Antimicrobial Resistance and Biofilm-Forming Ability in ESBL-Producing and Non-ESBL-Producing Escherichia coli and Klebsiella pneumoniae Isolated from Canine Urinary Samples from Italy
Abstract
1. Introduction
2. Results
2.1. Animal and Sample Collection
2.2. Escherichia coli and Klebsiella pneumoniae Isolates
2.3. Phenotypic and Genetic Characterization of ESBL-Producing E. coli and K. pneumoniae
2.4. Antimicrobial Minimum Inhibitory Concentration (MIC) and Disk Diffusion Testing
2.5. Biofilm Formation
3. Discussion
4. Materials and Methods
4.1. Animals and Bacterial Isolates
4.2. Phenotypic Characterization of ESBL-/AmpC-/CP-Producing E. coli and K pneumoniae
4.3. Genetic Characterization of ESBL-Producing E. coli and K. pneumoniae
4.4. Antimicrobial Minimum Inhibitory Concentration (MIC) and Disk Diffusion Susceptibility Testing
4.5. Biofilm Formation Assessment Using Microtiter Plate (MtP) Assay
4.6. Sample Size Calculation and Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Daure, E.; Belanger, M.C.; Beauchamp, G.; Lapointe, C. Elevation of neutrophil gelatinase-associated lipocalin (NGAL) in non-azotemic dogs with urinary tract infection. Res. Vet. Sci. 2013, 95, 1181–1185. [Google Scholar] [CrossRef] [PubMed]
- Temmerman, R.; Berlamont, H.; El Garch, F.; Rose, M.; Simjee, S.; Meschi, S.; de Jong, A. Antimicrobial Susceptibility of Canine and Feline Urinary Tract Infection Pathogens Isolated from Animals with Clinical Signs in European Veterinary Practices during the Period 2013–2018. Antibiotics 2024, 13, 500. [Google Scholar] [CrossRef] [PubMed]
- Weese, J.S.; Blondeau, J.; Boothe, D.; Guardabassi, L.G.; Gumley, N.; Papich, M.; Jessen, L.R.; Lappin, M.; Rankin, S.; Westropp, J.L.; et al. International Society for Companion Animal Infectious Diseases (ISCAID) guidelines for the diagnosis and management of bacterial urinary tract infections in dogs and cats. Vet. J. 2019, 247, 8–25. [Google Scholar] [CrossRef]
- Roberts, M.; White, J.; Lam, A. Prevalence of bacteria and changes in trends in antimicrobial resistance of Escherichia coli isolated from positive canine urinary samples from an Australian referral hospital over a 5-year period (2013–2017). Vet. Rec. Open. 2019, 6, e000345. [Google Scholar] [CrossRef] [PubMed]
- McMeekin, C.H.; Hill, K.E.; Gibson, I.R.; Bridges, J.P.; Benschop, J. Antimicrobial resistance patterns of bacteria isolated from canine urinary samples submitted to a New Zealand veterinary diagnostic laboratory between 2005–2012. N. Z. Vet. J. 2017, 65, 99–104. [Google Scholar] [CrossRef] [PubMed]
- Yudhanto, S.; Hung, C.C.; Maddox, C.W.; Varga, C. Antimicrobial Resistance in Bacteria Isolated from Canine Urine Samples Submitted to a Veterinary Diagnostic Laboratory, Illinois, United States. Front. Vet. Sci. 2022, 9, 867784. [Google Scholar] [CrossRef] [PubMed]
- Weese, J.S.; Blondeau, J.M.; Boothe, D.; Breitschwerdt, E.B.; Guardabassi, L.; Hillier, A.; Lloyd, D.H.; Papich, M.G.; Rankin, S.C.; Turnidge, J.D.; et al. Antimicrobial use guidelines for treatment of urinary tract disease in dogs and cats: Antimicrobial guidelines working group of the international society for companion animal infectious diseases. Vet. Med. Int. 2011, 2011, 263768. [Google Scholar] [CrossRef] [PubMed]
- Mukerji, S.; O’Dea, M.; Barton, M.; Kirkwood, R.; Lee, T.; Abraham, S. Development and transmission of antimicrobial resistance among Gram-negative bacteria in animals and their public health impact. Essays Biochem. 2017, 61, 23–35. [Google Scholar]
- Woerde, D.J.; Reagan, K.L.; Byrne, B.A.; Weimer, B.C.; Epstein, S.E.; Schlesener, C.; Huang, B.C.; Sykes, J.E. Characteristics of Extended-Spectrum β-Lactamase Producing Enterobacterales Isolated from Dogs and Cats, 2011–2021. Vet. Sci. 2023, 10, 178. [Google Scholar] [CrossRef]
- Toombs-Ruane, L.J.; Benschop, J.; French, N.P.; Biggs, P.J.; Midwinter, A.C.; Marshall, J.C.; Chan, M.; Drinković, D.; Fayaz, A.; Baker, M.G.; et al. Carriage of Extended-Spectrum-Beta-Lactamase- and AmpC Beta-Lactamase-Producing Escherichia coli Strains from Humans and Pets in the Same Households. Appl. Environ. Microbiol. 2020, 86, e01613–e01620. [Google Scholar] [CrossRef]
- Kern, Z.T.; Jacob, M.E.; Gilbertie, J.M.; Vaden, S.L.; Lyle, S.K. Characteristics of Dogs with Biofilm-Forming Escherichia coli Urinary Tract Infections. J. Vet. Intern. Med. 2018, 32, 1645–1651. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Available online: https://www.who.int/news/item/29-04-2019-new-report-calls-for-urgent-action-to-avert-antimicrobial-resistance-crisis (accessed on 25 November 2024).
- Roscetto, E.; Varriale, C.; Galdiero, U.; Esposito, C.; Catania, M.R. Extended-Spectrum Beta-Lactamase-Producing and Carbapenem-Resistant Enterobacterales in Companion and Animal-Assisted Interventions Dogs. Int. J. Environ. Res. Public Health 2021, 18, 12952. [Google Scholar] [CrossRef]
- Aslam, B.; Wang, W.; Arshad, M.I.; Khurshid, M.; Muzammil, S.; Rasool, M.H.; Nisar, M.A.; Alvi, R.F.; Aslam, M.A.; Qamar, M.U.; et al. Antibiotic resistance: A rundown of a global crisis. Infect. Drug Resist. 2018, 11, 1645–1658. [Google Scholar] [CrossRef] [PubMed]
- Brazelton de Cardenas, J.N.; Garner, C.D.; Su, Y.; Tang, L.; Hayden, R.T. Comparative Evaluation of Assays for Broad Detection of Molecular Resistance Mechanisms in Enterobacterales Isolates. J. Clin. Microbiol. 2021, 59, e0103321. [Google Scholar] [CrossRef]
- Aurich, S.; Prenger-Berninghoff, E.; Ewers, C. Prevalence and Antimicrobial Resistance of Bacterial Uropathogens Isolated from Dogs and Cats. Antibiotics 2022, 11, 1730. [Google Scholar] [CrossRef] [PubMed]
- Osman, M.; Albarracin, B.; Altier, C.; Gröhn, Y.T.; Cazer, C. Antimicrobial resistance trends among canine Escherichia coli isolated at a New York veterinary diagnostic laboratory between 2007 and 2020. Prev. Vet. Med. 2022, 208, 105767. [Google Scholar] [CrossRef]
- Ballash, G.A.; Mollenkopf, D.F.; Diaz-Campos, D.; van Balen, J.C.; Cianciolo, R.E.; Wittum, T.E. Pathogenomics and clinical recurrence influence biofilm capacity of Escherichia coli isolated from canine urinary tract infections. PLoS ONE 2022, 17, e0270461. [Google Scholar] [CrossRef] [PubMed]
- Brložnik, M.; Šterk, K.; Zdovc, I. Prevalence and resistance patterns of canine uropathogens in regard to concurrent diseases. Berl. Munch. Tierarztl. Wochenschr. 2016, 129, 340–350. [Google Scholar] [PubMed]
- Sørensen, T.M.; Jensen, A.B.; Damborg, P.; Bjørnvad, C.R.; Guardabassi, L.; Jessen, L.R. Evaluation of different sampling methods and criteria for diagnosing canine urinary tract infection by quantitative bacterial culture. Vet. J. 2016, 216, 168–173. [Google Scholar] [CrossRef]
- Hernando, E.; Vila, A.; D’Ippolito, P.; Rico, A.J.; Rodon, J.; Roura, X. Prevalence and Characterization of Urinary Tract Infection in Owned Dogs and Cats from Spain. Top. Companion. Anim. Med. 2021, 43, 100512. [Google Scholar] [CrossRef]
- Moyaert, H.; Morrissey, I.; de Jong, A.; El Garch, F.; Klein, U.; Ludwig, C.; Thiry, J.; Youala, M. Antimicrobial Susceptibility Monitoring of Bacterial Pathogens Isolated from Urinary Tract Infections in Dogs and Cats Across Europe: ComPath Results. Microb. Drug Resist. 2017, 23, 391–403. [Google Scholar] [CrossRef] [PubMed]
- Thompson, M.F.; Litster, A.L.; Platell, J.L.; Trott, D.J. Canine bacterial urinary tract infections: New developments in old pathogens. Vet. J. 2011, 190, 22–27. [Google Scholar] [CrossRef]
- Norris, C.R.; Williams, B.J.; Ling, G.V.; Franti, C.E.; Johnson, D.L.; Ruby, A.L. Recurrent and persistent urinary tract infections in dogs: 383 cases (1969–1995). J. Am. Anim. Hosp. Assoc. 2000, 36, 484–492. [Google Scholar] [CrossRef]
- Seguin, M.A.; Vaden, S.L.; Altier, C.; Stone, E.; Levine, J.F. Persistent urinary tract infections and reinfections in 100 dogs (1989–1999). J. Vet. Intern. Med. 2003, 17, 622–631. [Google Scholar] [CrossRef] [PubMed]
- Quan, J.; Dai, H.; Liao, W.; Zhao, D.; Shi, Q.; Zhang, L.; Shi, K.; Akova, M.; Yu, Y. Etiology and prevalence of ESBLs in adult community-onset urinary tract infections in East China: A prospective multicenter study. J. Infect. 2021, 83, 175–181. [Google Scholar] [CrossRef] [PubMed]
- Dupouy, V.; Abdelli, M.; Moyano, G.; Arpaillange, N.; Bibbal, D.; Cadiergues, M.C.; Lopez-Pulin, D.; Sayah-Jeanne, S.; de Gunzburg, J.; Saint-Lu, N.; et al. Prevalence of Beta-Lactam and Quinolone/Fluoroquinolone Resistance in Enterobacteriaceae from Dogs in France and Spain-Characterization of ESBL/pAmpC Isolates, Genes, and Conjugative Plasmids. Front. Vet. Sci. 2019, 6, 279. [Google Scholar] [CrossRef] [PubMed]
- Shaheen, B.W.; Nayak, R.; Foley, S.L.; Kweon, O.; Deck, J.; Park, M.; Rafii, F.; Boothe, D.M. Molecular characterization of resistance to extended-spectrum cephalosporins in clinical Escherichia coli isolates from companion animals in the United States. Antimicrob. Agents Chemother. 2011, 55, 5666–5675. [Google Scholar] [CrossRef]
- Salgado-Caxito, M.; Benavides, J.A.; Adell, A.D.; Paes, A.C.; Moreno-Switt, A.I. Global prevalence and molecular characterization of extended-spectrum β-lactamase producing-Escherichia coli in dogs and cats—A scoping review and meta-analysis. One Health 2021, 12, 100236. [Google Scholar] [CrossRef] [PubMed]
- Karkaba, A.; Hill, K.; Benschop, J.; Pleydell, E.; Grinberg, A. Carriage and population genetics of extended spectrum β-lactamase-producing Escherichia coli in cats and dogs in New Zealand. Vet. Microbiol. 2019, 233, 61–67. [Google Scholar] [CrossRef] [PubMed]
- Jain, A.; Mondal, R. TEM & SHV genes in extended spectrum beta-lactamase producing Klebsiella species beta their antimicrobial resistance pattern. Indian J. Med. Res. 2008, 128, 759–764. [Google Scholar] [PubMed]
- Bush, K.; Jacoby, G.A. Updated functional classification of beta-lactamases. Agents Chemother. 2010, 54, 969–976. [Google Scholar] [CrossRef] [PubMed]
- Cantón, R.; Akóva, M.; Carmeli, Y.; Giske, C.G.; Glupczynski, Y.; Gniadkowski, M.; Livermore, D.M.; Miriagou, V.; Naas, T.; Rossolini, G.M.; et al. Rapid evolution and spread of carbapenemases among Enterobacteriaceae in Europe. Clin. Microbiol. Infect. 2012, 18, 413–431. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Zhao, G.; Chao, X.; Xie, L.; Wang, H. The Characteristic of Virulence, Biofilm and Antibiotic Resistance of Klebsiella pneumoniae. Int. J. Environ. Res. Public Health 2020, 17, 6278. [Google Scholar] [CrossRef] [PubMed]
- Costerton, J.W.; Stewart, P.S.; Greenberg, E.P. Bacterial biofilms: A common cause of persistent infections. Science 1999, 284, 1318–1322. [Google Scholar] [CrossRef]
- Soto, S.M.; Smithson, A.; Horcajada, J.P.; Martinez, J.A.; Mensa, J.P.; Vila, J. Implication of biofilm formation in the persistence of urinary tract infection caused by uropathogenic Escherichia coli. Clin. Microbiol. Infect. 2006, 12, 1034–1036. [Google Scholar] [CrossRef]
- Zogg, A.L.; Zurfluh, K.; Schmitt, S.; Nüesch-Inderbinen, M.; Stephan, R. Antimicrobial resistance, multilocus sequence types and virulence profiles of ESBL producing and non-ESBL producing uropathogenic Escherichia coli isolated from cats and dogs in Switzerland. Vet. Microbiol. 2018, 216, 79–84. [Google Scholar] [CrossRef]
- Johnstone, T. A clinical approach to multidrug-resistant urinary tract infection and subclinical bacteriuria in dogs and cats. N. Z. Vet. J. 2020, 68, 69–83. [Google Scholar] [CrossRef]
- Pomba, C.; Rantala, M.; Greko, C.; Baptiste, K.E.; Catry, B.; van Duijkeren, E.; Mateus, A.; Moreno, M.A.; Pyörälä, S.; Ružauskas, M.; et al. Public health risk of antimicrobial resistance transfer from companion animals. J. Antimicrob. Chemother. 2017, 72, 957–968. [Google Scholar] [CrossRef] [PubMed]
- Gibson, J.S.; Morton, J.M.; Cobbold, R.N.; Sidjabat, H.E.; Filippich, L.J.; Trott, D.J. Multidrug-resistant E. coli and Enterobacter extraintestinal infection in 37 dogs. J. Vet. Intern. Med. 2008, 22, 844–850. [Google Scholar] [CrossRef] [PubMed]
- Hamilton, E.; Kruger, J.M.; Schall, W.; Beal, M.; Manning, S.D.; Kaneene, J.B. Acquisition and persistence of antimicrobial-resistant bacteria isolated from dogs and cats admitted to a veterinary teaching hospital. J. Am. Vet. Med. Assoc. 2013, 243, 990–1000. [Google Scholar] [CrossRef] [PubMed]
- Ortiz-Díez, G.; Mengíbar, R.L.; Turrientes, M.C.; Artigao, M.B.; Gallifa, R.L.; Tello, A.M.; Pérez, C.F.; Santiago, T.A. Prevalence, incidence and risk factors for acquisition and colonization of extended-spectrum beta-lactamase- and carbapenemase-producing Enterobacteriaceae from dogs attended at a veterinary hospital in Spain. Comp. Immunol. Microbiol. Infect. Dis. 2023, 92, 101922. [Google Scholar] [CrossRef] [PubMed]
- Wong, C.; Epstein, S.E.; Westropp, J.L. Antimicrobial Susceptibility Patterns in Urinary Tract Infections in Dogs (2010–2013). J. Vet. Intern. Med. 2015, 29, 1045–1052. [Google Scholar] [CrossRef] [PubMed]
- Martin, R.M.; Bachman, M.A. Colonization, Infection, and the Accessory Genome of Klebsiella pneumoniae. Front. Cell. Infect. Microbiol. 2018, 8, 4. [Google Scholar] [CrossRef] [PubMed]
- Behzadi, P.; Urbán, E.; Gajdács, M. Association between Biofilm-Production and Antibiotic Resistance in Uropathogenic Escherichia coli (UPEC): An In Vitro Study. Diseases 2020, 8, 17. [Google Scholar] [CrossRef]
- Gilbertie, J.M.; Levent, G.; Norman, K.N.; Vinasco, J.; Scott, H.M.; Jacob, M.E. Comprehensive phenotypic and genotypic characterization and comparison of virulence, biofilm, and antimicrobial resistance in urinary Escherichia coli isolated from canines. Vet. Microbiol. 2020, 249, 108822. [Google Scholar] [CrossRef]
- Li, Y.; Fernández, R.; Durán, I.; Molina-López, R.A.; Darwich, L. Antimicrobial Resistance in Bacteria Isolated from Cats and Dogs from the Iberian Peninsula. Front. Microbiol. 2021, 11, 621597. [Google Scholar] [CrossRef] [PubMed]
- Rampacci, E.; Bottinelli, M.; Stefanetti, V.; Hyatt, D.R.; Sgariglia, E.; Coletti, M.; Passamonti, F. Antimicrobial susceptibility survey on bacterial agents of canine and feline urinary tract infections: Weight of the empirical treatment. J. Glob. Antimicrob. Resist. 2018, 13, 192–196. [Google Scholar] [CrossRef]
- Menezes, J.; Moreira da Silva, J.; Frosini, S.M.; Loeffler, A.; Weese, S.; Perreten, V.; Schwarz, S.; Telo da Gama, L.; Amaral, A.J.; Pomba, C. mcr-1 colistin resistance gene sharing between Escherichia coli from cohabiting dogs and humans, Lisbon, Portugal, 2018 to 2020. Euro Surveill. 2022, 27, 2101144. [Google Scholar] [CrossRef] [PubMed]
- Singhal, N.; Kumar, M.; Kanaujia, P.K.; Virdi, J.S. MALDI-TOF mass spectrometry: An emerging technology for microbial identification and diagnosis. Front. Microbiol. 2015, 6, 791. [Google Scholar] [CrossRef] [PubMed]
- Wood, M.W.; Lepold, A.; Tesfamichael, D.; Lasarev, M.R. Risk factors for enterococcal bacteriuria in dogs: A retrospective study. J. Vet. Intern. Med. 2020, 34, 2447–2453. [Google Scholar] [CrossRef] [PubMed]
- Dall’Ara, P.; Lauzi, S.; Turin, L.; Castaldelli, G.; Servida, F.; Filipe, J. Effect of Aging on the Immune Response to Core Vaccines in Senior and Geriatric Dogs. Vet. Sci. 2023, 10, 412. [Google Scholar] [CrossRef] [PubMed]
- EUCAST Guidelines for Detection of Resistance Mechanisms and Specific Resistances of Clinical and/or Epidemiological Importance (V 2.0). 2017. Available online: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Resistance_mechanisms/EUCAST_detection_of_resistance_mechanisms_170711.pdf (accessed on 26 November 2024).
- Monstein, H.J.; Ostholm-Balkhed, A.; Nilsson, M.V.; Nilsson, M.; Dornbusch, K.; Nilsson, L.E. Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. APMIS 2007, 115, 1400–1408. [Google Scholar] [CrossRef]
- Saladin, M.; Cao, V.T.; Lambert, T.; Donay, J.L.; Herrmann, J.L.; Ould-Hocine, Z.; Verdet, C.; Delisle, F.; Philippon, A.; Arlet, G. Diversity of CTX-M beta-lactamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals. FEMS Microbiol. Lett. 2002, 209, 161–168. [Google Scholar] [PubMed]
- Commission Implementing Decision (EU) 2020/1729 of 17 November 2020 on the Monitoring and Reporting of Antimicrobial Resistance in Zoonotic and Commensal Bacteria and Repealing Implementing Decision 2013/652/EU (Notified Under Document C(2020) 7894). Available online: https://eur-lex.europa.eu/legal-content/EN/TXT/PDF/?uri=CELEX:32020D1729 (accessed on 14 October 2024).
- The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters(V 14.0). 2024. Available online: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_14.0_Breakpoint_Tables.pdf (accessed on 26 November 2024).
- CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 7th ed.; CLSI Supplement VET01S; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2024; Available online: http://vet01s.edaptivedocs.net/GetDoc.aspx?doc=CLSI%20VET01S%20ED7:2024&sbssok=CLSI%20VET01S%20ED7:2024%20SECTION%20ABSTRACT (accessed on 26 November 2024).
- European Committee on Antimicrobial Susceptibility Testing. Data from the EUCAST MIC Distribution Website. Available online: https://www.eucast.org (accessed on 23 September 2024).
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed]
- Stepanović, S.; Vuković, D.; Dakić, I.; Savić, B.; Švabić-Vlahović, M. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J. Microbiol. Methods 2000, 40, 175–179. [Google Scholar] [CrossRef]

| Population Characteristics | No. | No. (%) E. coli/ K. pneumoniae | Significance | No. (%) ESBL | Significance | No. (%) MDR | Significance | |
|---|---|---|---|---|---|---|---|---|
| Sex | Male | 53 | 12 (22.6) | 0.53 | 1 (1.9) | 0.873 | 4 (7.5) | 1 |
| Female | 80 | 22 (27.5) | 3 (3.8) | 7 (8.8) | ||||
| Breed a | Dachshund | 8 | 1 (12.5) | 0.038 * | - | 0.4846 | - | 0.074 |
| German Shepherd Dog | 6 | 2 (33.3) | - | 1 (16.7) | ||||
| Golden Retriever | 6 | 4 (66.7) | 1 (16.7) | 3 (50) | ||||
| Labrador Retriever | 7 | 2 (28.6) | - | - | ||||
| Other pure breeds b | 69 | 11 (15.9) | 2 (2.9) | 3 (4.3) | ||||
| Mixed breed | 36 | 14 (38.9) | 1 (2.8) | 4 (11.1) | ||||
| Breed size classification | Small (≤9 kg) | 43 | 8 (18.6) | 0.3824 | 2 (4.7) | 0.843 | 4 (10.3) | 0.81 |
| Medium (10–22 kg) | 39 | 11 (28.2) | 1 (2.6) | 3 (9.7) | ||||
| Large (23–41 kg) | 43 | 14 (32.6) | 1 (2.3) | 4 (12.1) | ||||
| Giant (>41 kg) | 8 | 1 (12.5) | - | - | ||||
| Age groups c | Young (≤1 year) | 15 | 3 (20) | 0.331 | - | 0.469 | 1 (6.7) | 0.45 |
| Adult (>1 to ≤4/6 years) d | 21 | 5 (23.8) | 1 (4.8) | 1 (4.8) | ||||
| Senior (5/7 to 9/13 years) d | 59 | 13 (22) | 3 (5.1) | 6 (10.2) | ||||
| Geriatric (≥10/14 years) d | 34 | 13 (38.2) | - | 3 (8.8) | ||||
| Administration of antimicrobial therapy | Yes | 35 | 13 (3.1) | 0.07 | 2 (5.7) | 0.169 | 6 (17.1) | 0.037 * |
| No | 98 | 21 (21.4) | 1 (1) | 5 (5.1) | ||||
| Administered antimicrobial agents e | Amoxicillin + clavulanic acid | 19 | 1 (5.3) | nd | 1 (5.3) | nd | 1 (5.3) | nd |
| Ampicillin | 4 | 3 (75) | - | (33.3) | ||||
| Ceftriaxone | 1 | - | - | - | ||||
| Clindamycin | 1 | - | - | - | ||||
| Doxycycline | 1 | - | - | - | ||||
| Enrofloxacin | 8 | 3 (37.5) | 1 (12.5) | 2 (25) | ||||
| Marbofloxacin | 5 | 4 (80) | 2 (40) | 3 (60) | ||||
| Nitrofurantoin | 1 | 1 | 1 (100) | 1 (100) | ||||
| Spiramycin + metronidazole | 2 | 1 | - | - | ||||
| Hospitalization | Yes | 29 | 11 (37.9) | 0.37 | 2 (6.9) | 0.21 | 5 (17.2) | 0.05 |
| No | 104 | 23 (22.1) | 2 (1.9) | 6 (5.8) | ||||
| Recurrent infection | Yes | 12 | 7 (58.3) | 0.01 * | 2 (16.7) | 0.04 * | 4 (33.3) | 0.06 |
| No | 121 | 27 (22.3) | 2 (1.7) | 7 (5.8) | ||||
| Type of sampling f | Cystocentesis | 117 | 32 (27.4) | 0.61 | 4 (3.4) | 0.905 | 9 (7.7) | 0.493 |
| Catheterism | 3 | - | - | - | ||||
| Voided sample | 10 | 2 (20) | - | 2 (20) | ||||
| Year of sampling | 2021 | 56 | 11 (19.6) | 0.18 | 2 (3.6%) | 0.51 | 4 (56) | 0.76 |
| 2023 | 77 | 23 (29.9) | 2 (2.6%) | 7 (77) | ||||
| Characteristics | No. | No. (%) ESBL | Significance | No. (%) MDR | Significance | No. (%) Biofilm-Producing | Significance | |
|---|---|---|---|---|---|---|---|---|
| Bacterial species | E. coli | 28 | 1 (3.6) | 0.012 * | 7 (25) | 0.07 | 17 (60.7) | 0.15 |
| K. pneumoniae | 6 | 3 (50) | 4 (66.7) | 6 (100) | ||||
| ESBL production | Non-ESBL | 30 | nd | 7 (23.3) | 0.01 * | 20 (66.7) | 1 | |
| ESBL- | 4 | 4 (100) | 3 (75) | |||||
| MDR isolates | Yes | 11 | 4 (100) | 0.01 * | nd | 8 (72.7) | 0.096 | |
| No | 23 | - | 15 (65.2) | |||||
| Biofilm- production | Non-biofilm producers | 11 | 1 (9.1) | 0.104 | 3 (27.3) | 0.056 | nd | |
| Weakly adherent | 20 | 1 (5) | 5 (25) | |||||
| Moderately adherent | 3 | 2 (66.7) | 3 (100) | |||||
| Antimicrobial Class | Antimicrobial Agent | Breakpoint | Total No. Resistant/ Total Analyzed (%) |
|---|---|---|---|
| β-lactam (penicillins) | AMP a | 8 | 15/34 (44) |
| TRM a | 16 | 1/4 (25) e | |
| β-lactam (cephalosporins) | FEP a | 4 | 1/4 (25) e |
| FOT a | 2 | 5/34 (15) | |
| FOX a | 8 | 2/4 (50) e | |
| TAZ a | 4 | 5/34 (15) | |
| Carbapenems | ETP a | 0.5 | 0/4 (0) e |
| IMI a | 4 | 0/4 (0) e | |
| MERO a | 8 | 0/34 | |
| β-lactam combination | AMC b | 17 | 4/22 (18) |
| F/C c | 0.25 | 1/4 (25) e | |
| T/C c | 1 (E. coli); 0.5 (K. pneumoniae) | 1/4 (25) e | |
| Aminoglycoside | AMI a | 8 | 0/34 (0) |
| GEN a | 2 | 2/34 (6) | |
| Glycylcyclines | TGC a | 0.5 | 6/34 (18) |
| Fluoroquinolones | CIP a | 0.5 | 9/34 (27) |
| Quinolones | NAL c | 8 | 11/34 (32) |
| Folate antagonist | TMS b | 10 | 3/22 (14) |
| TMP c | 2 | 6/34 (18) | |
| Macrolides | AZI c | 16 | 3/34 (9) |
| Phenicols | CHL a | 16 | 8/34 (24) |
| Polymyxins | COL a | 2 | 2/34 (6) |
| Tetracycline | TET d | 16 | 11/34 (32) |
| Target | Primer | Sequence 5′-3′ | Reference |
|---|---|---|---|
| CTX-M | blaCTX-M F | ATGTGCAGYACCAGTAARGTKATGGC | [54] |
| blaCTX-M R | TGGGTRAARTARGTSACCAGAAYCAGCGG | ||
| CTX-M-1 group | blaCTX-M-1 F | GGTTAAAAAATCACTGCGYC | [55] |
| blaCTX-M-1 R | TYGGTGACGATTTTAGCCGC | ||
| TEM | blaTEM F | TCGCCGCATACACTATTCTCAGAATGA | [54] |
| blaTEM R | ACGCTCACCGGCTCCAGATTTAT | ||
| SHV | blaSHV F | ATGCGTTATATTCGCCTGTG | [54] |
| blaSHV R | TGCTTTGTTATTCGGGCCAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Facchin, A.; Filipe, J.; Mauri, I.; Tagliasacchi, F.; Grilli, G.; Vitiello, T.; Ratti, G.; Musa, L.; Penati, M.; Scarpa, P.; et al. Antimicrobial Resistance and Biofilm-Forming Ability in ESBL-Producing and Non-ESBL-Producing Escherichia coli and Klebsiella pneumoniae Isolated from Canine Urinary Samples from Italy. Antibiotics 2025, 14, 31. https://doi.org/10.3390/antibiotics14010031
Facchin A, Filipe J, Mauri I, Tagliasacchi F, Grilli G, Vitiello T, Ratti G, Musa L, Penati M, Scarpa P, et al. Antimicrobial Resistance and Biofilm-Forming Ability in ESBL-Producing and Non-ESBL-Producing Escherichia coli and Klebsiella pneumoniae Isolated from Canine Urinary Samples from Italy. Antibiotics. 2025; 14(1):31. https://doi.org/10.3390/antibiotics14010031
Chicago/Turabian StyleFacchin, Alessia, Joel Filipe, Irene Mauri, Filippo Tagliasacchi, Guido Grilli, Tiziana Vitiello, Gabriele Ratti, Laura Musa, Martina Penati, Paola Scarpa, and et al. 2025. "Antimicrobial Resistance and Biofilm-Forming Ability in ESBL-Producing and Non-ESBL-Producing Escherichia coli and Klebsiella pneumoniae Isolated from Canine Urinary Samples from Italy" Antibiotics 14, no. 1: 31. https://doi.org/10.3390/antibiotics14010031
APA StyleFacchin, A., Filipe, J., Mauri, I., Tagliasacchi, F., Grilli, G., Vitiello, T., Ratti, G., Musa, L., Penati, M., Scarpa, P., & Lauzi, S. (2025). Antimicrobial Resistance and Biofilm-Forming Ability in ESBL-Producing and Non-ESBL-Producing Escherichia coli and Klebsiella pneumoniae Isolated from Canine Urinary Samples from Italy. Antibiotics, 14(1), 31. https://doi.org/10.3390/antibiotics14010031

