Obtaining of Antibacterial Nanoporous Layer on Ti7.5Mo Alloy Surface Combining Alkaline Treatment and Silver: In Vitro Studies
Abstract
:1. Introduction
2. Materials and Methods
2.1. Processing of the Ti7.5Mo Alloy
2.2. Surface Treatment
2.3. Surface Characterization
2.4. Biocompatibility Study
2.4.1. Cell Viability and Adhesion Assays
2.4.2. Gene Expression by RT-qPCR
2.4.3. Zymography
2.5. Bacterial Cell Viability
3. Results
3.1. Surface Characterization
3.2. Biocompatibility Studies
3.3. Bacterial Cell Viability
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Niinomi, M.; Liu, Y.; Nakai, M.; Liu, H.; Li, H. Biomedical titanium alloys with young’s moduli close to that of cortical bone. Regen. Biomater. 2016, 3, 173–185. [Google Scholar] [CrossRef] [PubMed]
- Callegari, B.; Oliveira, J.; Aristizabal, K.; Coelho, R.; Brito, P.; Wu, L.; Schell, N.; Soldera, F.; Mücklich, F.; Pinto, H. In-situ synchrotron radiation study of the aging response of Ti-6Al-4V alloy with different starting microstructures. Mater. Charact. 2020, 165, 110400. [Google Scholar] [CrossRef]
- Callegari, B.; Oliveira, J.P.; Coelho, R.S.; Brito, P.P.; Schell, N.; Soldera, F.A.; Mücklich, F.; Sadik, M.I.; García, J.L.; Pinto, H.C. New insights into the microstructural evolution of Ti-5Al-5Mo-5V-3Cr alloy during hot working. Mater. Charact. 2020, 162, 110180. [Google Scholar] [CrossRef]
- Long, M.; Rack, H.J. Titanium alloys in total joint replacement—A materials science perspective. Biomaterials 1998, 19, 1621–1639. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.J.H.; Ju, C.P.; Ho, W.F. Biocompatible Low Modulus Titanium Alloy for Medical Implant. U.S. Patent No. 6409852, 25 June 2002. [Google Scholar]
- Dong, J.; Wang, W.; Zhou WZhang, S.; Li, M.; Pan, G.; Zhang, X.; Bai, J.; Zhu, C. Immunomodulatory biomaterials for implant-associated infections: From conventional to advanced therapeutic strategies. Biomater. Res. 2022, 26, 2–33. [Google Scholar] [CrossRef] [PubMed]
- Neufeld, M.E.; Lanting, B.A.; Shehata, M.; Howard, J.L.; MacDonald, S.J.; Teeter, M.G.; Vasarhelyi, E.M. Prevalence and outcomes of unexpected positive intraoperative cultures in presumed aseptic revision hip arthroplasty. J. Bone Jt. Surg. Am. 2021, 103, 1392–1401. [Google Scholar] [CrossRef] [PubMed]
- Xin, C.; Zhu, H.; Gao, W.; Xu, G.; Xiao, W.; Xu, Y.L. A high bioactive alkali-treated titanium surface induced by induction heat treatment. Surf. Coat. Technol. 2020, 385, 125362. [Google Scholar]
- Ueno, T.; Tsukimura, N.; Yamada, M.; Ogawa, T. Enhanced bone-integration capability of alkali- and heat-treated nanopolymorphic titanium in micro-to-nanoscale hierarchy. Biomaterials 2011, 32, 7297–7308. [Google Scholar] [CrossRef]
- Kawanabe, K.; Ise, K.; Goto, K.; Akiyama, H.; Nakamura, T.; Kaneuji, A.; Sugimori, T.; Matsumoto, T. A new cementless total hip arthroplasty with bioactive titanium porous-coating by alkaline and heat treatment: Average 4.8-year results. J. Biomed. Mater. Res. B Appl. Biomater. 2009, 90, 476–481. [Google Scholar] [CrossRef]
- Escada, A.L.A.; Trujillo, N.; Ketul, C.P.; Alves Claro, A.P.R. Human dermal fibroblast adhesion on Ti-7.5Mo after TiO2 nanotubes growth. Mater. Sci. Forum 2017, 899, 195–200. [Google Scholar] [CrossRef]
- Claro, A.P.R.A.; Konatu, R.T.; Escada, A.L.A.; Nunes, M.C.S.; Morelli, C.V.M.; Dias-Netipanyj, M.F.; Popat, K.C.; Mantovani, D. Incorporation of silver nanoparticles on Ti7.5Mo alloy surface containing TiO2 nanotubes arrays for promoting antibacterial coating—In Vitro and In Vivo Study. Appl. Surf. Sci. 2018, 455, 780–788. [Google Scholar] [CrossRef]
- Kulkarni, M.; Mazare, A.; Schmuki, P.; Iglič, A.; Seifalian, A. Biomaterial surface modification of titanium and titanium alloys for medical applications. Nanomedicine 2014, 111, 615. [Google Scholar]
- Youn, Y.H.; Lee, S.J.; Choi, G.R.; Lee, H.R.; Lee, D.; Heo, D.N.; Kim, B.S.; Bang, J.B.; Hwang, Y.S.; Correlo, V.M.; et al. Simple and facile preparation of recombinant human bone morphogenetic protein-2 immobilized titanium implant via initiated chemical vapor deposition technique to promote osteogenesis for bone tissue engineering application. Mater. Sci. Eng. C Mater. Biol. 2019, 100, 949–958. [Google Scholar] [CrossRef]
- Khana, S.; Utsav Patel, R.; Marathey, P.; Chaudan, R.; Vora, J.; Banerjee, R.; Ray, A.; Mukhopadhyay, I. Growth of titanium dioxide nanorod over shape memory material using chemical vapor deposition for energy conversion application. Mater. Today Proc. 2020, 28, 475–479. [Google Scholar] [CrossRef]
- Çomakl, O.; Yazıcı, M.; Kovacı, H.; Yetim, T.; Yetim, A.; Çelik, A. Tribological and electrochemical properties of TiO2 films produced on Cp-Ti by sol-gel and SILAR in bio-simulated environment. Surf. Coat. Technol. 2018, 352, 513–521. [Google Scholar] [CrossRef]
- Svagrova, K.; Horkavcova, D.; Jablonska, E.; Helebrant, A. Titania-based sol–gel coatings with Ag, Ca-P applied on titanium substrate developed for implantation. J. Biomed. Mater. Res. B Appl. Biomater. 2022, 110, 115–124. [Google Scholar] [CrossRef] [PubMed]
- Zinjarde, S.S. Bio-inspired nanomaterials and their applications as antimicrobial agents. Chron. Young Sci. 2012, 3, 74. [Google Scholar] [CrossRef]
- Siddiqi, S.K.; Husen, A.; Rao, R.A.K. A review on biosynthesis of silver nanoparticles and their biocidal properties. J. Nanobiotechnol. 2018, 16, 2–28. [Google Scholar] [CrossRef]
- Dhas, T.S.; Ganesh, V.; Kumar, V. Facile synthesis of silver chloride nanoparticles using marine alga and its antibacterial efficacy. Spectrochim. Acta Mol. Biomol. Spectrosc. 2014, 120, 416–420. [Google Scholar] [CrossRef]
- Escada, A.L.A.; Machado, J.P.B.; Schneider, S.G.; Alves Rezende, M.C.R.; Alves Claro, A.P.R. Biomimetic calcium phosphate coating on Ti-7.5Mo alloy for dental application. J. Mater. Sci. Mater. Med. 2011, 22, 2457–2465. [Google Scholar] [CrossRef]
- Escada, A.L.A.; Machado, J.P.B.; Rodrigues, D., Jr.; Alves Claro, A.P.R. Surface characterization of Ti7.5Mo alloy modified by biomimetic method. Surf. Coat. Technol. 2010, 205, 383–387. [Google Scholar] [CrossRef]
- Escada, A.L.A.; Camargo, S.E.A.; Vasconcellos, L.M.R.; Milhan, N.V.M.; Alves Claro, A.P.R. Cytotoxicity analysis of Ti-7.5Mo alloy after biomimetic surface treatment to use as dental materials. Mater. Res.-Ibero-Am. J. Mater. 2017, 20, 4–8. [Google Scholar] [CrossRef]
- Kim, H.S.; Kumbar, S.G. Biomaterial-directed cell behavior for tissue engineering. Curr. Opin. Biomed. Eng. 2021, 17, 100260. [Google Scholar] [CrossRef] [PubMed]
- Ferraris, S.; Spriano, S. Antibacterial Titanium Surfaces for Medical Implants. Mater. Sci. Eng. C. 2016, 61, 965–978. [Google Scholar] [CrossRef] [PubMed]
- Besinis, A.; Hadi, S.D.; Le, H.; Tredwin, C.; Handy, R. Antibacterial activity and biofilm inhibition by surface modified titanium alloy medical implants following application of silver, titanium dioxide and hydroxyapatite nanocoatings. Nanotoxicology 2017, 11, 327–338. [Google Scholar] [CrossRef] [PubMed]
- Boyan, B.D.; Cheng, A.; Olivares-Navarrete, R.; Schwartz, Z. Implant surface design regulates mesenchymal stem cell differentiation and maturation. Adv. Dent. Res. 2016, 28, 10–17. [Google Scholar] [CrossRef] [PubMed]
- Bressan, E.; Sbricoli, L.; Guazzo, R.; Tocco, I.; Roman, M.; Vindigni, V.; Stellini, E.; Gardin, C.; Ferroni, L.; Sivolella, S.; et al. Nanostructured surfaces of dental implants. Int. J. Mol. Sci. 2013, 14, 1918–1931. [Google Scholar] [CrossRef] [PubMed]
- Wu, B.; Tang, Y.; Wang, K.; Zhou, X.; Xiang, L. Nanostructured Titanium Implant Surface Facilitating Osseointegration from Protein Adsorption to Osteogenesis: The Example of TiO2NTAs. Int. J. Nanomed. 2022, 17, 1865–1879. [Google Scholar] [CrossRef]
- Ogura, N.; Berger, M.B.; Srivas, P.; Hwang, S.; Li, J.; Cohen, D.J.; Schwarts, Z.; Boyan, B.D.; Dandhage, K.H. Tailoring of TiAl6V4 Surface Nanostructure for Enhanced In Vitro Osteoblast Response via Gas/Solid (Non-Line-of-Sight) Oxidation / Reduction Reactions. Biomimetics 2022, 7, 117. [Google Scholar] [CrossRef]
- Medvedev, A.E.; Ng, H.P.; Lapovok, R.; Estrin, Y.; Lowe, T.C. Effect of bulk microstructure of commercially pure titanium on surface characteristics and fatigue properties after surface modification by sand blasting and acid-etching. J. Behav. Biomed. Mater. 2016, 57, 55–68. [Google Scholar] [CrossRef]
- Kataoka, Y.; Tamaki, Y.; Miyazaki, T. Synergistic responses of superficial chemistry and micro topography of titanium created by wire-type electric discharge machining. Bio-Med. Mater. Eng. 2011, 21, 113–121. [Google Scholar] [CrossRef]
- Eom, T.G.; Jeon, G.R.; Jeong, C.M. Estudo experimental da resposta óssea a implantes com revestimento de hidroxiapatita: Contato osso-implante e teste de torque de remoção. Cir. Oral Med. Oral Patol. Oral E Radiol. Oral 2012, 114, 411–418. [Google Scholar] [CrossRef]
- Mocanu, A.; Furtos, G.; Rapuntean, S.; Horovitz, O.; Flore, C.; Garbo, C.; TomoaiaCotisel, M. Synthesis, characterization and antimicrobial effects of composites based on multi-substituted hydroxyapatite and silver nanoparticles. Appl. Surf. Sci. 2014, 298, 225–235. [Google Scholar] [CrossRef]
- Ranj, N.; Salaieac, A.B.; Huirong, L.; Christopher, T.; Richard, D.H. The biocompatibility of silver and nanohydroxyapatite coatings on titanium dental implants with human primary osteoblast cells. Mater. Sci. Eng. C 2020, 17, 100260. [Google Scholar]
- Barthes, J.; Cazzola, M.; Muller, C. Controlling porous titanium/soft tissue interactions with an innovative surface chemical treatment: Responses of macrophages and fibroblasts. Mater. Sci. Eng. C 2020, 112, 110845. [Google Scholar] [CrossRef]
- Vilardell, A.M.; Cinca, N.; Garcia-Girald, N. In-vitro study of hierarchical structures: Anodic oxidation and alkaline treatments onto highly rough titanium cold gas spray coatings for biomedical applications. Mater. Sci. Eng. C 2018, 91, 589–596. [Google Scholar] [CrossRef]
- Fan, H.; Guo, Z. Bioinspired surfaces with wettability: Biomolecule adhesion behaviors. Biomater. Sci. 2020, 8, 1502–1535. [Google Scholar] [CrossRef]
- Polini, A.; Yang, F. Physicochemical characterization of nanofiber composites. In Nanofiber Composites for Biomedical Applications; Woodhead Publishing: Cambridge, UK, 2017; pp. 97–115. [Google Scholar]
- Polo-Corrales, L.; Latorre-Esteves, M.; Ramirez-Vick, J.E. Scaffold design for bone regeneration. J. Nanosci. Nanotechnol. 2014, 14, 15–56. [Google Scholar] [CrossRef]
- Achinas, S.; Charalampogiannis, N.; Euverink, G.J. A brief recap of microbial adhesion and biofilms. Appl. Sci. 2019, 9, 2801. [Google Scholar] [CrossRef]
- Zhang, X.W.L.; Levänena, E. Superhydrophobic surfaces for the reduction of bacterial adhesion. RSC Adv. 2013, 3, 12003–12020. [Google Scholar] [CrossRef]
- Almaguer-Flores, A.; Olivares-Navarrete, R.; Wieland, M.; Ximenez-Fyvie, L.A.; Schwartz, Z.; Boyan, B.D. Influence of topography and hydrophilicity on initial oral biofilm formation on microstructured titanium surfaces in vitro. Clin. Oral Implant. Res. 2012, 23, 301–307. [Google Scholar] [CrossRef]
- Mi, L.; Jiang, S. Integrated antimicrobial and nonfouling zwitterionic polymers. Angew. Chem. Int. Ed. Engl. 2014, 53, 1746–1754. [Google Scholar] [CrossRef]
- Manicourt, D.H.; Lefebvre, V. An assay for matrix metalloproteinases and other proteases acting on proteoglycans, casein, or gelatin. Anal. Biochem. 1993, 9, 171–215. [Google Scholar] [CrossRef]
- Daley, W.P.; Peters, S.B.; Larsen, M. Extracellular matrix dynamics in development and regenerative medicine. J. Cell Sci. 2008, 121, 255–264. [Google Scholar] [CrossRef]
- Aiyelabegan, H.T.; Sadroddiny, E. Fundamentals of protein and cell interactions in biomaterials. Biomed. Pharmacother. 2018, 8, 956–970. [Google Scholar] [CrossRef]
- da Costa Fernandes, C.J.; Ferreira, M.R.; Bezerra, F.J.B.; Zambuzzi, W.F. Zirconia stimulates ECM-remodeling as a prerequisite to pre-osteoblast adhesion/proliferation by possible interference with cellular anchorage. J. Mater. Sci. Mater. Med. 2018, 29, 41. [Google Scholar] [CrossRef]
- Da Silva, R.A.; da Silva Feltran, G.; Ferreira, M.R.; Wood, P.F.; Bezerra, F.; Zambuzzi, W.F. The Impact of Bioactive Surfaces in the Early Stages of Osseointegration: An in Vitro comparative study evaluating the HAnano® and SLActive® Super Hydrophilic Surfaces. Biomed. Res. Int. 2020, 2020, 3026893. [Google Scholar] [CrossRef]
- Tokuhara, C.K.; Santesso, M.R.; de Oliveira, G.S.N.; da Ventura, T.M.S.; Doyama, J.T.; Zambuzzi, W.F.; de Oliveira, R.C. Updating the role of matrix metalloproteinases in mineralized tissue and related diseases. J. Appl. Oral Sci. 2019, 27, 1–14. [Google Scholar] [CrossRef]
- Machado, M.I.P.; Gomes, A.M.; Rodrigues, M.F.; Silva Pinto, T.; da Costa Fernandes, C.J.; Bezerra, F.J.; Zambuzzi, W.F. Cobalt-chromium-enriched medium ameliorates shear-stressed endothelial cell performance. J. Trace Elem. Med. Biol. 2019, 54, 163–171. [Google Scholar] [CrossRef]
- Zambuzzi, W.F.; Paiva, K.B.S.; Menezes, R.; Oliveira, R.C.; Taga, R.; Granjeiro, J.M. MMP-9 and CD68(+) cells are required for tissue remodeling in response to natural hydroxyapatite. J. Mol. Histol. 2009, 40, 301–309. [Google Scholar] [CrossRef]
- Rooprai, H.K.; Martin, A.J.; King, A.; Appadu, U.D.; Jones, H.; Selway, R.P.; Gullan, R.W.; Pilkington, G.J. Comparative gene expression profiling of ADAMs, MMPs, TIMPs, EMMPRIN, EGF-R and VEGFA in low grade meningioma. Int. J. Oncol. 2016, 49, 2309–2318. [Google Scholar] [CrossRef]
- de Breij, A.; Riool, M.; Kwakman, P.H.S.; de Boer, L.; Cordfunke, R.A.; Drijfhout, J.W.; Cohen, O.; Emanuel, N.; Zaat, S.A.J.; Nibbering, H.; et al. Prevention of Staphylococcus aureus biomaterial-associated infections using a polymer-lipid coating containing the antimicrobial peptide OP-145. J. Control. Release 2016, 222, 1–8. [Google Scholar] [CrossRef]
- Nune, K.C.; Somani, M.C.; Spencer, C.T.; Misra, R.D.K. Cellular response of Staphylococcus aureus to nanostructured metallic biomedical devices: Surface binding and mechanism of disruption of colonization. Mater. Technol. 2017, 32, 22–31. [Google Scholar] [CrossRef]
- Li, D.; Liu, S.; Ma, Y.; Liu, S.; Liu, Y.; Ding, J. Biomaterials That Induce Immunogenic Cell Death. Small Methods 2023, 7, 2300204. [Google Scholar] [CrossRef]
- Gla, H.; Jonitz-Heincke, A.; Petters, J.; Lukas, J.; Bader, R.; Hermann, A. Corrosion Products from Metallic Implants Induce ROS and Cell Death in Human Motoneurons In Vitro. J. Funct. Biomater. 2023, 14, 392. [Google Scholar]
- Zhang, Y.; Doan, B.-T.; Gasser, G. Metal-Based Photosensitizers as Inducers of Regulated Cell Death Mechanisms. Chem. Rev. 2023, 123, 10135–10155. [Google Scholar] [CrossRef]
- Prabhu, S.; Poulose, E.K. Silver Nanoparticles: Mechanism of antimicrobial action, synthesis, medical applications, and toxicity effects. Int. Nano Lett. 2012, 2, 1–10. [Google Scholar] [CrossRef]
- Iqbal, N.; Kadir, M.R.A.; Mahmood, N.H.B.; Iqbal, S.; Almasi, D.; Naghizadeh, F.; Kamarul, T. Characterization and biological evaluation of silver containing fluoroapatite nanoparticles prepared through microwave synthesis. Ceram. Int. 2015, 41, 6470–6477. [Google Scholar] [CrossRef]
- Lan, M.Y.; Liu, C.P.; Huang, H.H.; Lee, S.W. Both enhanced biocompatibility and antibacterial activity in Ag-decorated TiO2 nanotubes. PLoS ONE 2013, 8, e75364. [Google Scholar] [CrossRef]
- Agnihotri, S.; Mukherji, S.; Mukherji, S. Immobilized silver nanoparticles enhance contact killing and show highest efficacy: Elucidation of the mechanism of bactericidal action of silver. Nanoscale 2013, 5, 7328–7340. [Google Scholar] [CrossRef]
- Li, Y.; Leung, W.K.; Yeung, K.L.; Lau, P.S.; Kwan, J.K.C. A multilevel antimicrobial coating based on polymer-encapsulated ClO2. Langmuir 2009, 25, 13472–13480. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer | 5′-3′ Sequence | Parameters |
---|---|---|---|
Integrin α1 | Forward | TATCCTCCTGAGCGCCTTT | 95 °C-15 s; 60 °C-30 s; 72 °C-60 s |
Reverse | TGGCCTTTTGAAGAATCCAA | ||
Integrin β1 | Forward | CTGATTGGCTGGAGGAATGT | 95 °C-15 s; 60 °C-30 s; 72 °C-60 s |
Reverse | TGAGCAATTGAAGGATAATCATAG | ||
Src | Forward | TCGTGAGGGAGAGTGAGAC | 95 °C-15 s; 60 °C-30 s; 72 °C-60 s |
Reverse | GCGGGAGGTGATGTAGAAAC | ||
FAK | Forward | TCCACCAAAGAAACCACCTC | 95 °C-15 s; 60 °C-30 s; 72 °C-60 s |
Reverse | ACGGCTTGACACCCTCATT | ||
Cofilin | Forward | CAGACAAGGACTGCCGCTAT | 95 °C-15 s; 60 °C-30 s; 72 °C-60 s |
Reverse | TTGCTCTTGAGGGGTGCATT | ||
GAPDH | Forward | AGGCCGGTGCTGAGTATGTC | 95 °C-15 s; 60 °C-30 s; 72 °C-60 s |
Reverse | TGCCTGCTTCACCACCTTCT | ||
Runx2 | Forward | GGACGAGGCAAGAGTTTCA | 95 °C-15 s; 60 °C-30 s; 72 °C-60 s |
Reverse | TGGTGCAGAGTTCAGGGAG | ||
Osterix | Forward | CCCTTCCCTCACTCATTTCC | 95 °C-15 s; 60 °C-30 s; 72 °C-60 s |
Reverse | CAACCGCCTTGGGCTTAT | ||
Osteocalcin | Forward | AGACTCCGGCGCTACCTT | 95 °C-15 s; 60 °C-30 s; 72 °C-60 s |
Reverse | CTCGTCACAAGCAGGGTTAAG | ||
MMP2 | Forward | AACTTTGAGAAGGATGGCAAGT | 95 °C-15 s; 60 °C-30 s; 72 °C-60 s |
Reverse | TGCCACCCATGGTAAACAA | ||
MMP9 | Forward | TGTGCCCTGGAACTCACACGAC | 95 °C-15 s; 60 °C-30 s; 72 °C-60 s |
Reverse | ACGTCGTCCACCTGGTTCACCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mathias de Souza, B.L.; Escada, A.L.d.A.; Costa Fernandes, C.J.d.; de Almeida, G.S.; Zambuzzi, W.F.; Capellato, P.; Sachs, D.; Rosifini Alves, A.P. Obtaining of Antibacterial Nanoporous Layer on Ti7.5Mo Alloy Surface Combining Alkaline Treatment and Silver: In Vitro Studies. Coatings 2024, 14, 52. https://doi.org/10.3390/coatings14010052
Mathias de Souza BL, Escada ALdA, Costa Fernandes CJd, de Almeida GS, Zambuzzi WF, Capellato P, Sachs D, Rosifini Alves AP. Obtaining of Antibacterial Nanoporous Layer on Ti7.5Mo Alloy Surface Combining Alkaline Treatment and Silver: In Vitro Studies. Coatings. 2024; 14(1):52. https://doi.org/10.3390/coatings14010052
Chicago/Turabian StyleMathias de Souza, Barbara Lois, Ana Lúcia do Amaral Escada, Célio Junior da Costa Fernandes, Gerson Santos de Almeida, Willian Fernando Zambuzzi, Patricia Capellato, Daniela Sachs, and Ana Paula Rosifini Alves. 2024. "Obtaining of Antibacterial Nanoporous Layer on Ti7.5Mo Alloy Surface Combining Alkaline Treatment and Silver: In Vitro Studies" Coatings 14, no. 1: 52. https://doi.org/10.3390/coatings14010052
APA StyleMathias de Souza, B. L., Escada, A. L. d. A., Costa Fernandes, C. J. d., de Almeida, G. S., Zambuzzi, W. F., Capellato, P., Sachs, D., & Rosifini Alves, A. P. (2024). Obtaining of Antibacterial Nanoporous Layer on Ti7.5Mo Alloy Surface Combining Alkaline Treatment and Silver: In Vitro Studies. Coatings, 14(1), 52. https://doi.org/10.3390/coatings14010052