Next Article in Journal
Population Pharmacokinetic Study of Benzylpenicillin in Critically Unwell Adults
Previous Article in Journal
Improving Antimicrobial Use to Protect the Environment: What Is the Role of Infection Specialists?
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cross-Talking of Pathway-Specific Regulators in Glycopeptide Antibiotics (Teicoplanin and A40926) Production

by
Andrés Andreo-Vidal
1,
Oleksandr Yushchuk
1,2,*,
Flavia Marinelli
1 and
Elisa Binda
1
1
Department of Biotechnology and Life Sciences, University of Insubria, via J. H. Dunant 3, 21100 Varese, Italy
2
Department of Genetics and Biotechnology, Ivan Franko National University of Lviv, 79005 Lviv, Ukraine
*
Author to whom correspondence should be addressed.
Antibiotics 2023, 12(4), 641; https://doi.org/10.3390/antibiotics12040641
Submission received: 3 March 2023 / Revised: 19 March 2023 / Accepted: 21 March 2023 / Published: 24 March 2023
(This article belongs to the Section Antimicrobial Peptides)

Abstract

Teicoplanin and A40926 (natural precursor of dalbavancin) are clinically relevant glycopeptide antibiotics (GPAs) produced by Actinoplanes teichomyceticus NRRL B-16726 and Nonomuraea gerenzanensis ATCC 39727. Their biosynthetic enzymes are coded within large biosynthetic gene clusters (BGCs), named tei for teicoplanin and dbv for A40926, whose expression is strictly regulated by pathway-specific transcriptional regulators (PSRs), coded by cluster-situated regulatory genes (CSRGs). Herein, we investigated the “cross-talk” between the CSRGs from tei and dbv, through the analysis of GPA production levels in A. teichomyceticus and N. gerenzanensis strains, with knockouts of CSRGs cross-complemented by the expression of heterologous CSRGs. We demonstrated that Tei15* and Dbv4 StrR-like PSRs, although orthologous, were not completely interchangeable: tei15* and dbv4 were only partially able or unable to cross-complement N. gerenzanensis knocked out in dbv4 and A. teichomyceticus knocked out in tei15*, implying that the DNA-binding properties of these PSRs are more different in vivo than it was believed before. At the same time, the unrelated LuxR-like PSRs Tei16* and Dbv3 were able to cross-complement corresponding N. gerenzanensis knocked out in dbv3 and A. teichomyceticus knocked out in tei16*. Moreover, the heterologous expression of dbv3 in A. teichomyceticus led to a significant increase in teicoplanin production. Although the molecular background of these events merits further investigations, our results contribute to a deeper understanding of GPA biosynthesis regulation and offer novel biotechnological tools to improve their production.

1. Introduction

Actinobacteria produce more than two-thirds of antibiotics used in medicine and agriculture, as well as other specialized metabolites [1]. One example of these valuable compounds are glycopeptide antibiotics (GPAs) which are last-resort drugs against multidrug-resistant Gram-positive pathogens such as staphylococci, enterococci, and Clostridioides difficile [2,3]. Natural GPAs are produced by fermentation of filamentous actinobacteria mainly from the genera Amycolatopsis, Actinoplanes, and Nonomuraea [4]. They are divided into five types according to their structure; among them, types I-IV (also known as dalbaheptides) are clinically relevant [4,5]. Clinically important GPAs include first-generation vancomycin and teicoplanin [6], which are produced by Amycolatopsis orientalis strains [7] and Actinoplanes teichomyceticus NRRL B-16726 [8], respectively, by fermentation processes that were developed and have been described in the past [9,10,11,12,13,14]. Vancomycin was introduced in clinics first (in 1958) [15], followed by teicoplanin (in 1988 in Europe and in 1998 in Japan) [16,17]. Second-generation GPAs are semisynthetic molecules, approved for therapeutic use in the last decade, chemically deriving either from the natural vancomycin-like molecules produced by fermentation (telavancin and oritavancin) [18] or from A40926 (dalbavancin) [19]. The latter natural precursor of dalbavancin—A40926—is biosynthesized by the uncommon actinobacterium Nonomuraea gerenzanensis ATCC 39727 [20]. The renewed interest for these antibiotics and their newest developments, highlighting the importance of developing next-generation semisynthetic GPAs with enhanced antibacterial activities and improved safety profiles, have been recently stated in different reviews [21,22,23,24,25]. Recent efforts have also aimed at developing targeted therapies, and advances have been made in extending the activity of GPAs toward Gram-negative organisms [21,22,23,24,25].
As for the majority of specialized metabolites, GPA biosynthetic enzymes are coded within large biosynthetic gene clusters (BGCs) [21,22]. Similarly to other antibiotic biosynthetic pathways [26], the expression of GPA BGCs is strictly regulated by pathway-specific transcriptional regulators (PSRs), coded by cluster-situated regulatory genes (CSRGs). It is likely that the expression of these CSRGs is by turn controlled by pleiotropic regulators of a higher rank, although the knowledge of their role is still very limited [27,28]. All the described GPA BGCs contain at least one CSRG, coding for a StrR-like [29] transcriptional regulator [30]. An additional CSRG could be present in GPA BGCs [30], coding for a large ATP-binding regulator belonging to the LuxR family [31,32]. The roles of CSRGs have been investigated in Amycolatopsis balhimycina DSM 5908 [33], Amycolatopsis japonicum MG417-CF17 [12], Amycolatopsis sp. TNS106 [13], Amycolatopsis orientalis NCPC 2-48 [34], A. teichomyceticus NRRL B-16726 [30,35], and N. gerenzanensis ATCC 39727 [36,37,38], producing balhimycin, ristocetin (both MG417-CF17 and TNS106), norvancomycin, teicoplanin, and A40926, respectively. The best-studied cases are those of Am. balhimycina DSM 5908, A. teichomyceticus NRRL B-16726, and N. gerenzanensis ATCC 39727. The expression of balhimycin BGC—bal [39]—is controlled by a single StrR-like PSR, named Bbr [33]. Teicoplanin BGC (called tei) encodes two PSRs: Tei15* (StrR-like) and Tei16* (LuxR-like) [40,41], while A40926 BGC (called dbv) also codes for two PSRs: Dbv3 (LuxR-like) and Dbv4 (StrR-like) [42].
The transcriptional control of BGCs with only one CSRG seems to be rather straightforward and is well represented by the model involving Bbr, which singularly controls the expression of the majority of bal genes and operons [33]. On the contrary, the regulatory mechanisms of the GPA BGCs (as tei and dbv) carrying two different CSRGs are more intriguing. Previous works reported that either in A. teichomyceticus or in N. gerenzanensis, the expression of both CSRGs is essential for GPA biosynthesis, since the knockout of each of them completely abolished antibiotic production [35,37]. In addition, the overexpression of tei15*, tei16*, dbv3, and dbv4 significantly improved GPA production in the homologous producers [35,37,38]. Nevertheless, the logic behind the functions of the PSRs of tei and dbv is quite different. Notably, in A. teichomyceticus, the StrR-like regulator—Tei15*—was shown to directly control the expression of the majority of the tei genes (5) and operons (5), coding for NRPS, for tailoring enzymes, and for enzymes of non-proteinogenic amino acids biosynthesis [30]. At the same time, tei15* itself seemed to be the single target of LuxR-like Tei16* [30]. On the contrary, in N. gerenzanensis, StrR-like PSR Dbv4 was responsible for the activation of only two operons: dbv14–8 (coding for cross-linking monooxygenases, halogenase, glycosyltransferase, and acyltransferase) and dbv30–35 (coding for the l-3,5-dihydroxyphenylglycine biosynthesis enzymes) [37]. The other operons (5) and genes (2) of dbv appeared to be under the control of the LuxR-like PSR Dbv3 [37]. Hence, the tei expression seems to be controlled by Tei15* and Tei16* in a hierarchical fashion, while Dbv3 and Dbv4 possess two separate regulons within dbv.
The DNA-binding properties of StrR-like PSRs coded in GPA BGCs have been extensively investigated and seem to be quite similar [33,35,36]. On the other hand, the exact mechanisms of action of LuxR-like PSRs from A. teichomyceticus (Tei16*) and N. gerenzanensis (Dbv3) remain obscure. In particular, the analysis of Tei16* DNA-binding properties in vitro failed to reveal any target within tei [35], while the DNA binding features of Dbv3 have not been investigated yet.
A recent work reconstructing the overall phylogeny of StrR-like PSRs coded within GPA BGCs demonstrated that Dbv4 and Tei15* belong to two separate clades of the phylogenetic tree, while Dbv3 and Tei16* are likely non-orthologous, having emerged in the corresponding BCGs independently. Notably, Dbv4 was found to be closely related to Bbr and to Ajr (the StrR-like PSR encoded within ristocetin BGC from Am. japonicum MG417-CF17), and indeed all these PSRs showed a high degree of interchangeability in regulating cognate GPA BGCs [12,37]. However, the degree of interchangeability of less related PSRs, such as the abovementioned Dbv4 and Tei15*, as well as Dbv3 and Tei16*, has not been investigated yet.
In the current work, we investigated the “cross-talk” between the CSRGs from tei and dbv BGCs. We demonstrated that tei15* and dbv4 are not completely interchangeable, implying that the DNA-binding properties of phylogenetically distant StrR-like PSRs are more different in vivo than was supposed. At the same time, surprisingly, unrelated LuxR-like PSRs were able to cross-complement corresponding mutants of A. teichomyceticus and N. gerenzanensis. Moreover, the overexpression of dbv3 in A. teichomyceticus led to a significant increase in teicoplanin production.

2. Results

2.1. Generation and Complementation of dbv3 and dbv4 N. gerenzanensis Knockout Mutants

Previously, we reported that the knockouts of tei15* and tei16* CSRGs in A. teichomyceticus completely abolished the production of teicoplanin, while the re-introduction of wild type alleles restored antibiotic biosynthesis [35]. In this work, we knocked out dbv3 and dbv4, replacing them with the spectinomycin/streptomycin resistance cassette oriT-aadA by using the λ-Red-mediated recombineering approach [43]. Although other authors have previously reported on the generation of dbv4 and dbv3 knockout mutants where the apramycin resistance cassette (oriT-aac(3)IV) replaced target genes [37], for the current work, we required apramycin-sensitive mutants. Our strategy for performing knockouts of dbv3 and dbv4 is described in the Materials and Methods (Section 4) and is reported in detail in Figure S1 (Supplementary Materials).
Obtained mutants—N. gerenzanensis Δdbv3 and Δdbv4 (Table 1)—were cultivated in the FM2 medium (optimized for high-level A40926 production in N. gerenzanensis [11]). Both mutants were not able to produce A40926, as confirmed using a B. subtilis HB0933 growth inhibition assay (Figure 1a) and HPLC analysis (Figure 1b).
To complement N. gerenzanensis Δdbv3 and Δdbv4, two different platforms for the dbv3 and dbv4 expression were tested, being either pSET152A [45] or pIJ12551 [46] derivatives (Table 1). Both platforms were φC31-based integrative vectors providing a stable gene expression. pSET152A derivatives were pSAD4 and pSAD3 (already reported in our previous work [38]), where dbv4 and dbv3 were placed under the control of the apramycin resistance gene promoter (aac(3)IVp). These vectors were previously used to markedly increase the production of GPAs in Nonomuraea spp. [38,47]. In pIJ12551, dbv4 and dbv3 were placed under the control of the erythromycin resistance gene promotor (ermEp). This is the most widely used promoter for gene overexpression in Streptomyces spp. [48,49], but it was previously shown to be rather weak in Nonomuraea spp. [38]. Complemented strains were named N. gerenzanensis Δdbv3 pSAD3+, N. gerenzanensis Δdbv4 pSAD4+, N. gerenzanensis Δdbv4 pIJ12551dbv4+, and N. gerenzanensis Δdbv3 pIJ12551dbv3+ (see Table 1).
All the recombinant strains were verified by PCR (Figure S3) and cultivated in FM2 medium for 144 h. Culture extracts at this time point demonstrated restored antimicrobial activity in bioassays (Figure 2a). HPLC analysis of the same extracts further revealed that N. gerenzanensis Δdbv3 pSAD3+ and Δdbv4 pSAD4+ produced A40926 at approximately 25% of the wild type, while the A40926 production level was completely restored in N. gerenzanensis Δdbv4 pIJ12551dbv4+, but it reached only ca. 1.5% in N. gerenzanensis Δdbv3 pIJ12551dbv3+ (Figure 2b). The A40926 production levels of N. gerenzanensis Δdbv3 pIJ12551dbv3+ were slightly better when monitored in E26 vegetative medium, where they reached 13.25 mg/L (ca. 3% of the parental strain productivity in FM2 medium) (Figure 2b).

2.2. Cross-Complementation of N. gerenzanensis Δdbv4 and A. teichomyceticus Δtei15* with tei15* and dbv4

As demonstrated in our previous work [30], dbv4 and tei15* (coding for StrR-like transcriptional regulators) are orthologous, and they have orthologues in all other GPA BGCs. In addition, Dbv4 and its orthologue from Am. balhimycina DSM 5908 balhimycin BGC—Bbr [33]—showed similar DNA-binding properties [36]. Regarding this, we speculated that dbv4 and tei15* might be interchangeable. To investigate such eventual “cross-talk” between PSRs controlling teicoplanin and A40926 production, we “exchanged” the genes coding for StrR-like transcriptional regulators between N. gerenzanensis and A. teichomyceticus. To achieve this, we introduced either pSET152Atei15* [35] or pIJ12551tei15* plasmids into N. gerenzanensis Δdbv4. In parallel, we transferred pSHAD4 (carrying dbv4) into the teicoplanin non-producing mutant A. teichomyceticus Δtei15* [35]. pSHAD4 was generated by replacing the aac(3)IV gene in pSAD4 with the hygromycin resistance gene hygR. Such a replacement was necessary since A. teichomyceticus Δtei15* is resistant to apramycin. Obtained recombinant strains (validated by PCR as reported in Figure S4) were named N. gerenzanensis Δdbv4 pSET152Atei15*+, N. gerenzanensis Δdbv4 pIJ12551tei15*+, and A. teichomyceticus Δtei15* pSHAD4+ (Table 1).
N. gerenzanensis recombinant strains were cultivated in FM2 medium, as previously described, and their A40926 production was followed by B. subtilis growth inhibition assays and HPLC analyses of the corresponding culture broth extracts. Although no antimicrobial activity against B. subtilis HB0933 was detectable for N. gerenzanensis Δdbv4 pSET152Atei15*+ (Figure S5), a small inhibition halo was observed only in the case of N. gerenzanensis Δdbv4 pIJ12551tei15*+ (Figure 3a), but no A40926 was identified through HPLC analyses.
The poor antimicrobial activity of N. gerenzanensis Δdbv4 pIJ12551tei15*+ was further assessed against B. subtilis HB0950 (Figure 3b), a reporter strain containing the lacZ gene (coding for β-galactosidase) fused to the liaI promoter (PliaI), which is able to activate the expression of lacZ in response to the cell wall stress caused by lipid II binders [50]. Thus, GPA production could be identified by cultivating B. subtilis HB0950 in the presence of X-Gal; as lipid II binders, GPAs induce the chromogenic conversion of X-Gal. Indeed, the chromogenic conversion of X-Gal was induced by extracts obtained from N. gerenzanensis ATCC 39727 and N. gerenzanensis Δdbv4 pIJ12551tei15*+, indicating that they both produce A40926 (Figure 3b). Driven by this evidence, the bioactive culture extracts of N. gerenzanensis Δdbv4 pIJ12551tei15*+ were concentrated ten times by lyophilization and A40926 became detectable by HPLC, although at a low concentration (the estimated production was 2 mg/L after 144 h of cultivation in FM2 medium) (Figure 4a). These results indicated that the heterologous expression of tei15* might, albeit at a low efficiency, complement the dbv4 knockout in N. gerenzanensis.
Teicoplanin production was then analyzed cultivating A. teichomyceticus Δtei15* pSHAD4+ in TM1 medium, previously optimized for teicoplanin production [9], alongside with the parental strain. The culture broth extracts exhibited no antimicrobial activities against either B. subtilis HB0933 (Figure 3a) or B. subtilis HB0950 (Figure 3b), even after being ten-times concentrated by lyophilization. Confirming the results of growth inhibition assays, no teicoplanin production was detected by means of HPLC. Consequently, A. teichomyceticus Δtei15* pSHAD4+ was cultivated in a set of different media, testing different combinations of vegetative and production media, previously used for growing other GPA producing strains. These were TM1 [9], ISP2 [51], VSP [11], and the vegetative media E25 [9] modified by adding 1 g/L of l-valine, which is the amino acid precursor contributing to the increased production of teicoplanin [5]. Again, in none of these conditions, A. teichomyceticus Δtei15* pSHAD4+ exhibited antimicrobial activity and teicoplanin could not be detected by HPLC. Thus, we concluded that dbv4 was not able to complement the teicoplanin production phenotype in A. teichomyceticus Δtei15*.

2.3. Cross-Complementation of N. gerenzanensis Δdbv3 and A. teichomyceticus Δtei16* with tei16* and dbv3

In addition to CSRGs coding for StrR-like transcriptional regulators, teicoplanin and A40926 BGCs also carry CSRGs for LuxR-like transcriptional regulators. Differently from StrR-like proteins, Dbv3 and Tei16* are not orthologous [30]; Tei16* has its orthologues coded within the BGCs of other Actinoplanes-derived GPAs, and, surprisingly, in feglymycin BGC from Streptomyces sp. DSM 11171 [52]. On the other hand, Dbv3 orthologues are coded only in Nonomuraea-derived BGCs for dalbaheptides and type V GPAs [47,53]. Thus, we considered it to be particularly intriguing to investigate if a cross-complementation between seemingly unrelated CSRGs might occur.
To achieve this goal, we transferred pSET152Atei16*—previously reported to trigger teicoplanin overproduction in A. teichomyceticus [45]—into N. gerenzanensis Δdbv3 (described above). In parallel, pSHAD3 was transferred into A. teichomyceticus Δtei16* teicoplanin non-producing mutant. So-obtained recombinant strains expressing heterologous genes for LuxR-like regulators (validated by PCR as reported in Figure S4) were named N. gerenzanensis Δdbv3 pSET152Atei16*+ and A. teichomyceticus Δtei16* pSHAD3+ (Table 1).
As illustrated in Figure 3, N. gerenzanensis Δdbv3 pSET152Atei16*+ inhibited the growth of B. subtilis HB0933 (Figure 3a) and was able to induce the chromogenic conversion of X-Gal in B. subtilis HB0950 (Figure 3b), indicating that tei16* was able to restore A40926 production. HPLC analysis of the concentrated culture extracts of N. gerenzanensis Δdbv3 pSET152Atei16*+ confirmed the complementation of the A40926 production phenotype, with an estimated production reaching 5–6% of the wild type A40926 production levels after 144 h of cultivation in FM2 medium (Figure 4b).
The growth of A. teichomyceticus Δtei16* pSHAD3+ (carrying dbv3) was very poor in TM1 production medium due to severe mycelium fragmentation. Similarly to the case of A. teichomyceticus Δtei15* pSHAD4+ (see above), we investigated whether some other liquid media might support its better growth and teicoplanin production. Indeed, teicoplanin production was observed when A. teichomyceticus Δtei16* pSHAD3+ was cultivated in E25 vegetative medium supplemented with 1 g/L of l-valine by means of B. subtilis HB0933 (Figure 3a) and HB0950 growth inhibition assays (Figure 3b). The HPLC analysis of culture broth extracts from A. teichomyceticus Δtei16* pSHAD3+ confirmed the restoration of the teicoplanin production phenotype (Figure 5), showing the production of approximately 150 mg/L of teicoplanin (as the cumulative concentration of five main congeners [9]).

2.4. Expression of tei15* and tei16* in the Double dbv3 and dbv4 Knockout Mutant of N. gerenzanensis

Unlike in A. teichomyceticus [30,35], the PSRs of A40926 biosynthesis do not act hierarchically; instead, either Dbv4 or Dbv3 control the expression of discrete regulons within dbv. Our data demonstrated (see above) that the introduction of either tei15* or tei16* into Δdbv4 and Δdbv3 mutants of N. gerenzanensis, respectively, restored A40926 production to a certain extent. In the case of N. gerenzanensis Δdbv4 pIJ12551tei15*+, such a restoration could be readily explained because both Dbv4 and Tei15* are related StrR-like regulators binding similar operator sequences [35,36]. Hence, Tei15* is probably able to activate only the genes of Dbv4 regulon. The case of N. gerenzanensis Δdbv3 pSET152Atei16*+ is more obscure: since both LuxR-like regulators are distantly related [30], it is possible that the Tei16*-mediated restoration of A40926 production might be unspecific, activating different genes from Dbv4 and Dbv3 regulons, or even involving some other players.
To evaluate if the introduction of tei15* and tei16* specifically restores A40926 production in Δdbv4 and Δdbv3 mutants, we decided to create a double dbv3 and dbv4 knockout mutant of N. gerenzanensis. Thus, both genes together were replaced with the oriT-aadA cassette using the λ-Red-mediated recombineering approach [43], as described in Materials and Methods (Figure S1). The obtained mutant was named N. gerenzanensis Δdbv3–4 and was verified by PCR (Figure S1). As expected, N. gerenzanensis Δdbv3–4 was unable to produce A40926 (Figure S6a,b). We further introduced either tei15* or tei16* in the double knockout mutant; obtained strains were called N. gerenzanensis Δdbv3–4 pIJ12551tei15*+ and N. gerenzanensis Δdbv3–4 pSET152Atei16*+, respectively (Table 1), and were verified by PCR (Figure S7). In both recombinants, we observed no restoration of A40926 production or the induction of any other antimicrobial activities (Figure S6a). Considering these results, we could conclude that either the tei15*- or tei16*-mediated restoration of A40926 production in N. gerenzanensis Δdbv4 and Δdbv3, respectively, is rather due to the specific activation of Dbv4 and Dbv3 regulons.

2.5. Cross-Overexpression of dbv and tei CSRGs in N. gerenzanensis ATCC 39727 and A. teichomyceticus NRRL B-16726

Since tei15* and tei16* are able to restore A40926 production in N. gerenzanensis Δdbv3 and Δdbv4, respectively, we tested if their overexpression in N. gerenzanensis ATCC 39727 would affect antibiotic production. To this aim, we created N. gerenzanensis pSET152Atei15*+, pIJ12551tei15*+, and pSET152Atei16*+ recombinant strains (verified by PCR, see Figure S4), but their A40926 production levels in FM2 medium did not exceed that of the wild type (Figure 6a).
We reproduced this approach also for A. teichomyceticus NRRL B-16726, generating A. teichomyceticus pSAD4+ and A. teichomyceticus pSAD3+ recombinants overexpressing the heterologous CSRGs dbv 4 and dbv3, respectively. The obtained recombinants were cultivated in TM1 medium and the teicoplanin production was measured by HPLC. We found that A. teichomyceticus pSAD4+ produced teicoplanin at the levels of the wild type, whereas the teicoplanin production was significantly increased in A. teichomyceticus pSAD3+, reaching ca. 700 mg/L (Figure 6b).

3. Discussion

Previous works reported that StrR-like pathway-specific regulators coded in different GPA BGCs were able to “cross-talk” in vivo between different pathways. For instance, StrR-like pathway-specific regulators Bbr and Ajr (the first from the balhimycin BGC in Am. balhimycina DSM 5908 and the second from ristocetin BGC in Am. japonicum MG417-CF17) could replace each other in governing the reciprocal GPA synthesis [12]. Both Bbr and Ajr share more than an 80% amino acid sequence identity, reflecting the similarity of corresponding BGCs deriving from Amycolatopsis spp. Similarly, the heterologous expression of Dbv4 in Nonomuraea coxensis DSM 45129 was able to increase GPA production levels in the latter [47]. Additional evidence also exists showing that StaQ—a PSR controlling A47934 [54] biosynthesis in Streptomyces toyocaensis NRRL 15009 [55]—was able to upregulate the expression of heterologous GPA BGCs [56].
In the current study, we investigated whether dbv4 and tei15* (sharing an only 53% amino acid sequence identity) would be able to “cross-talk” between rather diverged GPA biosynthetic pathways deriving from species belonging to different families, Micromonosporaceae in the case of teicoplanin and Streptosporangiaceae in the case of A40926. Our results did not show a clear reciprocal behavior of the two StrR-like pathway-specific regulators. In particular, the overexpression of tei15* was able to restore A40926 production in N. gerenzanensis Δdbv4, but to a very low extent, restoring only ca. 1% of A40926 production in comparison to the wild type. Although the activating effect of tei15* was slight, it was rather specific, since the overexpression of tei15* was not able to restore A40926 production in N. gerenzanensis Δdbv3–4. At the same time, dbv4 was not able to restore teicoplanin production in A. teichomyceticus Δtei15* at all.
The obtained results portray that Dbv4 and Tei15* are less functionally related than was previously believed, despite their clear orthology. Although they share the basic architecture of structural domains, as well as a high degree of amino acid sequence similarity, their DNA-binding activity is likely shaped in a way that they could not “cross-talk”. These results corroborate the previous findings of Tei15* DNA-binding activities in vitro [17], shown to be slightly different from the DNA-binding activities of Bbr [13]. In turn, other work demonstrated that Bbr and Dbv4 had rather similar DNA-binding properties [19]. Anyhow, further investigations are needed on their mode of action at the transcriptional level. A high-resolution phylogenetic analysis of all StrR-like proteins deriving from the Actinobacteria phylum might also be useful to better understand their evolutionary and reciprocal relations.
The emerging picture with LuxR-like pathway-specific regulators appeared to be even more puzzling. Dbv3 and Tei16* are not orthologous, sharing only 30% of an amino acid sequence identity and possessing dramatically different regulons [35,36,37]. Surprisingly, our results revealed that dbv3 is able to fully restore the teicoplanin production phenotype in A. teichomyceticus Δtei16*, while N. gerenzanensis Δdbv3 pSET152tei16*+ accumulated only hardly traceable amounts of A40926. We also achieved a significant increase in teicoplanin production when dbv3 was overexpressed in wild type A. teichomyceticus. Peculiarly, the overexpression of tei16* was not able to restore A40926 production in N. gerenzanensis Δdbv3–4, implying that Tei16* specifically activates only the regulon of Dbv3, which is not enough to achieve A40926 production in the absence of dbv4.
To conclude, if tei15* and dbv4 were only partially able (tei15*) or unable (dbv4) to “cross-talk” between the pathways, dbv3 and tei16* appeared more active in influencing heterologous pathways. In particular, dbv3 exerted a significant effect on teicoplanin production in A. teichomyceticus NRRL B-16726. Although the molecular background of these events is yet to be elucidated and merits further investigations, the results achieved in this work contribute to a throughout understanding of GPAs biosynthesis regulation, providing additional clues to comprehend their evolution. In addition, they might offer novel molecular tools for engineering producing actinomycetes and improving their GPA production, rendering the manufacturing processes for these antibiotics more sustainable and reducing their production costs.

4. Materials and Methods

4.1. Bacterial Strains and Growth Conditions

All strains and plasmids used in this work are listed in Table 1. N. gerenzanensis ATCC 39727, A. teichomyceticus NRRL B-16726 (ATCC 31121), and the derived recombinant strains were routinely cultivated on ISP3 agar medium at 30 °C. For A40926 production, N. gerenzanensis and recombinants were fermented in 50 mL of E26 vegetative medium for 72 h, and then 10% (v/v) of the preculture was inoculated in 100 mL of FM2 production medium [11]. A. teichomyceticus and its derived recombinants were fermented in 50 mL of E25 vegetative medium for 72 h, and then 10% (v/v) of the preculture was inoculated in 100 mL of TM1 production medium for teicoplanin production [9]. All the strains were grown on an orbital shaker in baffled Erlenmeyer flasks at 30 °C, 220 rpm. Escherichia coli DH5α was used for routine DNA cloning. E. coli ET12567 pUZ8002+ [48] was used as a donor for intergeneric mattings with Nonomuraea and Actinoplanes. E. coli strains carrying recombinant plasmids were grown in Lysogeny broth (LB) agar at 37 °C supplemented with 100 μg/mL of apramycin–sulfate, 100 μg/mL of spectinomycin, 50 μg/mL of hygromycin B, 50 μg/mL of kanamycin–sulfate, and 25 μg/mL of chloramphenicol when necessary.
Table 1. Bacterial strains and plasmids used in this work.
Table 1. Bacterial strains and plasmids used in this work.
PlasmidsDescriptionSource or Reference
pIJ778Template vector for the amplification of oriT-aadA cassette for PCR-targeted mutagenesis[57]
A40YSuperCos1 derivative, including 22 kb fragment of dbv cluster (dbv1dbv17)[58]
A40dbv3::aadAA40Y derivative with dbv3 replaced by oriT-aadA cassetteThis work
A40dbv4::aadAA40Y derivative with dbv4 replaced with oriT-aadAThis work
A40dbv3–4::aadAA40Y derivative with dbv3 and dbv4 replaced with oriT-aadA cassette derived from plasmid pIJ778This work
pKC1132Suicide plasmid for gene knockouts, AmR[59]
pKCKOD3pKC1132 derivative carrying dbv3 flanking regions surrounding oriT-aadA, AmRThis work
pKCKOD4pKC1132 derivative carrying dbv4 flanking regions surrounding oriT-aadA, AmRThis work
pKCKOD3–4pKC1132 derivative carrying dbv3–4 flanking regions surrounding oriT-aadA, AmRThis work
pSAD3pSET152A derivative carrying dbv3 under the control of aac(3)IVp, AmR[38]
pSAD4pSET152A derivative carrying dbv4 under the control of aac(3)IVp, AmR[38]
pIJ10700Template vector for the amplification of hygR[43]
pSHAD3pSAD3 derivative, HgRThis work
pSHAD4pSAD4 derivative, HgRThis work
pIJ12551ϕC31-actinophage-based integrative vector for gene expression under the control of ermE* promoter, AmR[46]
pIJ12551dbv4pIJ12551 derivative carrying dbv4 under the control of ermE*, AmRThis work
pIJ12551dbv3pIJ12551 derivative carrying dbv3 under the control of ermE*, AmRThis work
pSET152Atei15*pSET152A derivative carrying tei15* under the control of aac(3)IVp, AmR[35]
pSET152Atei16*pSET152A derivative carrying tei16* under the control of aac(3)IVp, AmR[35]
pIJ12551tei15*pIJ12551 derivative carrying tei15* under the control of ermE*This work
Bacterial Strains
N. gerenzanensisWild type, A40926 producerATCC 39727
N. gerenzanensis Δdbv3Wild type derivative with dbv3 replaced by oriT-aadA cassetteThis work
N. gerenzanensis Δdbv4Wild type derivative with dbv4 replaced by oriT-aadA cassetteThis work
N. gerenzanensis Δdbv3–4Wild type derivative with dbv3–4 replaced by oriT-aadA cassetteThis work
N. gerenzanensis Δdbv3 pSAD3+N. gerenzanensis Δdbv3 derivative carrying pSAD3This work
N. gerenzanensis Δdbv4 pSAD4+N. gerenzanensis Δdbv4 derivative carrying pSAD4This work
N. gerenzanensis Δdbv4 pIJ12551dbv4+N. gerenzanensis Δdbv4 derivative carrying pIJ12551dbv4This work
N. gerenzanensis pSET152Atei15*+Wild type derivative carrying pSET152Atei15*This work
N. gerenzanensis pSET152Atei16*+Wild type derivative carrying pSET152Atei16* This work
N. gerenzanensis pIJ12551tei15*+Wild type derivative carrying pIJ12551tei15*This work
N. gerenzanensis Δdbv4 pSET152Atei15*+N. gerenzanensis Δdbv4 derivative carrying pSET152Atei15*This work
N. gerenzanensis Δdbv3 pSET152Atei16*+N. gerenzanensis Δdbv3 derivative carrying pSET152Atei16*This work
N. gerenzanensis Δdbv4 pIJ12551dbv4+N. gerenzanensis Δdbv4 derivative carrying pIJ12551dbv4This work
N. gerenzanensis Δdbv3–4 pIJ12551tei15*+N. gerenzanensis Δdbv3–4 derivative carrying pIJ12551tei15*This work
N. gerenzanensis Δdbv3–4 pSET152Atei16*+N. gerenzanensis Δdbv3–4 derivative carrying pSET152Atei16*This work
A. teichomyceticusWild type, teicoplanin producerNRRL-B16726
A. teichomyceticus pSAD3+Wild type derivative carrying pSAD3This work
A. teichomyceticus pSAD4+Wild type derivative carrying pSAD4This work
A. teichomyceticus Δtei15*Wild type derivative with tei15* gene replaced by oriT-aac(3)IV cassette[35]
A. teichomyceticus Δtei16*Wild type derivative with tei16* gene replaced with oriT-aac(3)IV cassette[35]
A. teichomyceticus Δtei15* pSHAD4+A. teichomyceticus Δtei15* derivative carrying pSHAD4This work
A. teichomyceticus Δtei16* pSHAD3+A. teichomyceticus Δtei16* derivative carrying pSHAD3This work
E. coli DH5αGeneral cloning hostMBI
Fermentas, US
E. coli ET12567 pUZ8002+(dam-13::Tn9 dcm-6), pUZ8002+oriT), used for conjugative transfer of DNA[60]
E. coli BW25113 pIJ790+λ-Red-mediated recombineering host[43]
B. subtilis HB0933CU1065 liaR::kan[61]
B. subtilis HB0950CU1065 SPβ2Δ2::Tn917::Φ(PliaI-74-cat-lacZ)[50]

4.2. Extraction of Genomic DNA

Extraction of genomic DNA from N. gerenzanensis and A. teichomyceticus strains was conducted following the Kirby procedure [48]. Prior to DNA isolation, N. gerenzanensis and A. teichomyceticus strains were cultivated in 250 mL baffled Erlenmeyer flasks containing 50 mL of E25 or E26 on an orbital shaker at 220 rpm and 30 °C for 96 h.

4.3. Inactivation of dbv3 and dbv4 in N. gerenzanensis

First of all, dbv3, dbv4, and both dbv3 and dbv4 genes together were replaced on A40Y cosmid (containing the majority of dbv BGC genes) [58] with a spectinomycin/streptomycin resistance cassette (oriT-aadA, derived from pIJ778 [57]) using the λ-Red-mediated recombineering approach [43]. The obtained A40Y derivatives were named A40dbv4::aadA, A40dbv3::aadA, and A40dbv3–4::aadA, respectively. The primer pairs dbv3_P1/dbv3_P2, dbv4_P1/dbv4_P2, and dbv3_P1/dbv4_P2 were used for the replacement and are listed in Table 2. Then, using generated recombinant cosmids as templates, we amplified aadA–oriT with ca. 2 Kbp flanking regions of dbv3, dbv4, and dbv3–4 (which were previously replaced by oriT-aadA cassette) and cloned the amplicons into pKC1132 [59] suicide vector (Table 1). The latter carries the apramycin resistance gene aac(3)IV and neither phage integration systems genes nor replicon regions, depending on the homologous recombination for the integration into the chromosome of N. gerenzanensis. Amplicons were obtained with dbv3KO_F/R, dbv4KO_F/R, and dbv3KO_F/dbv4KO_R using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, United States), digested with HindIII/SpeI restriction endonucleases and cloned into pKC1132 via HindIII/XbaI recognition sites. In this way, pKCKOD3, pKCKOD4, and pKCKOD3–4 knockout suicide plasmids were generated (Table 1) and introduced into N. gerenzanensis ATCC 39727 via an intergeneric conjugation with E. coli ET12567 pUZ8002+. The obtained transconjugants were spectinomycin (SpR) and apramycin resistant (AmR), indicating that pKCKOD3, pKCKOD4, or pKCKOD3–4 successfully integrated into the chromosome via a single crossing over event. pKCKOD3+, pKCKOD4+, and pKCKOD3–4+ were then cultivated several times on ISP3 solid medium without any selective antibiotics. After the last cultivation passage, each strain was reseeded on a fresh ISP3 plate with no antibiotics using an exhaustive streak to obtain single colonies. Finally, these single colonies were analyzed by replica-plating to identify AmS, SpR ones, where the second crossing-over event took place, replacing dbv3, dbv4, or dbv3–4 genes with aadA-oriT. The obtained mutants were named Δdbv3, Δdbv4, and Δdbv3–4 and were verified by PCR, using the 3/4KOVER_F/R primer pair (Table 2). A detailed scheme displaying all steps of our knockout approach is provided in ESM Figure S1.

4.4. Generation of the Recombinant Plasmids

First, tei15*, dbv4, and dbv3 pathway-specific regulatory genes were cloned into the pIJ12551 plasmid [46] under the control of the ermE* promotor. To achieve this, coding sequences of tei15*, dbv4, and dbv3 were amplified from the genomic DNA of A. teichomyceticus and N. gerenzanensis, respectively, and cloned into pIJ12551 plasmid via NdeI/NotI recognition sites. Amplicons were generated using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, United States), and the oligonucleotide primers are listed in Table 2. Generated plasmids were named pIJ12551tei15*, pIJ12551dbv4, and pIJ12551dbv3 (Table 1), verified by restriction mapping and sequencing.
We also generated pSAD3 and pSAD4 [21] derivatives carrying the hygromycin resistance gene (hygR, originating from pIJ10700 [43]) instead of aac(3)IV, obtaining pSHAD3 and pSHAD4 (Table 1). This was achieved by digesting the pSAD3 and pSAD4 with XhoI restriction endonuclease, followed by ends blunting using Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA, United States). So-prepared backbones were ligated with hygR amplicon, obtained from pIJ10700 using Q5 High-Fidelity DNA Polymerase and hygR_R/F primer pair. The obtained plasmids were verified by restriction mapping and sequencing.

4.5. Conjugative Transfer of Plasmids into N. gerenzanensis and A. teichomyceticus

The conjugative transfer of plasmids (see Table 1 for the complete list, including those already available from other works and those generated in this work) into N. gerenzanensis and A. teichomyceticus was performed essentially as described previously [38,62]. All recombinant plasmids were transferred individually into the non-methylating E. coli ET12567 pUZ8002+, and the resulting derivatives were used as donor strains for intergeneric conjugation. To verify the integration of plasmids, target genes or aac(3)IV were amplified by PCR from the genomic DNA isolated from the recombinant strains.
To prepare the fresh vegetative mycelium of N. gerenzanensis prior to a conjugal transfer, one vial of WCB was inoculated into 50 mL of VSP medium (250 mL of Erlenmeyer flask with 10 glass beads of ø5 mm) and incubated for 48 h on the orbital shaker at 30 °C, 220 rpm. The mycelium was collected by centrifugation (10 min, 3220× g), washed twice with sterile 20% v/v glycerol, resuspended in the same solution to a final volume of 20 mL, and stored at −80 °C. In total, 1 mL of mycelial suspension was mixed with approximately 109 of donor E. coli cells, and the mixtures were plated on well dried VM0.1 agar plates supplemented with 20 mM of MgCl2. After 12–16 h of incubation at 30 °C, each plate was overlaid with 1 mL of sterile deionized water containing 1.25 mg of apramycin–sulfate and 750 μg of nalidixic acid sodium salt. Transconjugants were selected as they are resistant to 50 μg/mL of apramycin–sulfate.
Spore suspensions of A. teichomyceticus were prepared from lawns grown on ISP3 agar for 7 days at 30 °C. Sporangia from one plate were collected in deionized water and filtered through one layer of Miracloth (Merck KGaA, Darmstadt, Germany) to remove vegetative mycelial fragments. Then, sporangia were incubated in an orbital shaker at 30 °C until spores were released from sporangia. Then, spores were centrifuged (3220× g for 15 min) and resuspended in 1 mL of 15% v/v glycerol, and stored at −80 °C. For conjugation, approx. 106 spores were mixed with 107 E. coli donor cells and plated on SFM agar plates supplemented with 20 mM of MgCl2. The overlay for the selection of transconjugants was performed as described previously for N. gerenzanensis.

4.6. Microbial Growth Inhibition Assays

To prepare the plates for bioassays, Bacillus subtilis HB0933 [61] and HB0950 [50] were grown in LB liquid medium at 37 °C in a shaker (150 rpm) for 15–16 h. Then, 10% (v/v) of the overnight culture was inoculated in fresh LB medium and left to grow under the same incubation conditions up to 0.6 OD600nm. Subsequently, 100 µL of so-obtained B. subtilis culture were inoculated into 30 mL of Muller Hinton Agar (MHA). In the case of B. subtilis HB0950, an additional 50 µg/mL of 5-bromo-4-chloro-3-indolyl-β-d-galactoside (X-Gal) were added to the agar to observe the GPA-induced chromogenic conversion. Then, 6 mm paper disks socked with antibiotic extracts or agar plugs were placed on the surface of these plates. The plates were incubated overnight at 37 °C, and growth inhibition halos and X-Gal chromogenic conversion were monitored.

4.7. HPLC Analysis of Teicoplanin and A40926

GPAs were extracted by mixing 1 volume of broth with 1 volume of borate buffer [100 mM H3BO3 (Sigma-Aldrich, St. Louis, MO, USA), 100 mM NaOH (Sigma-Aldrich), pH 12]. The extraction of teicoplanin was performed by shaking samples on a rotary shaker at 200 rpm and 37 °C for 45 min, then the samples were centrifuged (16,000× g for 15 min) to obtain debris-free supernatants according to the protocol reported in [9]. Extracts containing A40926 were centrifuged (16,000× g for 15 min), and the supernatants were incubated at 50 °C for 1 h, following the procedure reported in [58].
When lyophilization was needed to concentrate the samples containing low amounts of GPAs, the supernatants were lyophilized in a VirTis Sentry vacuum chamber for 24 h and subsequently resuspended in a decreased volume of distilled water in order to concentrate the sample ten times.
HPLC was performed using a VWR Hitachi diode array L-2455 HPLC system with detection at 254 nm for A40926 and 236 nm for teicoplanin. Samples were estimated by injecting 50 μL of sample onto a 5 μm particle size Ultrasphere ODS (Beckman, Brea, California, Stati Uniti) HPLC column (4.6 by 250 mm) or Hypersil GOLD (Thermo Fisher Scientific, Waltham, MA, USA) HPLC column (4.6 by 250 mm). A40926 and teicoplanin samples were eluted at a flow rate of 1 mL/min with a 30 min linear gradient from 15 to 64% of phase B. Phase A was 32 mM HCOONH4 (pH 7)—CH3CN [90:10 (v/v)], and phase B was 32 mM HCOONH4 (pH 7)—CH3CN [30:70 (v/v)]. A volume of 50 μL of a pure sample of 150 μg/mL of A40926 (Sigma-Aldrich, St. Louis, MO, United States) and 100 μg/mL of teicoplanin (Sigma-Aldrich, St. Louis, MO, USA) were used as the standards.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/antibiotics12040641/s1, Figure S1: A scheme depicting the generation of dbv3, dbv4, and dbv3–4 knockout mutants of N. gerenzanensis; Figure S2: Chromatograms of the commercial standards of A40926 and teicoplanin; Figure S3: Photographs demonstrating PCR verification of genotypes of the complemented N. gerenzanensis mutants generated throughout this study; Figure S4: Photographs demonstrating PCR verification of genotypes of cross-complemented mutants of N. gerenzanensis and A. teichomyceticus generated throughout this study; Figure S5: A40926 production in N. gerenzanensis Δdbv4 pSET152Atei15*+ is not restored as seen from B. subtilis HB0933 growth inhibition assay (MH medium); Figure S6: N. gerenzanensis Δdbv3–4 is unable to produce A40926 as demonstrated by B. subtilis HB0933 growth inhibition assay (MH medium) and HPLC analysis; Figure S7: Photographs demonstrating PCR verification of genotypes of N. gerenzanensis and A. teichomyceticus strains overexpressing heterologous CSRGs generated throughout this study.

Author Contributions

Conceptualization, F.M., O.Y. and E.B.; methodology, O.Y. and E.B.; investigation, A.A.-V. and E.B.; writing—original draft preparation, A.A.-V. and O.Y.; writing—review and editing, F.M., O.Y. and E.B.; supervision, O.Y. and F.M.; project administration, E.B.; funding acquisition, F.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the public grant “Fondo di Ateneo per la Ricerca” 2021 and 2022 to F.M. and by Federation of European Microbiological Societies (FEMS) Research Fellowship 2015 to E.B.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data, strains, and plasmids are available from the corresponding author upon reasonable request.

Acknowledgments

A.A.-V. was a Ph.D. student of the “Life Science and Biotechnology” course at University of Insubria from 2018 to 2022, and E.B. prepared some of the plasmids used in this work in the laboratories of Mervyn Bibb at John Innes Centre, Norwich UK, thanks to Federation of European Microbiological Societies (FEMS) Research Fellowship in 2015. We thank Mervyn Bibb from John Innes Centre for his support to this work and Thorsten Mascher from Technische Universität Dresden for kindly providing us with B. subtilis HB0933 and HB0950.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. van der Meij, A.; Worsley, S.F.; Hutchings, M.I.; van Wezel, G.P. Chemical ecology of antibiotic production by actinomycetes. FEMS Microbiol. Rev. 2017, 41, 392–416. [Google Scholar] [CrossRef] [Scilit]
  2. van Bambeke, F. Lipoglycopeptide antibacterial agents in Gram-positive infections: A comparative review. Drugs 2015, 75, 2073–2095. [Google Scholar] [CrossRef] [Scilit]
  3. Hansen, M.H.; Stegmann, E.; Cryle, M.J. Beyond vancomycin: Recent advances in the modification, reengineering, production and discovery of improved glycopeptide antibiotics to tackle multidrug-resistant bacteria. Curr. Opin. Biotechnol. 2022, 77, 102767. [Google Scholar] [CrossRef] [Scilit]
  4. Nicolaou, K.C.; Boddy, C.N.C.; Bräse, S.; Winssinger, N. Chemistry, biology, and medicine of the glycopeptide antibiotics. Angew. Chem.-Int. Ed. 1999, 38, 2096–2152. [Google Scholar] [CrossRef] [Scilit]
  5. Parenti, F.; Cavalleri, B. Proposal to name the vancomycin-ristocetin like glycopeptides as dalbaheptides. J. Antibiot. 1989, 42, 1882–1883. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Butler, M.S.; Hansford, K.A.; Blaskovich, M.A.T.; Halai, R.; Cooper, M.A. Glycopeptide antibiotics: Back to the future. J. Antibiot. 2014, 67, 631–644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Xu, L.; Huang, H.; Wei, W.; Zhong, Y.; Tang, B.; Yuan, H.; Zhu, L.; Huang, W.; Ge, M.; Yang, S.; et al. Complete genome sequence and comparative genomic analyses of the vancomycin-producing Amycolatopsis orientalis. BMC Genom. 2014, 15, 363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Borgh, A.; Coronelli, C.; Faniuolo, L.; Allievi, G.; Pallanza, R.; Gallo, G.G. Teichomycins, new antibiotics from Actinoplanes teichomyceticus nov. sp.: IV. Separation and characterization of the components of teichomycin (teicoplanin). J. Antibiot. 1984, 37, 615–620. [Google Scholar] [CrossRef] [Scilit]
  9. Taurino, C.; Frattini, L.; Marcone, G.L.; Gastaldo, L.; Marinelli, F. Actinoplanes teichomyceticus ATCC 31121 as a cell factory for producing teicoplanin. Microb. Cell Fact. 2011, 10, 82. [Google Scholar] [CrossRef] [Scilit]
  10. Gunnarsson, N.; Bruheim, P.; Nielsen, J. Production of the glycopeptide antibiotic A40926 by Nonomuraea sp. ATCC 39727: Influence of medium composition in batch fermentation. J. Ind. Microbiol. Biotechnol. 2003, 30, 150–156. [Google Scholar] [CrossRef] [Scilit]
  11. Marcone, G.L.; Binda, E.; Carrano, L.; Bibb, M.; Marinelli, F. Relationship between glycopeptide production and resistance in the actinomycete Nonomuraea sp. ATCC 39727. Antimicrob. Agents Chemother. 2014, 58, 5191–5201. [Google Scholar] [CrossRef] [Scilit]
  12. Spohn, M.; Kirchner, N.; Kulik, A.; Jochim, A.; Wolf, F.; Muenzer, P.; Borst, O.; Gross, H.; Wohlleben, W.; Stegmann, E. Overproduction of ristomycin a by activation of a silent gene cluster in Amycolatopsis japonicum MG417-CF17. Antimicrob. Agents Chemother. 2014, 58, 6185–6196. [Google Scholar] [CrossRef] [Scilit]
  13. Liu, K.; Hu, X.R.; Zhao, L.X.; Wang, Y.; Deng, Z.; Taoa, M. Enhancing ristomycin a production by overexpression of ParB-like StrR family regulators controlling the biosynthesis genes. Appl. Environ. Microbiol. 2021, 87, e0106621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Padma, P.N.; Rao, A.B.; Yadav, J.S.; Reddy, G. Optimization of fermentation conditions for production of glycopeptide antibiotic vancomycin by Amycolatopsis orientalis. Appl. Biochem. Biotechnol. 2002, 102–103, 395–405. [Google Scholar] [CrossRef] [Scilit]
  15. Levine, D.P. Vancomycin: A history. Clin. Infect. Dis. 2006, 42, 5–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Babul, N.; Pasko, M. Teicoplanin: A new glycopeptide antibiotic complex. Drug Intell. Clin. Pharm. 1988, 22, 218–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Glupczynski, Y.; Lagast, H.; Van der Auwera, P.; Thys, J.P.; Crokaert, F.; Yourassowsky, E.; Meunier-Carpentier, F.; Klastersky, J.; Kains, J.P.; Serruys-Schoutens, E. Clinical evaluation of teicoplanin for therapy of severe infections caused by Gram-positive bacteria. Antimicrob. Agents Chemother. 1986, 29, 52–57. [Google Scholar] [CrossRef] [Scilit]
  18. Klinker, K.P.; Borgert, S.J. Beyond vancomycin: The tail of the lipoglycopeptides. Clin. Ther. 2015, 37, 2619–2636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Steiert, M.; Schmitz, F.-J. Dalbavancin (Biosearch Italia/Versicor). Curr. Opin. Investig. Drugs 2002, 3, 229–233. [Google Scholar]
  20. Goldstein, B.P.; Selva, E.; Gastaldo, L.; Berti, M.; Pallanza, R.; Ripamonti, F.; Ferrari, P.; Denaro, M.; Arioli, V.; Cassani, G. A40926, a new glycopeptide antibiotic with anti-Neisseria activity. Antimicrob. Agents Chemother. 1987, 31, 1961–1966. [Google Scholar] [CrossRef] [Scilit]
  21. Yim, G.; Thaker, M.N.; Koteva, K.; Wright, G. Glycopeptide antibiotic biosynthesis. J. Antibiot. 2014, 67, 31–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Yim, G.; Wang, W.; Thaker, M.N.; Tan, S.; Wright, G.D. How to make a glycopeptide: A synthetic biology approach to expand antibiotic chemical diversity. ACS Infect. Dis. 2016, 2, 642–650. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. van Groesen, E.; Innocenti, P.; Martin, N.I. Recent advances in the development of semisynthetic glycopeptide antibiotics: 2014–2022. ACS Infect. Dis. 2022, 8, 1381–1407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Acharya, Y.; Bhattacharyya, S.; Dhanda, G.; Haldar, J. Emerging roles of glycopeptide antibiotics: Moving beyond Gram-positive bacteria. ACS Infect. Dis. 2022, 8, 1–28. [Google Scholar] [CrossRef] [Scilit]
  25. Tian, L.; Shi, S.; Zhang, X.; Han, F.; Dong, H. Newest perspectives of glycopeptide antibiotics: Biosynthetic cascades, novel derivatives, and new appealing antimicrobial applications. World J. Microbiol. Biotechnol. 2023, 39, 67. [Google Scholar] [CrossRef] [Scilit]
  26. van der Heul, H.U.; Bilyk, B.L.; McDowall, K.J.; Seipke, R.F.; Van Wezel, G.P. Regulation of antibiotic production in Actinobacteria: New perspectives from the post-genomic era. Nat. Prod. Rep. 2018, 35, 575–604. [Google Scholar] [CrossRef] [Scilit]
  27. Ostash, B.; Yushchuk, O.; Tistechok, S.; Mutenko, H.; Horbal, L.; Muryn, A.; Dacyuk, Y.; Kalinowski, J.; Luzhetskyy, A.; Fedorenko, V. The adpA-like regulatory gene from Actinoplanes teichomyceticus: In silico analysis and heterologous expression. World J. Microbiol. Biotechnol. 2015, 31, 1297–1301. [Google Scholar] [CrossRef] [Scilit]
  28. Alduina, R.; Sosio, M.; Donadio, S. Complex regulatory networks governing production of the glycopeptide A40926. Antibiotics 2018, 7, 30. [Google Scholar] [CrossRef] [Scilit]
  29. Retzlaff, L.; Distler, J. The regulator of streptomycin gene expression, StrR, of Streptomyces griseus is a DNA binding activator protein with multiple recognition sites. Mol. Microbiol. 1995, 18, 151–162. [Google Scholar] [CrossRef] [Scilit]
  30. Yushchuk, O.; Horbal, L.; Ostash, B.; Marinelli, F.; Wohlleben, W.; Stegmann, E.; Fedorenko, V. Regulation of teicoplanin biosynthesis: Refining the roles of tei cluster-situated regulatory genes. Appl. Microbiol. Biotechnol. 2019, 103, 4089–4102. [Google Scholar] [CrossRef] [Scilit]
  31. Santos, C.L.; Correia-Neves, M.; Moradas-Ferreira, P.; Mendes, M.V. A Walk into the LuxR regulators of Actinobacteria: Phylogenomic distribution and functional diversity. PLoS ONE 2012, 7, e46758. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. De Schrijver, A.; De Mot, R. A subfamily of MalT-related ATP-dependent regulators in the LuxR family. Microbiology 1999, 145, 1287–1288. [Google Scholar] [CrossRef] [Scilit]
  33. Shawky, R.M.; Puk, O.; Wietzorrek, A.; Pelzer, S.; Takano, E.; Wohlleben, W.; Stegmann, E. The border sequence of the balhimycin biosynthesis gene cluster from Amycolatopsis balhimycina contains bbr, encoding a StrR-like pathway-specific regulator. J. Mol. Microbiol. Biotechnol. 2007, 13, 76–88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Li, X.; Zhang, C.; Zhao, Y.; Lei, X.; Jiang, Z.; Zhang, X.; Zheng, Z.; Si, S.; Wang, L.; Hong, B. Comparative genomics and transcriptomics analyses provide insights into the high yield and regulatory mechanism of norvancomycin biosynthesis in Amycolatopsis orientalis NCPC 2-48. Microb. Cell Fact. 2021, 20, 28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Horbal, L.; Kobylyanskyy, A.; Truman, A.W.; Zaburranyi, N.; Ostash, B.; Luzhetskyy, A.; Marinelli, F.; Fedorenko, V. The pathway-specific regulatory genes, tei15* and tei16*, are the master switches of teicoplanin production in Actinoplanes teichomyceticus. Appl. Microbiol. Biotechnol. 2014, 98, 9295–9309. [Google Scholar] [CrossRef] [Scilit]
  36. Alduina, R.; Lo Piccolo, L.; D’Alia, D.; Ferraro, C.; Gunnarsson, N.; Donadio, S.; Puglia, A.M. Phosphate-controlled regulator for the biosynthesis of the dalbavancin precursor A40926. J. Bacteriol. 2007, 189, 8120–8129. [Google Scholar] [CrossRef] [Scilit]
  37. Lo Grasso, L.; Maffioli, S.; Sosio, M.; Bib, M.; Puglia, A.M.; Alduina, R. Two master switch regulators trigger A40926 biosynthesis in Nonomuraea sp. strain ATCC 39727. J. Bacteriol. 2015, 197, 2536–2544. [Google Scholar] [CrossRef] [Scilit]
  38. Yushchuk, O.; Andreo-Vidal, A.; Marcone, G.L.; Bibb, M.; Marinelli, F.; Binda, E. New molecular tools for regulation and improvement of A40926 glycopeptide antibiotic production in Nonomuraea gerenzanensis ATCC 39727. Front. Microbiol. 2020, 11, 8. [Google Scholar] [CrossRef] [Scilit]
  39. Pelzer, S.; Süßmuth, R.; Heckmann, D.; Recktenwald, J.; Huber, P.; Jung, G.; Wohlleben, W. Identification and analysis of the balhimycin biosynthetic gene cluster and its use for manipulating glycopeptide biosynthesis in Amycolatopsis mediterranei DSM5908. Antimicrob. Agents Chemother. 1999, 43, 1565–1573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Li, T.L.; Huang, F.; Haydock, S.F.; Mironenko, T.; Leadlay, P.F.; Spencer, J.B. Biosynthetic gene cluster of the glycopeptide antibiotic teicoplanin: Characterization of two glycosyltransferases and the key acyltransferase. Chem. Biol. 2004, 11, 107–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Sosio, M.; Kloosterman, H.; Bianchi, A.; de Vreugd, P.; Dijkhuizen, L.; Donadio, S. Organization of the teicoplanin gene cluster in Actinoplanes teichomyceticus. Microbiology 2004, 150, 95–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Sosio, M.; Stinchi, S.; Beltrametti, F.; Lazzarini, A.; Donadio, S. The gene cluster for the biosynthesis of the glycopeptide antibiotic A40926 by Nonomuraea species. Chem. Biol. 2003, 10, 541–549. [Google Scholar] [CrossRef] [Scilit]
  43. Gust, B.; Chandra, G.; Jakimowicz, D.; Yuqing, T.; Bruton, C.J.; Chater, K.F. λ Red-mediated genetic manipulation of antibiotic-producing Streptomyces. Adv. Appl. Microbiol. 2004, 54, 107–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Jovetic, S.; Feroggio, M.; Marinelli, F.; Lancini, G. Factors influencing cell fatty acid composition and A40926 antibiotic complex production in Nonomuraea sp. ATCC 39727. J. Ind. Microbiol. Biotechnol. 2008, 35, 1131–1138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Horbal, L.; Kobylyanskyy, A.; Yushchuk, O.; Zaburannyi, N.; Luzhetskyy, A.; Ostash, B.; Marinelli, F.; Fedorenko, V. Evaluation of heterologous promoters for genetic analysis of Actinoplanes teichomyceticus—Producer of teicoplanin, drug of last defense. J. Biotechnol. 2013, 168, 367–372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Sherwood, E.J.; Hesketh, A.R.; Bibb, M.J. Cloning and analysis of the planosporicin lantibiotic biosynthetic gene cluster of Planomonospora alba. J. Bacteriol. 2013, 195, 2309–2321. [Google Scholar] [CrossRef] [Scilit]
  47. Yushchuk, O.; Vior, N.M.; Andreo-Vidal, A.; Berini, F.; Rückert, C.; Busche, T.; Binda, E.; Kalinowski, J.; Truman, A.W.; Marinelli, F. Genomic-led discovery of a novel glycopeptide antibiotic by Nonomuraea coxensis DSM 45129. ACS Chem. Biol. 2021, 16, 915–928. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Kieser, T.; Bibb, M.J.; Buttner, M.J.; Chater, K.F.; Hopwood, D.A. Practical Streptomyces Genetics; John Innes Foundation: Norwich, UK, 2000. [Google Scholar]
  49. Bibb, M.J.; Janssen, G.R.; Ward, J.M. Cloning and analysis of the promoter region of the erythromycin resistance gene (ermE) of Streptomyces erythraeus. Gene 1985, 38, 215–226. [Google Scholar] [CrossRef] [Scilit]
  50. Mascher, T.; Zimmer, S.L.; Smith, T.-A.; Helmann, J.D. Antibiotic-inducible promoter regulated by the cell envelope stress-sensing two-component system LiaRS of Bacillus subtilis. Antimicrob. Agents Chemother. 2004, 48, 2888–2896. [Google Scholar] [CrossRef] [Scilit]
  51. Shirling, E.B.; Gottlieb, D. Methods for characterization of Streptomyces species. Int. J. Syst. Evol. Microbiol. 1966, 16, 313–340. [Google Scholar] [CrossRef] [Scilit]
  52. Gonsior, M.; Mühlenweg, A.; Tietzmann, M.; Rausch, S.; Poch, A.; Süssmuth, R.D. Biosynthesis of the peptide antibiotic feglymycin by a linear nonribosomal peptide synthetase mechanism. ChemBioChem 2015, 16, 2610–2614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Nazari, B.; Forneris, C.C.; Gibson, M.I.; Moon, K.; Schramma, K.R.; Seyedsayamdost, M.R. Nonomuraea sp. ATCC 55076 harbours the largest actinomycete chromosome to date and the kistamicin biosynthetic gene cluster. Medchemcomm 2017, 8, 780–788. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Boeck, L.D.; Mertz, F.P. A47934, a novel glycopeptide-aglycone antibiotic produced by a strain of Streptomyces toyocaensis: Taxonomy and fermentation studies. J. Antibiot. 1986, 39, 1533–1540. [Google Scholar] [CrossRef] [Scilit]
  55. Pootoolal, J.; Thomas, M.G.; Marshall, C.G.; Neu, J.M.; Hubbard, B.K.; Walsh, C.T.; Wright, G.D. Assembling the glycopeptide antibiotic scaffold: The biosynthesis of A47934 from Streptomyces toyocaensis NRRL15009. Proc. Natl. Acad. Sci. USA 2002, 99, 8962–8967. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Xu, M.; Wang, W.; Waglechner, N.; Culp, E.J.; Guitor, A.K.; Wright, G.D. GPAHex—A synthetic biology platform for type IV–V glycopeptide antibiotic production and discovery. Nat. Commun. 2020, 11, 5232. [Google Scholar] [CrossRef] [Scilit]
  57. Gust, B.; Kieser, T.; Chater, K.F. PCR targeting system in Streptomyces coelicolor A3(2). John Innes Cent. 2000, 3, 1–39. [Google Scholar]
  58. Marcone, G.L.; Beltrametti, F.; Binda, E.; Carrano, L.; Foulston, L.; Hesketh, A.; Bibb, M.; Marinelli, F. Novel mechanism of glycopeptide resistance in the A40926 producer Nonomuraea sp. ATCC 39727. Antimicrob. Agents Chemother. 2010, 54, 2465–2472. [Google Scholar] [CrossRef] [Scilit]
  59. Bierman, M.; Logan, R.; O’Brien, K.; Seno, E.T.; Nagaraja Rao, R.; Schoner, B.E.; Rao, R.N.; Schoner, B.E. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 1992, 116, 43–49. [Google Scholar] [CrossRef] [Scilit]
  60. Paranthaman, S.; Dharmalingam, K. Intergeneric conjugation in Streptomyces peucetius and Streptomyces sp. strain C5: Chromosomal integration and expression of recombinant plasmids carrying the chiC gene. Appl. Environ. Microbiol. 2003, 69, 84–91. [Google Scholar] [CrossRef] [Scilit]
  61. Mascher, T.; Margulis, N.G.; Wang, T.; Ye, R.W.; Helmann, J.D. Cell wall stress responses in Bacillus subtilis: The regulatory network of the bacitracin stimulon. Mol. Microbiol. 2003, 50, 1591–1604. [Google Scholar] [CrossRef] [Scilit]
  62. Ha, H.S.; Hwang, Y.I.; Choi, S.U. Application of conjugation using φC31 att/int system for Actinoplanes teichomyceticus, a producer of teicoplanin. Biotechnol. Lett. 2008, 30, 1233–1238. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. A40926 production is abolished in N. gerenzanensis Δdbv3 and Δdbv4 mutants. (a) B. subtilis HB0933 growth inhibition assay (MHA medium), demonstrating that N. gerenzanensis Δdbv3 and Δdbv4 knockout strains did not show any antimicrobial activity. To prepare the assay, culture broth samples were collected after 144 h cultivation of N. gerenzanensis ATCC 39727, Δdbv3, and Δdbv4 strains in FM2 liquid medium. A40926 was extracted as reported in Materials and Methods. In total, 50 μL of the extracts were loaded onto 6 mm paper disks. (b) HPLC analysis of the same extracts confirmed that N. gerenzanensis Δdbv3 and Δdbv4 did not produce any A40926 in FM2 medium; N. gerenzanensis ATCC 39727 chromatographic profile is shown in black, N. gerenzanensis Δdbv3 in green, while N. gerenzanensis Δdbv4 in blue. Two main A40926 peaks could be distinguished in the N. gerenzanensis ATCC 39727 chromatographic profile: B0 and B1 are indicated, respectively, by black arrows; they differ for the fatty acid moiety (iso-C12:0 in B0, and n-C12:0 in B1 [44]). These two peaks are absent in the chromatograms from Δdbv3 and Δdbv4 mutants (for the chromatogram of commercial A40926 standard, please refer to Figure S2a).
Figure 1. A40926 production is abolished in N. gerenzanensis Δdbv3 and Δdbv4 mutants. (a) B. subtilis HB0933 growth inhibition assay (MHA medium), demonstrating that N. gerenzanensis Δdbv3 and Δdbv4 knockout strains did not show any antimicrobial activity. To prepare the assay, culture broth samples were collected after 144 h cultivation of N. gerenzanensis ATCC 39727, Δdbv3, and Δdbv4 strains in FM2 liquid medium. A40926 was extracted as reported in Materials and Methods. In total, 50 μL of the extracts were loaded onto 6 mm paper disks. (b) HPLC analysis of the same extracts confirmed that N. gerenzanensis Δdbv3 and Δdbv4 did not produce any A40926 in FM2 medium; N. gerenzanensis ATCC 39727 chromatographic profile is shown in black, N. gerenzanensis Δdbv3 in green, while N. gerenzanensis Δdbv4 in blue. Two main A40926 peaks could be distinguished in the N. gerenzanensis ATCC 39727 chromatographic profile: B0 and B1 are indicated, respectively, by black arrows; they differ for the fatty acid moiety (iso-C12:0 in B0, and n-C12:0 in B1 [44]). These two peaks are absent in the chromatograms from Δdbv3 and Δdbv4 mutants (for the chromatogram of commercial A40926 standard, please refer to Figure S2a).
Antibiotics 12 00641 g001
Figure 2. A40926 production is restored in N. gerenzanensis Δdbv3 and Δdbv4 after complementation with native regulatory genes expressed from different platforms. (a) B. subtilis HB0933 growth inhibition assays in MHA medium; complemented strains demonstrated restoration of antimicrobial activity. Culture samples were collected after 144 h cultivation in FM2 liquid medium (in the case of Δdbv3 pIJ12551dbv3+ also in E26) and A40926 was extracted as reported in Materials and Methods. In total, 50 μL of extracts were loaded on 6 mm paper disk. (b) Production of A40926 in the complemented strains in comparison to the wild type when cultivated for 144 h in FM2 liquid medium (in case of Δdbv3 pIJ12551dbv3+ also in E26). A40926 was extracted and measured by the HPLC as described in Materials and Methods, representing the cumulative concentration of B0 and B1 congeners. Data represent mean values of three independent experiments ± 2SD.
Figure 2. A40926 production is restored in N. gerenzanensis Δdbv3 and Δdbv4 after complementation with native regulatory genes expressed from different platforms. (a) B. subtilis HB0933 growth inhibition assays in MHA medium; complemented strains demonstrated restoration of antimicrobial activity. Culture samples were collected after 144 h cultivation in FM2 liquid medium (in the case of Δdbv3 pIJ12551dbv3+ also in E26) and A40926 was extracted as reported in Materials and Methods. In total, 50 μL of extracts were loaded on 6 mm paper disk. (b) Production of A40926 in the complemented strains in comparison to the wild type when cultivated for 144 h in FM2 liquid medium (in case of Δdbv3 pIJ12551dbv3+ also in E26). A40926 was extracted and measured by the HPLC as described in Materials and Methods, representing the cumulative concentration of B0 and B1 congeners. Data represent mean values of three independent experiments ± 2SD.
Antibiotics 12 00641 g002
Figure 3. GPA production phenotypes of N. gerenzanensis and A. teichomyceticus CSRGs mutants complemented with heterologous CSRGs tested by B. subtilis HB0933 (a) and HB0950 (b) growth inhibition assays. N. gerenzanensis Δdbv4 pIJ12551tei15*+, Δdbv3 pSET152Atei16*+, and A. teichomyceticus Δtei16* pSHAD3+ inhibited the growth of B. subtilis HB0933 and induced X-Gal chromogenic conversion in B. subtilis HB0950, indicating restoration of GPA biosynthesis. Samples were collected after 144 h cultivation in FM2 medium in the case of wild type N. gerenzanensis and recombinant strains, and after 96 h cultivation in TM1 in the case of A. teichomyceticus and its recombinant strains, with the exception of A. teichomyceticus Δtei16* pSHAD3+ which was grown 96 h in E25 added with 1 g/L l-valine; GPAs were extracted as reported in Materials and Methods. In total, 50 μL of extracts were loaded onto a 6 mm paper disks.
Figure 3. GPA production phenotypes of N. gerenzanensis and A. teichomyceticus CSRGs mutants complemented with heterologous CSRGs tested by B. subtilis HB0933 (a) and HB0950 (b) growth inhibition assays. N. gerenzanensis Δdbv4 pIJ12551tei15*+, Δdbv3 pSET152Atei16*+, and A. teichomyceticus Δtei16* pSHAD3+ inhibited the growth of B. subtilis HB0933 and induced X-Gal chromogenic conversion in B. subtilis HB0950, indicating restoration of GPA biosynthesis. Samples were collected after 144 h cultivation in FM2 medium in the case of wild type N. gerenzanensis and recombinant strains, and after 96 h cultivation in TM1 in the case of A. teichomyceticus and its recombinant strains, with the exception of A. teichomyceticus Δtei16* pSHAD3+ which was grown 96 h in E25 added with 1 g/L l-valine; GPAs were extracted as reported in Materials and Methods. In total, 50 μL of extracts were loaded onto a 6 mm paper disks.
Antibiotics 12 00641 g003
Figure 4. HPLC analysis showing the restoration of A40926 production in N. gerenzanensis Δdbv4 pIJ12551tei15*+ (a) and Δdbv3 pSET152Atei16*+ (b). N. gerenzanensis strains were cultivated for 144 h in FM2; A40926 was extracted as described in Materials and Methods and the extracts from Δdbv4, Δdbv4 pIJ12551tei15*+, Δdbv3, and Δdbv3 pSET152Atei16*+ were concentrated ten times by lyophilization. Peaks with a typical UV spectrum, corresponding to A40926 B0 and B1 (indicated by black arrows), were clearly visible in the control N. gerenzanensis ATCC 39727 (black). In (a), A40926 B0 and B1 were detectable, although at a very low level, in the concentrated extracts from N. gerenzanensis Δdbv4 pIJ12551tei15*+(red), but not in those from N. gerenzanensis Δdbv4 (green). In (b), A40926 B0 and B1 were detectable in Δdbv3 pSET152Atei16*+ concentrated extracts (red) but were undetectable in those from N. gerenzanensis Δdbv3 (green) (for the chromatogram of commercial A40926 standard please refer to Figure S2a).
Figure 4. HPLC analysis showing the restoration of A40926 production in N. gerenzanensis Δdbv4 pIJ12551tei15*+ (a) and Δdbv3 pSET152Atei16*+ (b). N. gerenzanensis strains were cultivated for 144 h in FM2; A40926 was extracted as described in Materials and Methods and the extracts from Δdbv4, Δdbv4 pIJ12551tei15*+, Δdbv3, and Δdbv3 pSET152Atei16*+ were concentrated ten times by lyophilization. Peaks with a typical UV spectrum, corresponding to A40926 B0 and B1 (indicated by black arrows), were clearly visible in the control N. gerenzanensis ATCC 39727 (black). In (a), A40926 B0 and B1 were detectable, although at a very low level, in the concentrated extracts from N. gerenzanensis Δdbv4 pIJ12551tei15*+(red), but not in those from N. gerenzanensis Δdbv4 (green). In (b), A40926 B0 and B1 were detectable in Δdbv3 pSET152Atei16*+ concentrated extracts (red) but were undetectable in those from N. gerenzanensis Δdbv3 (green) (for the chromatogram of commercial A40926 standard please refer to Figure S2a).
Antibiotics 12 00641 g004
Figure 5. Restoration of teicoplanin production phenotype in A. teichomyceticus Δtei16* upon introduction of pSHAD3, as revealed with HPLC. Black and blue chromatograms show the production profile of A. teichomyceticus NRRL B-16726 in TM1 and in E25, supplemented with 1g/L of l-valine, after 96 h cultivation, the red chromatogram shows the production profile of A. teichomyceticus Δtei16* pSHAD3+ in E25 added with 1g/L of l-valine at the same cultivation time point, while the green chromatogram demonstrates the absence of teicoplanin production in A. teichomyceticus Δtei16* cultivated in TM1 for 96 h. No production (superimposable profiles not shown) was observed with A. teichomyceticus Δtei16* pSHAD3+ in TM1 and with A. teichomyceticus Δtei16* in E25 + 1 g/L l-valine. Teicoplanin main peak (factor A2–2) is indicated with a black arrow (for the chromatogram of commercial teicoplanin standard, please refer to Figure S2b).
Figure 5. Restoration of teicoplanin production phenotype in A. teichomyceticus Δtei16* upon introduction of pSHAD3, as revealed with HPLC. Black and blue chromatograms show the production profile of A. teichomyceticus NRRL B-16726 in TM1 and in E25, supplemented with 1g/L of l-valine, after 96 h cultivation, the red chromatogram shows the production profile of A. teichomyceticus Δtei16* pSHAD3+ in E25 added with 1g/L of l-valine at the same cultivation time point, while the green chromatogram demonstrates the absence of teicoplanin production in A. teichomyceticus Δtei16* cultivated in TM1 for 96 h. No production (superimposable profiles not shown) was observed with A. teichomyceticus Δtei16* pSHAD3+ in TM1 and with A. teichomyceticus Δtei16* in E25 + 1 g/L l-valine. Teicoplanin main peak (factor A2–2) is indicated with a black arrow (for the chromatogram of commercial teicoplanin standard, please refer to Figure S2b).
Antibiotics 12 00641 g005
Figure 6. GPA production in N. gerenzanensis (a) and A. teichomyceticus (b) strains, expressing heterologous CSRGs. (a) A40926 production levels in FM2 medium by N. gerenzanensis ATCC 39727, N. gerenzanensis pSET152tei15*+, N. gerenzanensis pIJ12551tei15*+, and N. gerenzanensis pSET152tei16*+ after 144 h growth; A40926 was extracted and measured as described in Materials and Methods. (b) Teicoplanin production in TM1 medium by A. teichomyceticus NRRL B-16726, A. teichomyceticus pSAD4+, and A. teichomyceticus pSAD3+ after 96 h growth. Teicoplanin was extracted and measured as described in Materials and Methods. Data represent mean values of three independent experiments ± 2SD.
Figure 6. GPA production in N. gerenzanensis (a) and A. teichomyceticus (b) strains, expressing heterologous CSRGs. (a) A40926 production levels in FM2 medium by N. gerenzanensis ATCC 39727, N. gerenzanensis pSET152tei15*+, N. gerenzanensis pIJ12551tei15*+, and N. gerenzanensis pSET152tei16*+ after 144 h growth; A40926 was extracted and measured as described in Materials and Methods. (b) Teicoplanin production in TM1 medium by A. teichomyceticus NRRL B-16726, A. teichomyceticus pSAD4+, and A. teichomyceticus pSAD3+ after 96 h growth. Teicoplanin was extracted and measured as described in Materials and Methods. Data represent mean values of three independent experiments ± 2SD.
Antibiotics 12 00641 g006
Table 2. Oligonucleotide primers used in this work.
Table 2. Oligonucleotide primers used in this work.
NameNucleotide Sequence (5′-3′)Purpose
dbv3KO_RTTTACTAGTCCCCGATGAGCCTCGGTCCAmplification of dbv3 with 2 Kbp flanks
dbv3KO_FTTTAAGCTTGCCGATCAGACCGGTGCCG
dbv4KO_RCCTCGCGAGCTCGTAGCCGAmplification of dbv4 with 2 Kbp flanks
dbv4KO_FCGTGGAAGCGCAGTGCCTC
3/4KOVER_RGATATCCTGCCCGAGGCCGVerification of dbv3, dbv4, and dbv3–4 knockouts
3/4KOVER_FCCAGATGCTGCAGGCGCGA
dbv3_P1GCAAACCAAGTCGACGAACCGCTTGGGGGACGAGCAAGAATTCCGGGGATCCGTCGACCReplacement of dbv3 with oriT-aadA within A40Y
dbv3_P2GCCCGAGGCCGGCGAATTCGGCTTGTCGAACTCTTCGCTTGTAGGCTGGAGCTGCTTC
dbv4_P1CCCCGGCTCCGATATGACGCTAATCGAATCGGAGGCTAGATTCCGGGGATCCGTCGACCReplacement of dbv4 with oriT-aadA within A40Y
dbv4_P2GTCGCTCTACATACGGCCGCCCGGCTCATCCACTCGTGCTGTAGGCTGGAGCTGCTTC
dbv3_FWpIJAAAACATATGCTGTTCGGGCGAGATCGTCloning of dbv3 into pIJ12551
dbv3_RVpIJAAAAGCGGCCGCCTACAGCCGCACTGCCTC
dbv4_FWpIJAAAAAACATATGGACCCGACGGGAGTTGACATACloning of dbv4 into pIJ12551
dbv4_RVpIJTTTATTAGCGGCCGCTCATCCAGCGGCCAGATCGGTCG
tei15_FWpIJGGGCATATGACACCTGACGAAGAGCloning of tei15* into pIJ12551
tei15_RVpIJAAAAGCGGCCGCTCAGCTCGCCATC
pSET_ver_FGCATCGGCCGCGCTCCCGAVerification of tei15* and tei16* cloned into pSET152A
tei15*_ver_RCAGCTCAGCGCCGCTGAGCAVerification of tei15* cloned into pSET152Atei15*
tei16*_ver_RCTCGCACACGCCCGGGCCVerification of tei16* cloned into pSET152Atei16*
hygR_FGATACACCAAGGAAAGTCTAmplification of hygR
hygR_RTGTAGGCTGGAGCTGCTTC
aac(3)IV_FwACCGACTGGACCTTCCTTCTVerification of apramycin resistance cassette
aac(3)IV_RvTCGGTCAGCTTCTCAACCTT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Andreo-Vidal, A.; Yushchuk, O.; Marinelli, F.; Binda, E. Cross-Talking of Pathway-Specific Regulators in Glycopeptide Antibiotics (Teicoplanin and A40926) Production. Antibiotics 2023, 12, 641. https://doi.org/10.3390/antibiotics12040641

AMA Style

Andreo-Vidal A, Yushchuk O, Marinelli F, Binda E. Cross-Talking of Pathway-Specific Regulators in Glycopeptide Antibiotics (Teicoplanin and A40926) Production. Antibiotics. 2023; 12(4):641. https://doi.org/10.3390/antibiotics12040641

Chicago/Turabian Style

Andreo-Vidal, Andrés, Oleksandr Yushchuk, Flavia Marinelli, and Elisa Binda. 2023. "Cross-Talking of Pathway-Specific Regulators in Glycopeptide Antibiotics (Teicoplanin and A40926) Production" Antibiotics 12, no. 4: 641. https://doi.org/10.3390/antibiotics12040641

APA Style

Andreo-Vidal, A., Yushchuk, O., Marinelli, F., & Binda, E. (2023). Cross-Talking of Pathway-Specific Regulators in Glycopeptide Antibiotics (Teicoplanin and A40926) Production. Antibiotics, 12(4), 641. https://doi.org/10.3390/antibiotics12040641

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop