting Gbeta protein Asc1/RACK1. PLoS Genet. 2021, 17, e1009640. [Google Scholar] [CrossRef]
- Broek, D.; Toda, T.; Michaeli, T.; Levin, L.; Birchmeier, C.; Zoller, M.; Powers, S.; Wigler, M. The S. cerevisiae CDC25 gene product regulates the RAS/adenylate cyclase pathway. Cell 1987, 48, 789–799. [Google Scholar] [CrossRef]
- Munder, T.; Kuntzel, H. Glucose-induced cAMP signaling in Saccharomyces cerevisiae is mediated by the CDC25 protein. FEBS Lett. 1989, 242, 341–345. [Google Scholar] [CrossRef] [Green Version]
- Crechet, J.B.; Poullet, P.; Mistou, M.Y.; Parmeggiani, A.; Camonis, J.; Boy-Marcotte, E.; Damak, F.; Jacquet, M. Enhancement of the GDP-GTP exchange of RAS proteins by the carboxyl-terminal domain of SCD25. Science 1990, 248, 866–868. [Google Scholar] [CrossRef]
- Jones, S.; Vignais, M.L.; Broach, J.R. The CDC25 protein of Saccharomyces cerevisiae promotes exchange of guanine nucleotides bound to ras. Mol. Cell. Biol. 1991, 11, 2641–2646. [Google Scholar]
- Papasavvas, S.; Arkinstall, S.; Reid, J.; Payton, M. Yeast alpha-mating factor receptor and G-protein-linked adenylyl cyclase inhibition requires RAS2 and GPA2 activities. Biochem. Biophys. Res. Commun. 1992, 184, 1378–1385. [Google Scholar] [CrossRef]
- Boy-Marcotte, E.; Ikonomi, P.; Jacquet, M. SDC25, a dispensable Ras guanine nucleotide exchange factor of Saccharomyces cerevisiae differs from CDC25 by its regulation. Mol. Biol. Cell 1996, 7, 529–539. [Google Scholar] [CrossRef] [Green Version]
- Gross, A.; Winograd, S.; Marbach, I.; Levitzki, A. The N-terminal half of Cdc25 is essential for processing glucose signaling in Saccharomyces cerevisiae. Biochemistry 1999, 38, 13252–13262. [Google Scholar] [CrossRef]
- VanderSluis, B.; Hess, D.C.; Pesyna, C.; Krumholz, E.W.; Syed, T.; Szappanos, B.; Nislow, C.; Papp, B.; Troyanskaya, O.G.; Myers, C.L.; et al. Broad metabolic sensitivity profiling of a prototrophic yeast deletion collection. Genome Biol. 2014, 15, R64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Powers, S.; Kataoka, T.; Fasano, O.; Goldfarb, M.; Strathern, J.; Broach, J.; Wigler, M. Genes in S. cerevisiae encoding proteins with domains homologous to the mammalian ras proteins. Cell 1984, 36, 607–612. [Google Scholar] [CrossRef]
- Toda, T.; Uno, I.; Ishikawa, T.; Powers, S.; Kataoka, T.; Broek, D.; Cameron, S.; Broach, J.; Matsumoto, K.; Wigler, M. In yeast, RAS proteins are controlling elements of adenylate cyclase. Cell 1985, 40, 27–36. [Google Scholar] [CrossRef]
- Uno, I.; Mitsuzawa, H.; Matsumoto, K.; Tanaka, K.; Oshima, T.; Ishikawa, T. Reconstitution of the GTP-dependent adenylate cyclase from products of the yeast CYR1 and RAS2 genes in Escherichia coli. Proc. Natl. Acad. Sci. USA 1985, 82, 7855–7859. [Google Scholar] [CrossRef] [Green Version]
- Field, J.; Nikawa, J.; Broek, D.; MacDonald, B.; Rodgers, L.; Wilson, I.A.; Lerner, R.A.; Wigler, M. Purification of a RAS-responsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method. Mol. Cell. Biol. 1988, 8, 2159–2165. [Google Scholar]
- Nakafuku, M.; Obara, T.; Kaibuchi, K.; Miyajima, I.; Miyajima, A.; Itoh, H.; Nakamura, S.; Arai, K.; Matsumoto, K.; Kaziro, Y. Isolation of a second yeast Saccharomyces cerevisiae gene (GPA2) coding for guanine nucleotide-binding regulatory protein: Studies on its structure and possible functions. Proc. Natl. Acad. Sci. USA 1988, 85, 1374–1378. [Google Scholar] [CrossRef] [Green Version]
- Field, J.; Xu, H.P.; Michaeli, T.; Ballester, R.; Sass, P.; Wigler, M.; Colicelli, J. Mutations of the adenylyl cyclase gene that block RAS function in Saccharomyces cerevisiae. Science 1990, 247, 464–467. [Google Scholar] [CrossRef]
- Suzuki, N.; Choe, H.R.; Nishida, Y.; Yamawaki-Kataoka, Y.; Ohnishi, S.; Tamaoki, T.; Kataoka, T. Leucine-rich repeats and carboxyl terminus are required for interaction of yeast adenylate cyclase with RAS proteins. Proc. Natl. Acad. Sci. USA 1990, 87, 8711–8715. [Google Scholar] [CrossRef] [Green Version]
- Mintzer, K.A.; Field, J. Interactions between adenylyl cyclase, CAP and RAS from Saccharomyces cerevisiae. Cell. Signal. 1994, 6, 681–694. [Google Scholar] [CrossRef]
- Bhattacharya, S.; Chen, L.; Broach, J.R.; Powers, S. Ras membrane targeting is essential for glucose signaling but not for viability in yeast. Proc. Natl. Acad. Sci. USA 1995, 92, 2984–2988. [Google Scholar] [CrossRef] [Green Version]
- Kubler, E.; Mosch, H.U.; Rupp, S.; Lisanti, M.P. Gpa2p, a G-protein alpha-subunit, regulates growth and pseudohyphal development in Saccharomyces cerevisiae via a cAMP-dependent mechanism. J. Biol. Chem. 1997, 272, 20321–20323. [Google Scholar] [CrossRef] [Green Version]
- Rolland, F.; De Winde, J.H.; Lemaire, K.; Boles, E.; Thevelein, J.M.; Winderickx, J. Glucose-induced cAMP signalling in yeast requires both a G-protein coupled receptor system for extracellular glucose detection and a separable hexose kinase-dependent sensing process. Mol. Microbiol. 2000, 38, 348–358. [Google Scholar] [CrossRef]
- Wang, Y.; Pierce, M.; Schneper, L.; Guldal, C.G.; Zhang, X.; Tavazoie, S.; Broach, J.R. Ras and Gpa2 mediate one branch of a redundant glucose signaling pathway in yeast. PLoS Biol. 2004, 2, E128. [Google Scholar] [CrossRef]
- Matsumoto, K.; Uno, I.; Oshima, Y.; Ishikawa, T. Isolation and characterization of yeast mutants deficient in adenylate cyclase and cAMP-dependent protein kinase. Proc. Natl. Acad. Sci. USA 1982, 79, 2355–2359. [Google Scholar] [CrossRef] [Green Version]
- Kataoka, T.; Broek, D.; Wigler, M. DNA sequence and characterization of the S. cerevisiae gene encoding adenylate cyclase. Cell 1985, 43, 493–505. [Google Scholar] [CrossRef]
- Casperson, G.F.; Walker, N.; Bourne, H.R. Isolation of the gene encoding adenylate cyclase in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 1985, 82, 5060–5063. [Google Scholar] [CrossRef] [Green Version]
- Harashima, T.; Heitman, J. The Galpha protein Gpa2 controls yeast differentiation by interacting with kelch repeat proteins that mimic Gbeta subunits. Mol. Cell 2002, 10, 163–173. [Google Scholar] [CrossRef]
- Toda, T.; Cameron, S.; Sass, P.; Zoller, M.; Scott, J.D.; McMullen, B.; Hurwitz, M.; Krebs, E.G.; Wigler, M. Cloning and characterization of BCY1, a locus encoding a regulatory subunit of the cyclic AMP-dependent protein kinase in Saccharomyces cerevisiae. Mol. Cell. Biol. 1987, 7, 1371–1377. [Google Scholar]
- Toda, T.; Cameron, S.; Sass, P.; Zoller, M.; Wigler, M. Three different genes in S. cerevisiae encode the catalytic subunits of the cAMP-dependent protein kinase. Cell 1987, 50, 277–287. [Google Scholar] [CrossRef]
- Cannon, J.F.; Tatchell, K. Characterization of Saccharomyces cerevisiae genes encoding subunits of cyclic AMP-dependent protein kinase. Mol. Cell. Biol. 1987, 7, 2653–2663. [Google Scholar]
- Robertson, L.S.; Fink, G.R. The three yeast A kinases have specific signaling functions in pseudohyphal growth. Proc. Natl. Acad. Sci. USA 1998, 95, 13783–13787. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pan, X.; Heitman, J. Cyclic AMP-dependent protein kinase regulates pseudohyphal differentiation in Saccharomyces cerevisiae. Mol. Cell. Biol. 1999, 19, 4874–4887. [Google Scholar] [CrossRef] [Green Version]
- Robertson, L.S.; Causton, H.C.; Young, R.A.; Fink, G.R. The yeast A kinases differentially regulate iron uptake and respiratory function. Proc. Natl. Acad. Sci. USA 2000, 97, 5984–5988. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ptacek, J.; Devgan, G.; Michaud, G.; Zhu, H.; Zhu, X.; Fasolo, J.; Guo, H.; Jona, G.; Breitkreutz, A.; Sopko, R.; et al. Global analysis of protein phosphorylation in yeast. Nature 2005, 438, 679–684. [Google Scholar] [CrossRef] [PubMed]
- Neigeborn, L.; Schwartzberg, P.; Reid, R.; Carlson, M. Null mutations in the SNF3 gene of Saccharomyces cerevisiae cause a different phenotype than do previously isolated missense mutations. Mol. Cell. Biol. 1986, 6, 3569–3574. [Google Scholar] [PubMed] [Green Version]
- Ozcan, S.; Dover, J.; Rosenwald, A.G.; Wolfl, S.; Johnston, M. Two glucose transporters in Saccharomyces cerevisiae are glucose sensors that generate a signal for induction of gene expression. Proc. Natl. Acad. Sci. USA 1996, 93, 12428–12432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ozcan, S.; Dover, J.; Johnston, M. Glucose sensing and signaling by two glucose receptors in the yeast Saccharomyces cerevisiae. EMBO J. 1998, 17, 2566–2573. [Google Scholar] [CrossRef] [Green Version]
- Schmidt, M.C.; McCartney, R.R.; Zhang, X.; Tillman, T.S.; Solimeo, H.; Wolfl, S.; Almonte, C.; Watkins, S.C. Std1 and Mth1 proteins interact with the glucose sensors to control glucose-regulated gene expression in Saccharomyces cerevisiae. Mol. Cell. Biol. 1999, 19, 4561–4571. [Google Scholar] [CrossRef] [Green Version]
- Lafuente, M.J.; Gancedo, C.; Jauniaux, J.C.; Gancedo, J.M. Mth1 receives the signal given by the glucose sensors Snf3 and Rgt2 in Saccharomyces cerevisiae. Mol. Microbiol. 2000, 35, 161–172. [Google Scholar] [CrossRef]
- Spielewoy, N.; Flick, K.; Kalashnikova, T.I.; Walker, J.R.; Wittenberg, C. Regulation and recognition of SCFGrr1 targets in the glucose and amino acid signaling pathways. Mol. Cell. Biol. 2004, 24, 8994–9005. [Google Scholar] [CrossRef] [Green Version]
- Moriya, H.; Johnston, M. Glucose sensing and signaling in Saccharomyces cerevisiae through the Rgt2 glucose sensor and casein kinase I. Proc. Natl. Acad. Sci. USA 2004, 101, 1572–1577. [Google Scholar] [CrossRef] [Green Version]
- Pasula, S.; Jouandot, D., 2nd; Kim, J.H. Biochemical evidence for glucose-independent induction of HXT expression in Saccharomyces cerevisiae. FEBS Lett. 2007, 581, 3230–3234. [Google Scholar] [CrossRef] [Green Version]
- Tomas-Cobos, L.; Sanz, P. Active Snf1 protein kinase inhibits expression of the Saccharomyces cerevisiae HXT1 glucose transporter gene. Biochem. J. 2002, 368, 657–663. [Google Scholar] [CrossRef]
- Kim, J.H.; Polish, J.; Johnston, M. Specificity and regulation of DNA binding by the yeast glucose transporter gene repressor Rgt1. Mol. Cell. Biol. 2003, 23, 5208–5216. [Google Scholar] [CrossRef] [Green Version]
- Flick, K.M.; Spielewoy, N.; Kalashnikova, T.I.; Guaderrama, M.; Zhu, Q.; Chang, H.C.; Wittenberg, C. Grr1-dependent inactivation of Mth1 mediates glucose-induced dissociation of Rgt1 from HXT gene promoters. Mol. Biol. Cell 2003, 14, 3230–3241. [Google Scholar] [CrossRef] [Green Version]
- Mosley, A.L.; Lakshmanan, J.; Aryal, B.K.; Ozcan, S. Glucose-mediated phosphorylation converts the transcription factor Rgt1 from a repressor to an activator. J. Biol. Chem. 2003, 278, 10322–10327. [Google Scholar] [CrossRef] [Green Version]
- Lakshmanan, J.; Mosley, A.L.; Ozcan, S. Repression of transcription by Rgt1 in the absence of glucose requires Std1 and Mth1. Curr. Genet. 2003, 44, 19–25. [Google Scholar] [CrossRef]
- Polish, J.A.; Kim, J.H.; Johnston, M. How the Rgt1 transcription factor of Saccharomyces cerevisiae is regulated by glucose. Genetics 2005, 169, 583–594. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.H.; Johnston, M. Two glucose-sensing pathways converge on Rgt1 to regulate expression of glucose transporter genes in Saccharomyces cerevisiae. J. Biol. Chem. 2006, 281, 26144–26149. [Google Scholar] [CrossRef] [Green Version]
- Palomino, A.; Herrero, P.; Moreno, F. Tpk3 and Snf1 protein kinases regulate Rgt1 association with Saccharomyces cerevisiae HXK2 promoter. Nucleic Acids Res. 2006, 34, 1427–1438. [Google Scholar] [CrossRef] [Green Version]
- Jouandot, D., 2nd; Roy, A.; Kim, J.H. Functional dissection of the glucose signaling pathways that regulate the yeast glucose transporter gene (HXT) repressor Rgt1. J. Cell. Biochem. 2011, 112, 3268–3275. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roy, A.; Shin, Y.J.; Cho, K.H.; Kim, J.H. Mth1 regulates the interaction between the Rgt1 repressor and the Ssn6-Tup1 corepressor complex by modulating PKA-dependent phosphorylation of Rgt1. Mol. Biol. Cell 2013, 24, 1493–1503. [Google Scholar] [CrossRef] [PubMed]
- Brachmann, C.B.; Davies, A.; Cost, G.J.; Caputo, E.; Li, J.; Hieter, P.; Boeke, J.D. Designer deletion strains derived from Saccharomyces cerevisiae S288C: A useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 1998, 14, 115–132. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Patro, R.; Duggal, G.; Love, M.I.; Irizarry, R.A.; Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat. Methods 2017, 14, 417–419. [Google Scholar] [CrossRef] [Green Version]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Green Version]
- Love, M.I.; Anders, S.; Kim, V.; Huber, W. RNA-Seq workflow: Gene-level exploratory analysis and differential expression. F1000Research 2015, 4, 1070. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. clusterProfiler: An R package for comparing biological themes among gene clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Li, Y.Y.; Douillet, C.; Huang, M.; Beck, R.; Sumner, S.J.; Styblo, M. Exposure to inorganic arsenic and its methylated metabolites alters metabolomics profiles in INS-1 832/13 insulinoma cells and isolated pancreatic islets. Arch. Toxicol. 2020, 94, 1955–1972. [Google Scholar] [CrossRef]
- Zelena, E.; Dunn, W.B.; Broadhurst, D.; Francis-McIntyre, S.; Carroll, K.M.; Begley, P.; O’Hagan, S.; Knowles, J.D.; Halsall, A.; Consortium, H.; et al. Development of a robust and repeatable UPLC-MS method for the long-term metabolomic study of human serum. Anal. Chem. 2009, 81, 1357–1364. [Google Scholar] [CrossRef]
- Dunn, W.B.; Broadhurst, D.; Begley, P.; Zelena, E.; Francis-McIntyre, S.; Anderson, N.; Brown, M.; Knowles, J.D.; Halsall, A.; Haselden, J.N.; et al. Procedures for large-scale metabolic profiling of serum and plasma using gas chromatography and liquid chromatography coupled to mass spectrometry. Nat. Protoc. 2011, 6, 1060–1083. [Google Scholar] [CrossRef]
- Chong, J.; Wishart, D.S.; Xia, J. Using MetaboAnalyst 4.0 for Comprehensive and Integrative Metabolomics Data Analysis. Curr. Protoc. Bioinform. 2019, 68, e86. [Google Scholar] [CrossRef]
- Pang, Z.; Chong, J.; Li, S.; Xia, J. MetaboAnalystR 3.0: Toward an Optimized Workflow for Global Metabolomics. Metabolites 2020, 10, 186. [Google Scholar] [CrossRef]
- Kanehisa, M.; Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef]
- Kanehisa, M. Toward understanding the origin and evolution of cellular organisms. Protein Sci. 2019, 28, 1947–1951. [Google Scholar] [CrossRef]
- Kanehisa, M.; Furumichi, M.; Sato, Y.; Ishiguro-Watanabe, M.; Tanabe, M. KEGG: Integrating viruses and cellular organisms. Nucleic Acids Res. 2020. [Google Scholar] [CrossRef]
- Zhang, N.; Cao, L. Starvation signals in yeast are integrated to coordinate metabolic reprogramming and stress response to ensure longevity. Curr. Genet. 2017, 63, 839–843. [Google Scholar] [CrossRef] [Green Version]
- Li, S.; Park, Y.; Duraisingham, S.; Strobel, F.H.; Khan, N.; Soltow, Q.A.; Jones, D.P.; Pulendran, B. Predicting network activity from high throughput metabolomics. PLoS Comput. Biol. 2013, 9, e1003123. [Google Scholar] [CrossRef] [Green Version]
- Colombo, S.; Ronchetti, D.; Thevelein, J.M.; Winderickx, J.; Martegani, E. Activation state of the Ras2 protein and glucose-induced signaling in Saccharomyces cerevisiae. J. Biol. Chem. 2004, 279, 46715–46722. [Google Scholar] [CrossRef] [Green Version]
- Mendes, I.; Sanchez, I.; Franco-Duarte, R.; Camarasa, C.; Schuller, D.; Dequin, S.; Sousa, M.J. Integrating transcriptomics and metabolomics for the analysis of the aroma profiles of Saccharomyces cerevisiae strains from diverse origins. BMC Genom. 2017, 18, 455. [Google Scholar] [CrossRef] [Green Version]
- Franco-Duarte, R.; Umek, L.; Mendes, I.; Castro, C.C.; Fonseca, N.; Martins, R.; Silva-Ferreira, A.C.; Sampaio, P.; Pais, C.; Schuller, D. New integrative computational approaches unveil the Saccharomyces cerevisiae pheno-metabolomic fermentative profile and allow strain selection for winemaking. Food Chem. 2016, 211, 509–520. [Google Scholar] [CrossRef] [Green Version]
- Vallejo, B.; Peltier, E.; Garrigos, V.; Matallana, E.; Marullo, P.; Aranda, A. Role of Saccharomyces cerevisiae Nutrient Signaling Pathways During Winemaking: A Phenomics Approach. Front. Bioeng. Biotechnol. 2020, 8, 853. [Google Scholar] [CrossRef]
- Peeters, K.; Van Leemputte, F.; Fischer, B.; Bonini, B.M.; Quezada, H.; Tsytlonok, M.; Haesen, D.; Vanthienen, W.; Bernardes, N.; Gonzalez-Blas, C.B.; et al. Fructose-1,6-bisphosphate couples glycolytic flux to activation of Ras. Nat. Commun. 2017, 8, 922. [Google Scholar] [CrossRef] [PubMed]
- Xing, Y.; Stoilov, P.; Kapur, K.; Han, A.; Jiang, H.; Shen, S.; Black, D.L.; Wong, W.H. MADS: A new and improved method for analysis of differential alternative splicing by exon-tiling microarrays. RNA 2008, 14, 1470–1479. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kapur, K.; Jiang, H.; Xing, Y.; Wong, W.H. Cross-hybridization modeling on Affymetrix exon arrays. Bioinformatics 2008, 24, 2887–2893. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bradley, P.H.; Gibney, P.A.; Botstein, D.; Troyanskaya, O.G.; Rabinowitz, J.D. Minor Isozymes Tailor Yeast Metabolism to Carbon Availability. Msystems 2019, 4, e00170-18. [Google Scholar] [CrossRef] [Green Version]
- Solis-Escalante, D.; Kuijpers, N.G.; Barrajon-Simancas, N.; van den Broek, M.; Pronk, J.T.; Daran, J.M.; Daran-Lapujade, P. A Minimal Set of Glycolytic Genes Reveals Strong Redundancies in Saccharomyces cerevisiae Central Metabolism. Eukaryot. Cell 2015, 14, 804–816. [Google Scholar] [CrossRef] [Green Version]
- Giaever, G.; Chu, A.M.; Ni, L.; Connelly, C.; Riles, L.; Veronneau, S.; Dow, S.; Lucau-Danila, A.; Anderson, K.; Andre, B.; et al. Functional profiling of the Saccharomyces cerevisiae genome. Nature 2002, 418, 387–391. [Google Scholar] [CrossRef]
- Papp, B.; Pal, C.; Hurst, L.D. Metabolic network analysis of the causes and evolution of enzyme dispensability in yeast. Nature 2004, 429, 661–664. [Google Scholar] [CrossRef]
- Ihmels, J.; Collins, S.R.; Schuldiner, M.; Krogan, N.J.; Weissman, J.S. Backup without redundancy: Genetic interactions reveal the cost of duplicate gene loss. Mol. Syst. Biol. 2007, 3, 86. [Google Scholar] [CrossRef]
- DeLuna, A.; Vetsigian, K.; Shoresh, N.; Hegreness, M.; Colon-Gonzalez, M.; Chao, S.; Kishony, R. Exposing the fitness contribution of duplicated genes. Nat. Genet. 2008, 40, 676–681. [Google Scholar] [CrossRef]
- Jin, X.; Starke, S.; Li, Y.; Sethupathi, S.; Kung, G.; Dodhiawala, P.; Wang, Y. Nitrogen Starvation-induced Phosphorylation of Ras1 Protein and Its Potential Role in Nutrient Signaling and Stress Response. J. Biol. Chem. 2016, 291, 16231–16239. [Google Scholar] [CrossRef] [Green Version]
- Nijhout, H.F.; Sadre-Marandi, F.; Best, J.; Reed, M.C. Systems Biology of Phenotypic Robustness and Plasticity. Integr. Comp. Biol. 2017, 57, 171–184. [Google Scholar] [CrossRef] [Green Version]
- Dean, E.J.; Davis, J.C.; Davis, R.W.; Petrov, D.A. Pervasive and persistent redundancy among duplicated genes in yeast. PLoS Genet. 2008, 4, e1000113. [Google Scholar] [CrossRef] [Green Version]
- Musso, G.; Costanzo, M.; Huangfu, M.; Smith, A.M.; Paw, J.; San Luis, B.J.; Boone, C.; Giaever, G.; Nislow, C.; Emili, A.; et al. The extensive and condition-dependent nature of epistasis among whole-genome duplicates in yeast. Genome Res. 2008, 18, 1092–1099. [Google Scholar] [CrossRef] [Green Version]
- VanderSluis, B.; Bellay, J.; Musso, G.; Costanzo, M.; Papp, B.; Vizeacoumar, F.J.; Baryshnikova, A.; Andrews, B.; Boone, C.; Myers, C.L. Genetic interactions reveal the evolutionary trajectories of duplicate genes. Mol. Syst. Biol. 2010, 6, 429. [Google Scholar] [CrossRef]
- Gu, X.; Zhang, Z.; Huang, W. Rapid evolution of expression and regulatory divergences after yeast gene duplication. Proc. Natl. Acad. Sci. USA 2005, 102, 707–712. [Google Scholar] [CrossRef] [Green Version]
- Kafri, R.; Bar-Even, A.; Pilpel, Y. Transcription control reprogramming in genetic backup circuits. Nat. Genet. 2005, 37, 295–299. [Google Scholar] [CrossRef]
- DeLuna, A.; Springer, M.; Kirschner, M.W.; Kishony, R. Need-based up-regulation of protein levels in response to deletion of their duplicate genes. PLoS Biol. 2010, 8, e1000347. [Google Scholar] [CrossRef]
- Van der Lee, R.; Lang, B.; Kruse, K.; Gsponer, J.; Sanchez de Groot, N.; Huynen, M.A.; Matouschek, A.; Fuxreiter, M.; Babu, M.M. Intrinsically disordered segments affect protein half-life in the cell and during evolution. Cell Rep. 2014, 8, 1832–1844. [Google Scholar] [CrossRef] [Green Version]
- Stelling, J.; Sauer, U.; Szallasi, Z.; Doyle, F.J., 3rd; Doyle, J. Robustness of cellular functions. Cell 2004, 118, 675–685. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kitano, H. Biological robustness. Nat. Rev. Genet. 2004, 5, 826–837. [Google Scholar] [CrossRef] [PubMed]
- Christen, S.; Sauer, U. Intracellular characterization of aerobic glucose metabolism in seven yeast species by 13C flux analysis and metabolomics. FEMS Yeast Res. 2011, 11, 263–272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bordbar, A.; Yurkovich, J.T.; Paglia, G.; Rolfsson, O.; Sigurjonsson, O.E.; Palsson, B.O. Elucidating dynamic metabolic physiology through network integration of quantitative time-course metabolomics. Sci. Rep. 2017, 7, 46249. [Google Scholar] [CrossRef] [Green Version]
- Zhou, B.; Der, C.J.; Cox, A.D. The role of wild type RAS isoforms in cancer. Semin. Cell Dev. Biol. 2016, 58, 60–69. [Google Scholar] [CrossRef] [Green Version]
Transcriptomics | Metabolomics | Integration | |||
---|---|---|---|---|---|
Enriched Pathways | Adjusted p-Value | Enriched Pathways | Combined p-Value | Enriched Pathways | Adjusted p-Value |
Oxidative phosphorylation | 0.0082 | Fructose and mannose metabolism | 0.0021 | Oxidative phosphorylation | 5.24 × 10−19 |
Starch and sucrose metabolism | 0.0082 | Purine metabolism | 0.0034 | Galactose metabolism | 8.60 × 10−13 |
Amino sugar and nucleotide sugar metabolism | 0.0075 | Starch and sucrose metabolism | 6.56 × 10−10 | ||
Galactose metabolism | 0.0075 | ABC transporters | 7.22 × 10−8 | ||
Tyrosine metabolism | 0.0090 | Glycolysis or Gluconeogenesis | 1.75 × 10−7 | ||
Glutathione metabolism | 0.0107 | Arginine biosynthesis | 5.76 × 10−5 | ||
Lysine biosynthesis | 0.0177 | Alanine, aspartate and glutamate metabolism | 0.0001 | ||
Arginine biosynthesis | 0.0229 | Purine metabolism | 0.0001 | ||
Butanoate metabolism | 0.0375 | Citrate cycle (TCA cycle) | 0.0001 | ||
Fructose and mannose metabolism | 0.0003 | ||||
Amino sugar and nucleotide sugar metabolism | 0.0009 | ||||
Cysteine and methionine metabolism | 0.0025 | ||||
Pentose phosphate pathway | 0.0025 | ||||
Nitrogen metabolism | 0.0128 | ||||
beta-Alanine metabolism | 0.0128 | ||||
Glycine, serine and threonine metabolism | 0.0175 | ||||
Pyruvate metabolism | 0.0264 | ||||
Glutathione metabolism | 0.0266 |
Transcriptomics | Metabolomics | Integration | |||
---|---|---|---|---|---|
Enriched Pathways | Adjusted p-Value | Enriched Pathways | Combined p-Value | Enriched Pathways | Adjusted p-Value |
Ribosome | 0.0076 | Purine metabolism | 0.0005 | Ribosome | 1.12 × 10−74 |
Ribosome biogenesis in eukaryotes | 0.0076 | Arginine biosynthesis | 0.0026 | Purine metabolism | 1.76 × 10−9 |
Sulfur metabolism | 0.0076 | Cysteine and methionine metabolism | 0.0027 | Longevity regulating pathway | 9.20 × 10−6 |
RNA polymerase | 0.0154 | Glyoxylate and dicarboxylate metabolism | 0.0055 | Alanine, aspartate and glutamate metabolism | 2.05 × 10−5 |
Nitrogen metabolism | 0.0165 | Glycine, serine and threonine metabolism | 0.0085 | Arginine biosynthesis | 0.0004 |
Autophagy | 0.0165 | Taurine and hypotaurine metabolism | 0.0172 | Glycine, serine and threonine metabolism | 0.0006 |
Alanine, aspartate and glutamate metabolism | 0.0289 | Glutathione metabolism | 0.0174 | Glycolysis or Gluconeogenesis | 0.0049 |
Proteasome | 0.0465 | Methane metabolism | 0.0254 | Starch and sucrose metabolism | 0.0080 |
Cysteine and methionine metabolism | 0.0088 | ||||
One carbon pool by folate | 0.0174 | ||||
Glyoxylate and dicarboxylate metabolism | 0.0174 | ||||
Sulfur metabolism | 0.0193 | ||||
Pyruvate metabolism | 0.0193 | ||||
Histidine metabolism | 0.0193 | ||||
Galactose metabolism | 0.0261 | ||||
Peroxisome | 0.0295 | ||||
Glycerolipid metabolism | 0.0392 |
Transcriptomics | Metabolomics | Integration | |||
---|---|---|---|---|---|
Enriched Pathways | Adjusted p-Value | Enriched Pathways | Combined p-Value | Enriched Pathways | Adjusted p-Value |
Ribosome biogenesis in eukaryotes | 0.0084 | Purine metabolism | 0.0021 | Oxidative phosphorylation | 3.13 × 10−14 |
Oxidative phosphorylation | 0.0084 | Fructose and mannose metabolism | 0.0047 | Galactose metabolism | 1.60 × 10−11 |
Amino sugar and nucleotide sugar metabolism | 0.0079 | ABC transporters | 1.31 × 10−8 | ||
Galactose metabolism | 0.0079 | Glycolysis or Gluconeogenesis | 8.02 × 10−5 | ||
Glutathione metabolism | 0.0155 | Fructose and mannose metabolism | 8.18 × 10−5 | ||
Tyrosine metabolism | 0.0224 | Starch and sucrose metabolism | 8.18 × 10−5 | ||
Arginine biosynthesis | 0.0234 | Arginine biosynthesis | 0.0012 | ||
Biotin metabolism | 0.0252 | Pentose phosphate pathway | 0.0012 | ||
Aminoacyl-tRNA biosynthesis | 0.0360 | Purine metabolism | 0.0017 | ||
Starch and sucrose metabolism | 0.0396 | Amino sugar and nucleotide sugar metabolism | 0.0073 | ||
Phosphatidylinositol signaling system | 0.0424 | beta-Alanine metabolism | 0.0119 | ||
Alanine, aspartate and glutamate metabolism | 0.0139 | ||||
Cysteine and methionine metabolism | 0.0149 | ||||
Citrate cycle (TCA cycle) | 0.0221 |
Transcriptomics | Metabolomics | Integration | |||
---|---|---|---|---|---|
Enriched Pathways | Adjusted p-Value | Enriched Pathways | Combined p-Value | Enriched Pathways | Adjusted p-Value |
Starch and sucrose metabolism | 0.0065 | Lysine biosynthesis | 1.00 × 10−5 | Galactose metabolism | 1.24 × 10−15 |
Oxidative phosphorylation | 0.0065 | Glyoxylate and dicarboxylate metabolism | 0.0005 | Starch and sucrose metabolism | 1.68 × 10−11 |
Ribosome biogenesis in eukaryotes | 0.0065 | Glycine, serine and threonine metabolism | 0.0009 | Glycolysis or Gluconeogenesis | 6.26 × 10−8 |
Ribosome | 0.0065 | Arginine biosynthesis | 0.0017 | Glycine, serine and threonine metabolism | 4.30 × 10−6 |
RNA polymerase | 0.0092 | Cysteine and methionine metabolism | 0.0028 | ABC transporters | 1.03 × 10−5 |
Galactose metabolism | 0.0169 | Taurine and hypotaurine metabolism | 0.0043 | Pentose phosphate pathway | 2.27 × 10−5 |
Autophagy | 0.0169 | Amino sugar and nucleotide sugar metabolism | 0.0043 | Cysteine and methionine metabolism | 2.27 × 10−5 |
Meiosis | 0.0332 | Galactose metabolism | 0.0043 | Fructose and mannose metabolism | 0.0002 |
Spliceosome | 0.0458 | Butanoate metabolism | 0.0095 | Amino sugar and nucleotide sugar metabolism | 0.0002 |
Lysine degradation | 0.0098 | Arginine biosynthesis | 0.0003 | ||
Aminoacyl-tRNA biosynthesis | 0.0098 | Purine metabolism | 0.0005 | ||
Starch and sucrose metabolism | 0.0204 | Glyoxylate and dicarboxylate metabolism | 0.0009 | ||
Alanine, aspartate and glutamate metabolism | 0.0372 | Peroxisome | 0.0014 | ||
Fructose and mannose metabolism | 0.0384 | Methane metabolism | 0.0057 | ||
Nitrogen metabolism | 0.0392 | Alanine, aspartate and glutamate metabolism | 0.0057 | ||
Phosphatidylinositol signaling system | 0.0429 | Lysine biosynthesis | 0.0213 | ||
Nitrogen metabolism | 0.0255 | ||||
Citrate cycle (TCA cycle) | 0.0338 | ||||
Vitamin B6 metabolism | 0.0385 | ||||
Inositol phosphate metabolism | 0.0390 | ||||
Monobactam biosynthesis | 0.0392 | ||||
Tryptophan metabolism | 0.0464 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, S.; Li, Y.; Rushing, B.R.; Harris, S.E.; McRitchie, S.L.; Dominguez, D.; Sumner, S.J.; Dohlman, H.G. Multi-Omics Analysis of Multiple Glucose-Sensing Receptor Systems in Yeast. Biomolecules 2022, 12, 175. https://doi.org/10.3390/biom12020175
Li S, Li Y, Rushing BR, Harris SE, McRitchie SL, Dominguez D, Sumner SJ, Dohlman HG. Multi-Omics Analysis of Multiple Glucose-Sensing Receptor Systems in Yeast. Biomolecules. 2022; 12(2):175. https://doi.org/10.3390/biom12020175
Chicago/Turabian StyleLi, Shuang, Yuanyuan Li, Blake R. Rushing, Sarah E. Harris, Susan L. McRitchie, Daniel Dominguez, Susan J. Sumner, and Henrik G. Dohlman. 2022. "Multi-Omics Analysis of Multiple Glucose-Sensing Receptor Systems in Yeast" Biomolecules 12, no. 2: 175. https://doi.org/10.3390/biom12020175