Full-Length Transcriptome Sequencing and Comparative Transcriptomics Reveal the Molecular Mechanisms Underlying Gonadal Development in Sleepy Cod (Oxyeleotris lineolata)
Simple Summary
Abstract
1. Introduction
1.1. Sexual Dimorphism in Fish
1.2. Introduction to the Sleepy Cod
1.3. Introduction to the RNA Sequencing
2. Materials and Methods
2.1. Ethics Statement
2.2. Experimental Samples
2.3. Histological Analysis of the Gonads
2.4. RNA Extraction and Quality Evaluation
2.5. Library Construction for PacBio and Illumina Sequencing
2.6. Processing of Sequencing Data
2.7. Functional Annotation of Transcripts
2.8. Differential Expression Analysis of Ovary and Testis
2.9. Functional Enrichment Analysis of DETs
2.10. Protein–Protein Interaction (PPI) Network Construction
2.11. Quantitative Real-Time PCR (qPCR)
3. Results
3.1. Differences in Growth Traits Between Female and Male of Sleepy Cod
3.2. Histological Characteristics of the Sleepy Cod Gonads
3.3. The Full-Length Transcriptome of Sleepy Cod
3.4. Functional Gene Annotation for Full-Length Transcripts of Sleepy Cod
3.5. Illumina Sequencing and Analysis of Ovary and Testis
3.6. DETs in Testes and Ovaries
3.7. Validation of Transcriptome Sequencing Results via qPCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ravi, V.; Venkatesh, B. Rapidly evolving fish genomes and teleost diversity. Curr. Opin. Genet. 2008, 18, 544–550. [Google Scholar] [CrossRef] [PubMed]
- Bachtrog, D.; Mank, J.E.; Peichel, C.L.; Kirkpatrick, M.; Otto, S.P.; Ashman, T.L.; Hahn, M.W.; Kitano, J.; Mayrose, I.; Ming, R. Sex determination: Why so many ways of doing it? PLoS Biol. 2014, 12, e1001899. [Google Scholar] [CrossRef]
- Chen, J.; Hu, W.; Zhu, Z.Y. Progress in studies of fish reproductive development regulation. Chin. Sci. Bull. 2013, 58, 7–16. [Google Scholar] [CrossRef]
- Li, X.Y.; Gui, J.F. Diverse and variable sex determination mechanisms in vertebrates. Sci. China Life Sci. 2018, 61, 1503–1514. [Google Scholar] [CrossRef] [PubMed]
- Fernandino, J.I.; Hattori, R.S. Sex determination in Neotropical fish: Implications ranging from aquaculture technology to ecological assessment. Gen. Comp. Endocrinol. 2019, 273, 172–183. [Google Scholar] [CrossRef]
- Beardmore, J.A.; Mair, G.C.; Lewis, R.I. Monosex male production in finfish as exemplified by tilapia: Applications, problems, and prospects. Aquaculture 2001, 97, 283–301. [Google Scholar] [CrossRef]
- Sayed, E.D.H.; Mahmoud, U.M.; Mekkawy, I.A. Erythrocytes alterations of monosex tilapia (Oreochromis niloticus, Linnaeus, 1758) produced using methyltestosterone. Egypt. J. Aquatic Res. 2016, 42, 83–90. [Google Scholar] [CrossRef]
- Liu, H.; Guan, B.; Xu, J.; Hou, C.; Tian, H.; Chen, H. Genetic manipulation of sex ratio for the large-scale breeding of YY super-male and XY all-male yellow catfish (Pelteobagrus fulvidraco (Richardson)). Mar. Biotechnol. 2013, 15, 321–328. [Google Scholar] [CrossRef] [PubMed]
- Jiang, M.Y.; Wu, X.X.; Chen, K.X.; Luo, H.R.; Yu, W.; Jia, S.T.; Li, Y.; Wang, Y.; Yang, P.; Zhu, Z.; et al. Production of YY supermale and XY physiological female common carp for potential eradication of this invasive species. J. World Aquac. Soc. 2018, 49, 315–327. [Google Scholar] [CrossRef]
- Herbert, B.; Graham, P. Breeding and fecundity of the endemic Australian gudgeon, sleepy cod Oxyeleotris lineolatus (Steindachner 1867) (Eleotridae). Aquaculture 2004, 236, 241–252. [Google Scholar] [CrossRef]
- Herbert, B.W.; Graham, P.A.; Foster, S.D. Effects of added shelter and stocking density on growth of sleepy cod Oxyeleotris lineolatus in ponds. J. World Aquac. Soc. 2003, 34, 433–440. [Google Scholar] [CrossRef]
- Mosig, J. Research on sleepy cod up north. Austasia Aquac. 2002, 16, 30–37. [Google Scholar]
- Chen, H.; Li, W.; Zhao, J.; Zhu, X. The complete mitochondrial genome of the sleepy cod (Oxyeleotris lineolatus). Mitochondrial DNA A DNA Mapp. Seq. Anal. 2016, 27, 2539–2540. [Google Scholar] [CrossRef]
- Fan, J.; Ma, D.; Zhu, H.; Lin, M.; Su, H.; Zhong, Z. Isolation and characterization of 48 SNP markers of sleepy cod, Oxyeleotris lineolatus by whole-genome resequencing. Conserv. Genet. Resour. 2024, 16, 73–78. [Google Scholar] [CrossRef]
- Ozsolak, F.; Milos, P.M. RNA sequencing: Advances, challenges and opportunities. Nat. Rev. Genet. 2011, 12, 87–98. [Google Scholar] [CrossRef]
- Rhoads, A.; Au, K.F. PacBio sequencing and its applications. Genom. Proteom. Bioinf. 2015, 13, 278–289. [Google Scholar] [CrossRef] [PubMed]
- Weirather, J.L.; de Cesare, M.; Wang, Y.; Piazza, P.; Sebastiano, V.; Wang, X.J.; Buck, D.; Au, K.F. Comprehensive comparison of Pacifc Biosciences and Oxford Nanopore Technologies and their applications to transcriptome analysis. F1000 Res. 2017, 6, 100. [Google Scholar] [CrossRef]
- Zhang, X.; Zhou, J.; Li, L.; Huang, W.; Ahmad, H.I.; Li, H.; Jiang, H.; Chen, J. Full-length transcriptome sequencing and comparative transcriptomic analysis to uncover genes involved in early gametogenesis in the gonads of Amur sturgeon (Acipenser schrenckii). Front. Zool. 2020, 17, 1–21. [Google Scholar] [CrossRef]
- Meng, F.; Zhang, Y.; Zhou, J.; Li, M.; Shi, G.; Wang, R. Do the toll-like receptors and complement systems play equally important roles in freshwater adapted Dolly Varden char (Salvelinus malma)? Fish Shellfish Immunol. 2019, 86, 581–598. [Google Scholar] [CrossRef] [PubMed]
- Yi, S.; Zhou, X.; Li, J.; Zhang, M.; Luo, S. Full-length transcriptome of Misgurnus anguillicaudatus provides insights into evolution of genus Misgurnus. Sci. Rep. 2018, 8, 11699. [Google Scholar] [CrossRef]
- Nudelman, G.; Frasca, A.; Kent, B.; Edepli-Sadler, K.; Sealfon, S.C.; Walsh, M.J.; Zaslavsky, E. High resolution annotation of zebrafish transcriptome using long-read sequencing. Genome Res. 2018, 28, 1415–1425. [Google Scholar] [CrossRef] [PubMed]
- Luo, D.; Zhou, Q.; Wu, Y.; Chai, X.; Liu, W.; Wang, Y.; Yang, Q.; Wang, Z.; Liu, Z. Full-length transcript sequencing and comparative transcriptomic analysis to evaluate the contribution of osmotic and ionic stress components towards salinity tolerance in the roots of cultivated alfalfa (Medicago sativa L.). BMC Plant Biol. 2019, 19, 32. [Google Scholar] [CrossRef] [PubMed]
- Li, H. Minimap2: Pairwise alignment for nucleotide sequences. Bioinformatics 2018, 34, 3094–3100. [Google Scholar] [CrossRef]
- Li, W.; Godzik, A. Cd-hit: A fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics 2006, 22, 1658–1659. [Google Scholar] [CrossRef] [PubMed]
- Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef]
- Deng, Y.Y.; Li, J.Q.; Wu, S.F.; Zhu, Y.; Chen, Y.W.; He, F.C. Integrated nr database in protein annotation system and its localization. Comput. Eng. 2006, 32, 71–72. [Google Scholar]
- Tatusov, R.L.; Galperin, M.Y.; Natale, D.A.; Koonin, E.V. The COG database: A tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Res. 2000, 28, 33–36. [Google Scholar] [CrossRef]
- Finn, R.D.; Bateman, A.; Clements, J.; Coggill, P.; Eberhardt, R.Y.; Eddy, S.R.; Heger, A.; Hetherington, K.; Holm, L.; Mistry, J.; et al. Pfam: The protein families database. Nucleic Acids Res. 2014, 42, D222–D230. [Google Scholar] [CrossRef]
- Apweiler, R.; Bairoch, A.; Wu, C.H.; Barker, W.C.; Boeckmann, B.; Ferro, S.; Gasteiger, E.; Huang, H.; Lopez, R.; Magrane, M.; et al. UniProt: The universal protein knowledgebase. Nucleic Acids Res. 2004, 32, D115–D119. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Goto, S.; Kawashima, S.; Okuno, Y.; Hattori, M. The KEGG resource for deciphering the genome. Nucleic Acids Res. 2004, 32, D277–D280. [Google Scholar] [CrossRef]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [PubMed]
- Koonin, E.V.; Fedorova, N.D.; Jackson, J.D.; Jacobs, A.R.; Krylov, D.M.; Makarova, K.S.; Mazumder, R.; Mekhedov, S.L.; Nikolskaya, A.N.; Rao, B.S.; et al. A comprehensive evolutionary classification of proteins encoded in complete eukaryotic genomes. Genome Biol. 2004, 5, R7. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef] [PubMed]
- Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, R106. [Google Scholar] [CrossRef]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef]
- Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Parker, G.A. The evolution of sexual size dimorphism in fish. J. Fish Biol. 1992, 41 (Suppl. B), 1–20. [Google Scholar] [CrossRef]
- Stelkens, R.B.; Wedekind, C. Environmental sex reversal, Trojan sex genes, and sex ratio adjustment: Conditions and population consequences. Mol. Ecol. 2010, 19, 627–646. [Google Scholar] [CrossRef] [PubMed]
- Piferrer, F.; Ribas, L.; Díaz, N. Genomic approaches to study genetic and environmental influences on fish sex determination and differentiation. Mar. Biotechnol. 2012, 14, 591–604. [Google Scholar] [CrossRef]
- Bye, V.J.; Lincoln, R.F. Commercial methods for the control of sexual maturation in rainbow trout (Salmo gairdneri R.). Aquaculture 1986, 57, 299–309. [Google Scholar] [CrossRef]
- Yoneda, M.; Kurita, Y.; Kitagawa, D.; Ito, M.; Tomiyama, T.; Goto, T.; Takahashi, K. Age validation and growth variability of Japanese flounder Paralichthys olivaceus off the Pacific coast of northern Japan. Fish Sci. 2007, 73, 585–592. [Google Scholar] [CrossRef]
- Chen, S.L.; Li, J.; Deng, S.P.; Tian, Y.S.; Wang, Q.Y.; Zhuang, Z.M.; Sha, Z.X.; Xu, J.Y. Isolation of female-specific AFLP markers and molecular identification of genetic sex in half-smooth tongue sole (Cynoglossus semilaevis). Mar. Biotechnol. 2007, 9, 273–280. [Google Scholar] [CrossRef]
- Wang, D.; Mao, H.L.; Chen, H.X.; Liu, H.Q.; Gui, J.F. Isolation of Y- and X-linked SCAR markers in yellow catfish and application in the production of all-male populations. Anim. Genet. 2009, 40, 978–981. [Google Scholar] [CrossRef] [PubMed]
- Goudie, C.A.; Simco, B.A.; Davis, K.B.; Carmichael, G.J. Growth of channel catfish in mixed sex and monosex pond culture. Aquaculture 1994, 128, 97–104. [Google Scholar] [CrossRef]
- Zhou, L.; Yang, R.; Tian, H.; Qin, X.; Ye, C.; Shi, X.; Xia, C.; Cai, T.; Xie, Y.; Jia, Y.; et al. Sexual dimorphism in Odontobutis sinensis brain-pituitary-gonad axis and liver highlighted by histological and transcriptomic approach. Gene 2022, 819, 146264. [Google Scholar] [CrossRef] [PubMed]
- Assis, R.; Zhou, Q.; Bachtrog, D. Sex-biased transcriptome evolution in Drosophila. Genome Biol. Evol. 2012, 4, 1189–1200. [Google Scholar] [CrossRef]
- Ellegren, H.; Parsch, J. The evolution of sex-biased genes and sex-biased gene expression. Nat. Rev. Genet. 2007, 8, 689–698. [Google Scholar] [CrossRef] [PubMed]
- Ottolenghi, C.; Uda, M.; Crisponi, L.; Omari, S.; Cao, A.; Forabosco, A.; Schlessinger, D. Determination and stability of sex. Bioessays 2007, 29, 15–25. [Google Scholar] [CrossRef] [PubMed]
- Guan, G.; Kobayashi, T.; Nagahama, Y. Sexually dimorphic expression of two types of DM (Doublesex/Mab-3)-domain genes in a teleost fish, the tilapia (Oreochromis niloticus). Biochem. Biophys. Res. Commun. 2000, 272, 662–666. [Google Scholar] [CrossRef] [PubMed]
- Marchand, O.; Govoroun, M.; D’Cotta, H.; McMeel, O.; Lareyre, J.J.; Bernot, A.; Laudet, V.; Guiguen, Y. DMRT1 expression during gonadal differentiation and spermatogenesis in the rainbow trout, Oncorhynchus mykiss. Biochim. Biophys. Acta. 2000, 1493, 180–187. [Google Scholar] [CrossRef] [PubMed]
- Raymond, C.S.; Shamu, C.E.; Shen, M.M.; Seifert, K.J.; Hirsch, B.; Hodgkin, J.; Zarkower, D. Evidence for evolutionary conservation of sex-determining genes. Nature 1998, 391, 690–694. [Google Scholar] [CrossRef] [PubMed]
- Herpin, A.; Schartl, M. Sex determination: Switch and suppress. Curr. Biol. 2011, 21, R656–R659. [Google Scholar] [CrossRef]
- Kobayashi, M.; Sorensen, P.W.; Stacey, N.E. Hormonal and pheromonal control of spawning behavior in the goldfish. Fish Physiol. Biochem. 2002, 26, 71–84. [Google Scholar] [CrossRef]
- Stocco, D.M.; Wang, X.J.; Jo, Y.; Manna, P.R. Multiple signaling pathways regulating steroidogenesis and steroidogenic acute regulatory protein expression: More complicated than we thought. Mol. Endocrinol. 2005, 19, 2647–2659. [Google Scholar] [CrossRef] [PubMed]
- Bruce, M.; Oyen, F.; Bell, G.; Asturiano, J.F.; Farndale, B.; Carrillo, M.; Zanuy, S.; Ramos, J.; Bromage, N. Development of broodstock diets for the European Sea Bass (Dicentrarchus labrax) with special emphasis on the importance of n-3 and n-6 highly unsaturated fatty acid to reproductive performance. Aquaculture 1999, 177, 85–97. [Google Scholar] [CrossRef]
- Furuita, H.; Yamamoto, T.; Shima, T.; Suzuki, N.; Takeuchi, T. Effect of arachidonic acid levels in broodstock diet on larval and egg quality of japanese flounder Paralichthys olivaceus. Aquaculture 2003, 220, 725–735. [Google Scholar] [CrossRef]
- Mazorra, C.; Bruce, M.; Bell, J.G.; Davie, A.; Alorend, E.; Jordan, N.; Rees, J.; Papanikos, N.; Porter, M.; Bromage, N. Dietary lipid enhancement of broodstock reproductive performance and egg and larval quality in Atlantic halibut (Hippoglossus hippoglossus). Aquaculture 2003, 227, 21–33. [Google Scholar] [CrossRef]
- Røjbek, M.C.; Stottrup, J.G.; Jacobsen, C.; Tomkiewicz, J.; Nielsen, A.; Trippel, E.A. Effects of dietary fatty acids on the production and quality of eggs and larvae of Atlantic cod (Gadus morhua L.). Aquacult. Nutr. 2014, 20, 654–666. [Google Scholar] [CrossRef]
Accession ID | Gene | Gene Symbol | Primer Sequence (5′→3′) | Product Length (bp) | Annealing Temperatures (℃) |
---|---|---|---|---|---|
F01_transcript_17321 | SRY-box transcription factor 19b | sox19b | F:CCCATATTCACCGGATTCA | 118 | 58 |
R:TTCGGATTTCTGCCACTACA | |||||
F01_transcript_19134 | SRY-box transcription factor 11b | sox11b | F:GCCAAGTCCCTCTAAACCC | 141 | 60 |
R:AGTCTGAGGACGGGTCTGTT | |||||
F01_transcript_19661 | SRY-box transcription factor 3 | sox3 | F:GTCCTCGGCTCAGACCTAC | 120 | 60 |
R:CTTGGTTCACTCTTGCACAC | |||||
F01_transcript_20650 | LSM family member 14B | lsm14b | F:GGACTGAAGGAAGACTGACTG | 121 | 57 |
R:TATTGGGATTGAGGTGGTTC | |||||
F01_transcript_20848 | forkhead box H1 | foxh1 | F:TCTGTGGAGGGCAACATAC | 124 | 59 |
R:CTGTGATCTGCTGAGTGTCC | |||||
F01_transcript_27462 | zygote arrest 1 | zar1 | F:CCTGCACCTGTGAGAAGAA | 143 | 57 |
R:TGTCCCATCGCATTATTAGAC | |||||
F01_transcript_32029 | cytoplasmic polyadenylation element binding protein 1 | cpeb1 | F:TACTACTGCCGCTCTTGCT | 91 | 58 |
R:AATCCCTGTTCTTCTGGTTG | |||||
F01_transcript_39260 | forkhead box L2 | foxl2 | F:CCTCACTCTGTCCGGTATCT | 147 | 60 |
R:CTGCGGTAGTTTCCCTTCT | |||||
F01_transcript_62040 | Gonadotropin releasing hormone receptor 2 | gnrhr2 | F:GGCTTCTACTCTCCGTCCTT | 132 | 60 |
R:CATCTCGTGGTCCTCTCTCT | |||||
F01_transcript_69028 | zona pellucida glycoprotein 4 | zp4 | F:TTGTTGTTGTCTTGGCTTGT | 114 | 60 |
R:GAGAAGTCGTGGTTGAAGGT | |||||
F01_transcript_77894 | atrophin-1 | arp | F:TGACTATGAGAACGGCAGAA | 118 | 57 |
R:GTGAAGTGCGTATCCCTGA | |||||
F01_transcript_16742 | doublesex- and mab-3-related transcription factor 1 | dmrt1 | F:TATTGTTCTTGGGCTGGTCT | 121 | 60 |
R:CCTTTGGATGAGGAGATAGGT | |||||
F01_transcript_31954 | doublesex- and mab-3-related transcription factor 3 | dmrt3 | F:TGCTATCGTGGCTCAAAGG | 144 | 60 |
R:TCTCCAGACTCTCGTTCGC | |||||
F01_transcript_34248 | SRY-box transcription factor 9 | sox9 | F:AAGCTGGGTTTAGAGGGTTT | 134 | 59 |
R:TCTTGTTCGTCCGTCATCT | |||||
F01_transcript_39344 | androgen receptor-1 | ar1 | F:GATACCAACCAACGAGCAA | 85 | 59 |
R:AGCAAGCGTAGTGTCCAAA | |||||
F01_transcript_40103 | androgen receptor-2 | ar2 | F:GATACCAACCAACGAGCAA | 85 | 57 |
R:AGCAAGCGTAGTGTCCAAA | |||||
F01_transcript_4821 | estrogen receptor beta | esr2 | F:AAGAACGCAGAAAGTGAACC | 199 | 58 |
R:TGGAGCAAACACAGAGAGAA | |||||
F01_transcript_60594 | estrogen receptor | esr1 | F:AATGTCCTCTCCAAGTGTCC | 143 | 59 |
R:ATGATGGCTGTCTCCCTTT | |||||
F01_transcript_72802 | anti-muellerian hormone receptor type-2 | amhr2 | F:TGACTTTGTGCCAGTCTTTATC | 94 | 59 |
R:GGTTGTCTACATTGGATGCTATT | |||||
F01_transcript_73590 | gonadal soma derived factor | gsdf | F:CTCTGTTCCTGATGGTGGA | 123 | 59 |
R:GTAATAGTGAGGCTGTTGGGA | |||||
F01_transcript_17112 | actin beta | β-actin | F:ATCTGGCATCACACCTTCTAC | 103 | 59 |
R:TCTTCTCCCTGTTGGCTTT |
Sex | Trait Parameter | Body Weight/g | Body Length/cm | Body Height/cm | Body Width/cm |
---|---|---|---|---|---|
Female | Mean ± SD | 144.85 ± 33.10 | 18.76 ± 1.72 | 4.80 ± 0.50 | 4.67 ± 0.46 |
Minmum value | 131.30 | 18.22 | 4.60 | 4.50 | |
Maximum value | 158.40 | 19.30 | 5.00 | 4.84 | |
Male | Mean ± SD | 185.80 ± 57.29 | 20.93 ± 1.96 | 5.60 ± 0.85 | 5.34 ± 0.71 |
Minmum value | 171.62 | 20.37 | 5.39 | 5.16 | |
Maximum value | 199.98 | 21.49 | 5.81 | 5.52 |
Database | Transcripts Annotated Number | Annotated Rate (%) |
---|---|---|
Transcript number | 49,113 | |
NR | 45,361 | 92.36 |
eggNOG | 44,443 | 90.49 |
GO | 31,310 | 63.75 |
KEGG | 30,523 | 62.15 |
Pfam | 39,448 | 80.32 |
Swiss-Prot | 31,149 | 63.42 |
KOG | 33,141 | 67.48 |
COG | 14,190 | 28.89 |
Total | 45,505 | 92.65 |
Sample | Read Number | Base Number | GC Content(%) | ≥Q30 (%) |
---|---|---|---|---|
F1 | 32,572,508 | 9,744,243,016 | 49.71 | 94.94 |
F2 | 33,770,463 | 10,099,245,068 | 49.95 | 95.20 |
F3 | 31,440,309 | 9,401,798,866 | 49.35 | 95.55 |
M1 | 26,243,758 | 7,852,416,722 | 48.44 | 93.14 |
M2 | 29,710,081 | 8,885,414,560 | 48.75 | 93.23 |
M3 | 30,980,070 | 9,250,954,850 | 48.62 | 93.73 |
Annotated | COG | GO | KEGG | KOG | Pfam | Swissprot | eggNOG | NR |
---|---|---|---|---|---|---|---|---|
18,445 | 5890 | 12,575 | 12,099 | 13,402 | 16,570 | 12,804 | 18,074 | 18,401 |
Pathway | Ko Id | Rich Factor | q-Value | Gene Number |
---|---|---|---|---|
Oocyte meiosis | ko04114 | 1.23 | 0.0005 | 156 |
Arachidonic acid metabolism | ko00590 | 1.54 | 0.0007 | 37 |
Fatty acid metabolism | ko01212 | 1.30 | 0.0023 | 78 |
Hedgehog signaling pathway | ko04340 | 1.34 | 0.0028 | 61 |
Cell adhesion molecules (CAMs) | ko04514 | 1.17 | 0.0029 | 194 |
Purine metabolism | ko00230 | 1.16 | 0.0036 | 201 |
ECM-receptor interaction | ko04512 | 1.27 | 0.0042 | 78 |
Fatty acid elongation | ko00062 | 1.40 | 0.0049 | 40 |
Spliceosome | ko03040 | 1.15 | 0.0049 | 204 |
Inositol phosphate metabolism | ko00562 | 1.21 | 0.0060 | 114 |
Phosphatidylinositol signaling system | ko04070 | 1.16 | 0.0113 | 148 |
Glycosphingolipid biosynthesis—lacto and neolacto series | ko00601 | 1.41 | 0.0119 | 31 |
Lysine degradation | ko00310 | 1.22 | 0.0132 | 83 |
MAPK signaling pathway | ko04010 | 1.11 | 0.0136 | 280 |
p53 signaling pathway | ko04115 | 1.18 | 0.0155 | 110 |
RNA polymerase | ko03020 | 1.36 | 0.0214 | 31 |
Cytokine-cytokine receptor interaction | ko04060 | 1.15 | 0.0215 | 138 |
Cytosolic DNA-sensing pathway | ko04623 | 1.30 | 0.0257 | 39 |
Glycerophospholipid metabolism | ko00564 | 1.14 | 0.0404 | 117 |
Fatty acid biosynthesis | ko00061 | 1.29 | 0.0456 | 31 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fan, J.; Ma, D.; Zhu, H.; Lin, M.; Zhong, Z.; Tian, Y. Full-Length Transcriptome Sequencing and Comparative Transcriptomics Reveal the Molecular Mechanisms Underlying Gonadal Development in Sleepy Cod (Oxyeleotris lineolata). Biology 2025, 14, 232. https://doi.org/10.3390/biology14030232
Fan J, Ma D, Zhu H, Lin M, Zhong Z, Tian Y. Full-Length Transcriptome Sequencing and Comparative Transcriptomics Reveal the Molecular Mechanisms Underlying Gonadal Development in Sleepy Cod (Oxyeleotris lineolata). Biology. 2025; 14(3):232. https://doi.org/10.3390/biology14030232
Chicago/Turabian StyleFan, Jiajia, Dongmei Ma, Huaping Zhu, Minghui Lin, Zaixuan Zhong, and Yuanyuan Tian. 2025. "Full-Length Transcriptome Sequencing and Comparative Transcriptomics Reveal the Molecular Mechanisms Underlying Gonadal Development in Sleepy Cod (Oxyeleotris lineolata)" Biology 14, no. 3: 232. https://doi.org/10.3390/biology14030232
APA StyleFan, J., Ma, D., Zhu, H., Lin, M., Zhong, Z., & Tian, Y. (2025). Full-Length Transcriptome Sequencing and Comparative Transcriptomics Reveal the Molecular Mechanisms Underlying Gonadal Development in Sleepy Cod (Oxyeleotris lineolata). Biology, 14(3), 232. https://doi.org/10.3390/biology14030232